ID: 1087220090

View in Genome Browser
Species Human (GRCh38)
Location 11:95537454-95537476
Sequence TTCCTTCACTACTTCATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087220090_1087220098 7 Left 1087220090 11:95537454-95537476 CCCTTCATGAAGTAGTGAAGGAA No data
Right 1087220098 11:95537484-95537506 AGGTTGAATAAAAGAGGGGAGGG No data
1087220090_1087220099 14 Left 1087220090 11:95537454-95537476 CCCTTCATGAAGTAGTGAAGGAA No data
Right 1087220099 11:95537491-95537513 ATAAAAGAGGGGAGGGCCACAGG No data
1087220090_1087220097 6 Left 1087220090 11:95537454-95537476 CCCTTCATGAAGTAGTGAAGGAA No data
Right 1087220097 11:95537483-95537505 AAGGTTGAATAAAAGAGGGGAGG No data
1087220090_1087220096 3 Left 1087220090 11:95537454-95537476 CCCTTCATGAAGTAGTGAAGGAA No data
Right 1087220096 11:95537480-95537502 GGCAAGGTTGAATAAAAGAGGGG No data
1087220090_1087220100 15 Left 1087220090 11:95537454-95537476 CCCTTCATGAAGTAGTGAAGGAA No data
Right 1087220100 11:95537492-95537514 TAAAAGAGGGGAGGGCCACAGGG No data
1087220090_1087220095 2 Left 1087220090 11:95537454-95537476 CCCTTCATGAAGTAGTGAAGGAA No data
Right 1087220095 11:95537479-95537501 CGGCAAGGTTGAATAAAAGAGGG No data
1087220090_1087220101 16 Left 1087220090 11:95537454-95537476 CCCTTCATGAAGTAGTGAAGGAA No data
Right 1087220101 11:95537493-95537515 AAAAGAGGGGAGGGCCACAGGGG No data
1087220090_1087220094 1 Left 1087220090 11:95537454-95537476 CCCTTCATGAAGTAGTGAAGGAA No data
Right 1087220094 11:95537478-95537500 ACGGCAAGGTTGAATAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087220090 Original CRISPR TTCCTTCACTACTTCATGAA GGG (reversed) Intergenic
No off target data available for this crispr