ID: 1087218686

View in Genome Browser
Species Human (GRCh38)
Location 11:95522353-95522375
Sequence ACGTGATAGGTGAAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087218686_1087218695 20 Left 1087218686 11:95522353-95522375 CCCACCAACTTCACCTATCACGT No data
Right 1087218695 11:95522396-95522418 TGTCACTTTTCCTCTTCCAAGGG No data
1087218686_1087218694 19 Left 1087218686 11:95522353-95522375 CCCACCAACTTCACCTATCACGT No data
Right 1087218694 11:95522395-95522417 GTGTCACTTTTCCTCTTCCAAGG No data
1087218686_1087218696 28 Left 1087218686 11:95522353-95522375 CCCACCAACTTCACCTATCACGT No data
Right 1087218696 11:95522404-95522426 TTCCTCTTCCAAGGGATGAGTGG No data
1087218686_1087218697 29 Left 1087218686 11:95522353-95522375 CCCACCAACTTCACCTATCACGT No data
Right 1087218697 11:95522405-95522427 TCCTCTTCCAAGGGATGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087218686 Original CRISPR ACGTGATAGGTGAAGTTGGT GGG (reversed) Intergenic
No off target data available for this crispr