ID: 1087239200

View in Genome Browser
Species Human (GRCh38)
Location 11:95756654-95756676
Sequence AGGGAGAAGCAGGATTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087239193_1087239200 27 Left 1087239193 11:95756604-95756626 CCAAGGAGTTCTTTACTCAGTAT No data
Right 1087239200 11:95756654-95756676 AGGGAGAAGCAGGATTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087239200 Original CRISPR AGGGAGAAGCAGGATTATGA GGG Intergenic
No off target data available for this crispr