ID: 1087241076

View in Genome Browser
Species Human (GRCh38)
Location 11:95780970-95780992
Sequence CTGTAAACAAGTACCAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087241074_1087241076 -10 Left 1087241074 11:95780957-95780979 CCTTAAGACTCAGCTGTAAACAA 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1087241076 11:95780970-95780992 CTGTAAACAAGTACCAAGTTGGG 0: 1
1: 0
2: 1
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087241076 Original CRISPR CTGTAAACAAGTACCAAGTT GGG Intronic
902910943 1:19596951-19596973 CTGGAAACAAGTCCCAGGTCAGG - Intergenic
903696597 1:25211969-25211991 CTGTAAAAAGGTACCAAGGCTGG - Intergenic
904870245 1:33613105-33613127 CTGAGACCAGGTACCAAGTTAGG + Intronic
905938607 1:41844644-41844666 TTGAAAACAAGTGCCAAGGTTGG + Intronic
906918118 1:50033613-50033635 CTGTAAATAAGTACCAGTTAAGG - Intergenic
907989545 1:59565961-59565983 CTGTGGTCAAGTACCAAATTTGG + Intronic
909883631 1:80912437-80912459 CTGCAAACAAGCACCATGCTAGG + Intergenic
910081391 1:83346649-83346671 CTATAATCAAGTATCAATTTTGG - Intergenic
910621962 1:89265466-89265488 CTCTAAAAAAGTGCAAAGTTTGG + Intronic
918183883 1:182110383-182110405 CTGTAAAAAAGTAGAAATTTAGG + Intergenic
918430290 1:184452598-184452620 CTGTGAACAAGTACAAATTGTGG - Intronic
1064388420 10:14920479-14920501 CTGTAAAGAAGTTTCAGGTTGGG - Intronic
1064875695 10:19991882-19991904 CTGTAAACAAGGACCAATCATGG - Intronic
1065451053 10:25857199-25857221 CTGTAAACTAGTGCAAAGATTGG - Intergenic
1066491474 10:35899040-35899062 CTGTAAATAAGTACAAGCTTGGG + Intergenic
1068906370 10:62328798-62328820 CTGTAATGAGGTACCAAATTGGG + Intergenic
1070461916 10:76678641-76678663 TTGTAAACAAGTGCCAAGGCTGG - Intergenic
1073158512 10:101369116-101369138 CTGTAAACAAGCACCTTTTTAGG + Intronic
1086289588 11:85292415-85292437 GTGAAAGCAAGTACCAAGTAAGG + Intronic
1086646387 11:89226852-89226874 TTGTAAGCAGGAACCAAGTTGGG - Intronic
1087241076 11:95780970-95780992 CTGTAAACAAGTACCAAGTTGGG + Intronic
1089151786 11:116369991-116370013 CTGTAAACAAGGACCAGGCTTGG - Intergenic
1095473860 12:42565451-42565473 CTTTGAAAAAGTACCAATTTGGG - Intronic
1097524535 12:60714642-60714664 CTTTATACATGTACCAACTTAGG + Intergenic
1098808823 12:75057570-75057592 CTATACACAATTACCAAGCTTGG + Intronic
1099501880 12:83423346-83423368 CTATAAAAAAGTACCAAACTGGG - Intergenic
1101497473 12:105268513-105268535 CTATAAACAAGACCCAAGTCTGG + Intronic
1103532737 12:121613682-121613704 CTATAAAGAAATACCAAGCTGGG + Intergenic
1103693752 12:122797436-122797458 TTGTAAACAAATAGCAAATTAGG + Intronic
1104579175 12:129997212-129997234 CTGGAAATAGATACCAAGTTTGG - Intergenic
1105738328 13:23295679-23295701 CTGTGAACAGGCACCAAGTGTGG - Intronic
1109922222 13:69080398-69080420 CTGAAAACAAATACACAGTTTGG + Intergenic
1110949459 13:81466578-81466600 CTCTATACAAGTAAGAAGTTTGG - Intergenic
1111306851 13:86425652-86425674 TTGTAAACAAGAAGCAAATTAGG - Intergenic
1112181555 13:97087014-97087036 CTTTAAACATGTACCATTTTAGG - Intergenic
1116105645 14:40500707-40500729 CTGTAAACAACTCCAAAGTACGG + Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1118124002 14:62878688-62878710 CTGTAACAAAGTACCAAGACTGG + Intronic
1119709844 14:76813587-76813609 TTGTAACCAAGTACCCAGCTTGG + Intronic
1120489080 14:85153667-85153689 CTCAAAACAATAACCAAGTTGGG + Intergenic
1127574347 15:60275291-60275313 CTGCATACATGTACCAATTTTGG - Intergenic
1128376617 15:67081068-67081090 CTCCAAACAGGTGCCAAGTTTGG - Intronic
1134379400 16:13710139-13710161 CTGTAAATAAATACCAAGACTGG - Intergenic
1141047821 16:80732857-80732879 CTCTAAACAAGGGTCAAGTTGGG + Intronic
1141241652 16:82270650-82270672 TTGGAAACAAGGACCAACTTGGG - Intergenic
1147445541 17:40473102-40473124 ATGAAAAGATGTACCAAGTTTGG - Intergenic
1149370384 17:55988262-55988284 CTGGAAACCAGGACCATGTTAGG + Intergenic
1155108307 18:22688818-22688840 CTGTAAAGAAATACCTAGCTGGG + Intergenic
1155437116 18:25825100-25825122 CAGCAAATGAGTACCAAGTTAGG - Intergenic
1160944459 19:1634768-1634790 CAGTACACAAGGACCAAGTCTGG + Intronic
925062268 2:902237-902259 ATGTAAACAACTACAAAATTGGG + Intergenic
925288856 2:2733417-2733439 CTGTAAGCAAGTGCGTAGTTTGG + Intergenic
925896139 2:8473727-8473749 CTGTAAAGAAGGACCATCTTAGG - Intergenic
928396990 2:30950291-30950313 CTTGAAACAAGTACCAAGTTGGG - Intronic
932465108 2:71916105-71916127 TTGGAAAGAAGAACCAAGTTTGG + Intergenic
936285562 2:111178695-111178717 AGGTAAAGAAGTACTAAGTTGGG + Intergenic
938841183 2:135165739-135165761 ATGAAAACAAGAACCGAGTTTGG + Intronic
938873121 2:135503184-135503206 CTGTAAACAAATACGAATTCTGG + Intronic
939133428 2:138265546-138265568 CTGTAAACAACAGCCAAGATTGG + Intergenic
939267995 2:139900257-139900279 GTTTAGACAAGTACCAAGCTAGG + Intergenic
939362980 2:141197669-141197691 CTGAAAACAAGTGACCAGTTAGG + Intronic
941799489 2:169641825-169641847 CTGTAAAACATTACCTAGTTTGG + Intergenic
942422848 2:175825700-175825722 TTGTAAACAATTAACAACTTGGG + Intergenic
943535508 2:189144273-189144295 CAGTAAACAAGTACATAGTTGGG + Intronic
1170709969 20:18781778-18781800 CTGGAAACATGTCCCAAGTCAGG - Intergenic
1175039684 20:56036644-56036666 CTTTAAACAAGTACCAATGAAGG - Intergenic
1176043429 20:63080215-63080237 CTGTAACCAAGGACCAAACTAGG - Intergenic
951861069 3:27253409-27253431 ATGGAAACAAGTACCATATTTGG + Intronic
953779842 3:45858195-45858217 CTGTTAAAAAGAACCAAGTATGG - Intronic
955729362 3:61968138-61968160 CCATAAACAAGTACTAAATTTGG + Intronic
956046748 3:65203716-65203738 CTGTAAACAAGGTCCAAACTAGG - Intergenic
956526050 3:70162958-70162980 CAGTAAACAAAAAACAAGTTGGG - Intergenic
956673621 3:71714617-71714639 TGGTAAACAAGTATGAAGTTCGG - Intronic
957779824 3:84804668-84804690 CTGTGAAGAAGCAACAAGTTTGG + Intergenic
960314919 3:116164976-116164998 CTTTAAAAAAGTAACAAGTGAGG - Intronic
967237592 3:187401013-187401035 CTGTAAACAAGTAAAAAACTGGG + Intergenic
969383755 4:6828057-6828079 CAGTAAAATATTACCAAGTTTGG - Intronic
970017109 4:11524203-11524225 CTGGAAACTAATACCAAATTAGG - Intergenic
970066907 4:12105575-12105597 TTGTAAACAAATACAAATTTTGG + Intergenic
973101775 4:46281277-46281299 CTGTACAAAAGTTCTAAGTTTGG + Intronic
974336145 4:60547300-60547322 TTGTAAACAAGTACTAAGCCTGG - Intergenic
974344651 4:60663162-60663184 CTGTAGACAAGTATCTTGTTGGG + Intergenic
975871921 4:78788586-78788608 ATAAAAACAAGTACCAATTTTGG - Intronic
977134495 4:93286384-93286406 TTGTAAATAAGTACTAAGCTTGG - Intronic
978010973 4:103683903-103683925 ATGTAAACAAATACCATTTTTGG - Intronic
978851585 4:113343667-113343689 CTCTAAACAGAGACCAAGTTAGG + Intronic
986812555 5:11375821-11375843 CTGAAAAAAGCTACCAAGTTGGG + Intronic
987605349 5:20127367-20127389 CTGTAAAGAACTACCAAGACTGG - Intronic
988135682 5:27168329-27168351 CTAAAAAAAATTACCAAGTTAGG + Intergenic
991408734 5:66326439-66326461 GTGTCAACAAGTACCAAGGCAGG - Intergenic
991512359 5:67393698-67393720 CTGCAAACCAGAACCCAGTTTGG + Intergenic
994370202 5:98959010-98959032 CTGTAAACATTTACAATGTTTGG + Intergenic
996631572 5:125639250-125639272 CAGTAAACATGTAAAAAGTTGGG - Intergenic
1000440789 5:161260689-161260711 CTGTAAATAATGAGCAAGTTTGG + Intergenic
1007158843 6:39772414-39772436 CAGTATGGAAGTACCAAGTTGGG - Intergenic
1009440101 6:63667656-63667678 TTGTAATCAAGGACCTAGTTTGG + Intronic
1011945999 6:92903997-92904019 ATGTGAACAAGTCCCAAGTCTGG - Intergenic
1011962801 6:93112370-93112392 TTGTAAAAATGTACCAAATTGGG - Intergenic
1012900698 6:105002878-105002900 CTGTAAAATACTACAAAGTTGGG + Intronic
1015352264 6:132234491-132234513 CTGTTACCAAGTTCCAATTTAGG - Intergenic
1016152300 6:140756747-140756769 CTATAAGCAAGTAGCAAGTGTGG - Intergenic
1017493357 6:154963249-154963271 GTGTAAACCAGTAAGAAGTTTGG + Intronic
1020603089 7:10301029-10301051 CTGTAAACAACTAAAAAGCTGGG - Intergenic
1027853025 7:83473045-83473067 CTATAAACAACTACCAAGATTGG - Intronic
1027931313 7:84538463-84538485 CTGGAATCAAGAACCAAATTGGG + Intergenic
1028994658 7:97086477-97086499 TTTTAAACAAGTACTAAGCTAGG - Intergenic
1033564192 7:142562663-142562685 CTGTAACCAGGTACCAAGTGTGG - Intergenic
1033650083 7:143334973-143334995 CAGTAACCAAGTACAAATTTTGG + Intronic
1034205418 7:149310427-149310449 CTGAAAAAAAATACCTAGTTTGG + Intergenic
1037437700 8:18880685-18880707 GTGTTAACAAGTTTCAAGTTTGG - Intronic
1037657987 8:20903284-20903306 CTGAAAAGAAGTAACATGTTCGG - Intergenic
1043256523 8:78145094-78145116 CTGTAGACAAATACTAACTTTGG + Intergenic
1043328961 8:79089534-79089556 GTATTAACAAGTACAAAGTTTGG + Intergenic
1044467097 8:92520196-92520218 CTGTAAACAAGCAGCAAACTCGG - Intergenic
1045200659 8:99977061-99977083 GTGTAAACAAGTCACAAATTGGG - Intronic
1048772134 8:137906171-137906193 CTCTCTACAAGTACTAAGTTGGG - Intergenic
1048847300 8:138613511-138613533 CTGTAACCAAGTACCATGAATGG - Intronic
1051615911 9:19006640-19006662 GTTTAAACAAGTACAGAGTTTGG + Intronic
1059922659 9:119176060-119176082 CTCTTAATAAGTACCAAGTTTGG - Intronic
1187682624 X:21782926-21782948 CTGTAACAAAGTACCAAACTGGG - Intergenic
1194230226 X:91313270-91313292 TTGTTAACAAATACCAAATTTGG + Intergenic
1195571866 X:106406191-106406213 TAGAAAACAAGAACCAAGTTAGG + Intergenic
1197645232 X:129010098-129010120 CTGTAAACAAGAATAAAGGTGGG - Intergenic