ID: 1087236330

View in Genome Browser
Species Human (GRCh38)
Location 11:95722953-95722975
Sequence ACTAGGGCCCCTTGGCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087236323_1087236330 16 Left 1087236323 11:95722914-95722936 CCAGATCTTGGTTTCTAATACCA 0: 35
1: 122
2: 211
3: 290
4: 488
Right 1087236330 11:95722953-95722975 ACTAGGGCCCCTTGGCAAAATGG No data
1087236322_1087236330 17 Left 1087236322 11:95722913-95722935 CCCAGATCTTGGTTTCTAATACC 0: 35
1: 115
2: 221
3: 350
4: 580
Right 1087236330 11:95722953-95722975 ACTAGGGCCCCTTGGCAAAATGG No data
1087236325_1087236330 -4 Left 1087236325 11:95722934-95722956 CCATTCTCCAGTAAAAGGAACTA No data
Right 1087236330 11:95722953-95722975 ACTAGGGCCCCTTGGCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087236330 Original CRISPR ACTAGGGCCCCTTGGCAAAA TGG Intergenic
No off target data available for this crispr