ID: 1087220876

View in Genome Browser
Species Human (GRCh38)
Location 11:95545146-95545168
Sequence TTTGATTTACTAGCTAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087220874_1087220876 -1 Left 1087220874 11:95545124-95545146 CCACAGAGGATGTAACATTGCTT No data
Right 1087220876 11:95545146-95545168 TTTGATTTACTAGCTAGGCCAGG No data
1087220873_1087220876 4 Left 1087220873 11:95545119-95545141 CCATGCCACAGAGGATGTAACAT No data
Right 1087220876 11:95545146-95545168 TTTGATTTACTAGCTAGGCCAGG No data
1087220872_1087220876 10 Left 1087220872 11:95545113-95545135 CCTCTGCCATGCCACAGAGGATG No data
Right 1087220876 11:95545146-95545168 TTTGATTTACTAGCTAGGCCAGG No data
1087220869_1087220876 16 Left 1087220869 11:95545107-95545129 CCCTAACCTCTGCCATGCCACAG No data
Right 1087220876 11:95545146-95545168 TTTGATTTACTAGCTAGGCCAGG No data
1087220870_1087220876 15 Left 1087220870 11:95545108-95545130 CCTAACCTCTGCCATGCCACAGA No data
Right 1087220876 11:95545146-95545168 TTTGATTTACTAGCTAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087220876 Original CRISPR TTTGATTTACTAGCTAGGCC AGG Intergenic
No off target data available for this crispr