ID: 1087222365

View in Genome Browser
Species Human (GRCh38)
Location 11:95560245-95560267
Sequence GCCCACTCCATAGTCACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087222363_1087222365 -7 Left 1087222363 11:95560229-95560251 CCTTGCTCCTGCAGAAGCCCACT No data
Right 1087222365 11:95560245-95560267 GCCCACTCCATAGTCACAACAGG No data
1087222362_1087222365 0 Left 1087222362 11:95560222-95560244 CCTGCTGCCTTGCTCCTGCAGAA No data
Right 1087222365 11:95560245-95560267 GCCCACTCCATAGTCACAACAGG No data
1087222361_1087222365 13 Left 1087222361 11:95560209-95560231 CCTTAGCAAATAGCCTGCTGCCT No data
Right 1087222365 11:95560245-95560267 GCCCACTCCATAGTCACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087222365 Original CRISPR GCCCACTCCATAGTCACAAC AGG Intergenic
No off target data available for this crispr