ID: 1087239339

View in Genome Browser
Species Human (GRCh38)
Location 11:95757602-95757624
Sequence AACATGGTGTTGAGGTTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087239339_1087239347 7 Left 1087239339 11:95757602-95757624 CCAAGGAACCTCAACACCATGTT No data
Right 1087239347 11:95757632-95757654 CCCTTGGCATTCTCAAACATGGG No data
1087239339_1087239345 6 Left 1087239339 11:95757602-95757624 CCAAGGAACCTCAACACCATGTT No data
Right 1087239345 11:95757631-95757653 ACCCTTGGCATTCTCAAACATGG No data
1087239339_1087239341 -9 Left 1087239339 11:95757602-95757624 CCAAGGAACCTCAACACCATGTT No data
Right 1087239341 11:95757616-95757638 CACCATGTTCCCGACACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087239339 Original CRISPR AACATGGTGTTGAGGTTCCT TGG (reversed) Intergenic
No off target data available for this crispr