ID: 1087222582

View in Genome Browser
Species Human (GRCh38)
Location 11:95562478-95562500
Sequence CATTGACAGGAGATGCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087222579_1087222582 9 Left 1087222579 11:95562446-95562468 CCTGGGTCATATTCAGGGTTTAT No data
Right 1087222582 11:95562478-95562500 CATTGACAGGAGATGCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087222582 Original CRISPR CATTGACAGGAGATGCAGTG TGG Intergenic
No off target data available for this crispr