ID: 1087245716

View in Genome Browser
Species Human (GRCh38)
Location 11:95833995-95834017
Sequence CAAACTGAACATTTTCATCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 300}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087245716 Original CRISPR CAAACTGAACATTTTCATCT GGG Exonic
900974590 1:6009103-6009125 CTGACTGGACATTCTCATCTCGG + Intronic
904345575 1:29866600-29866622 CCTACTGAACATTTTCACCTGGG + Intergenic
905158763 1:36012766-36012788 CAAAATTAACATTTTCAGCTGGG + Intronic
905498032 1:38410935-38410957 CAAACTGAACTTTGTATTCTGGG - Intergenic
906284614 1:44578647-44578669 CAAACTGGACATTGTCCTCCAGG - Intronic
906708293 1:47910809-47910831 AAAACTCCTCATTTTCATCTGGG + Intronic
907279582 1:53337865-53337887 CAAACTAATCATCTTCATTTTGG + Intergenic
907766558 1:57418084-57418106 CAAACTGTGCAATTGCATCTTGG + Intronic
908499007 1:64724147-64724169 AAAAGTGAACATTTCCACCTTGG - Intergenic
909709535 1:78631367-78631389 CCCACTGAAGATTTTTATCTAGG - Intronic
909740967 1:79029463-79029485 CAAAGTCAAAATTTACATCTAGG - Intergenic
910646474 1:89520598-89520620 GAAACAGAATATTTTCATATTGG + Intergenic
912668100 1:111601154-111601176 CACACTGAACATTGTCATCGAGG - Intronic
913974106 1:143440425-143440447 GAACCTGAATATTTTCATCCAGG + Intergenic
914068495 1:144266039-144266061 GAACCTGAATATTTTCATCCAGG + Intergenic
914078344 1:144379067-144379089 CAAATTAAAAATCTTCATCTTGG + Intergenic
914100835 1:144587435-144587457 CAAATTAAAAATCTTCATCTTGG - Intergenic
914110660 1:144700315-144700337 GAACCTGAATATTTTCATCCAGG - Intergenic
914173251 1:145247597-145247619 CAAATTAAAAATCTTCATCTTGG + Intergenic
914298145 1:146350200-146350222 CAAATTAAAAATCTTCATCTTGG + Intergenic
914403857 1:147350158-147350180 TACACTGAACATTTTATTCTTGG + Intergenic
914527904 1:148488735-148488757 CAAATTAAAAATCTTCATCTTGG + Intergenic
914638484 1:149578329-149578351 CAAATTAAAAATCTTCATCTTGG - Intergenic
914705777 1:150168768-150168790 AAAACATAACATTTTCAGCTGGG - Intergenic
916036896 1:160930203-160930225 CAAACTTAACATTCTAGTCTGGG + Intergenic
917328077 1:173853669-173853691 CAAACTCCACAATTTCTTCTGGG - Intronic
917763663 1:178193656-178193678 CAAACAGGACATTTAAATCTAGG - Intronic
919723409 1:200865203-200865225 CCATCTCAACATTTTCACCTGGG + Intergenic
920688146 1:208125658-208125680 CAAACCGAATATTCTCAGCTTGG + Intronic
921116934 1:212100727-212100749 CCAAATGAAGATTTTCAACTTGG - Exonic
921204836 1:212839819-212839841 CAAACTGTACATTTTAAACATGG + Intronic
921483194 1:215687251-215687273 CAAACTTAAAATGTTCAGCTTGG + Intronic
921707793 1:218344435-218344457 CAAAGTCAACATTTTCATTTCGG - Intergenic
922580540 1:226694647-226694669 CAATATGAACATTTTGAACTGGG + Intronic
924184309 1:241471501-241471523 CTAACTCAACATTTGAATCTAGG - Intergenic
1063032079 10:2245424-2245446 TGAACTTAACATTTTCATCGAGG - Intergenic
1063284887 10:4675885-4675907 AAAACTGAACTTTTTCAATTAGG + Intergenic
1064938725 10:20709289-20709311 CATTCTGAAAATTATCATCTTGG - Intergenic
1064970325 10:21059331-21059353 CAATGTTAACATTTTCATCCTGG - Intronic
1065631793 10:27687759-27687781 CAGGCTGAACATTTTAAACTTGG - Intronic
1067038804 10:42937569-42937591 CATACGGAAAATTTTCATTTTGG - Intergenic
1067377257 10:45739221-45739243 CTAACTGAACTTTTTTGTCTTGG - Intronic
1067422586 10:46167926-46167948 AAAATTCAACAATTTCATCTAGG + Intergenic
1067884962 10:50079913-50079935 CTAACTGAACTTTTTTGTCTTGG - Intronic
1069184481 10:65405854-65405876 CATATTGAACATTTTCATATTGG - Intergenic
1070651176 10:78237656-78237678 CAAACTGAACTTGATCATTTTGG - Intergenic
1070860051 10:79647703-79647725 AAAATTCAACAATTTCATCTAGG + Intergenic
1071688189 10:87784899-87784921 TAAACTGAACCTTTTCATGAAGG - Intronic
1072169405 10:92845634-92845656 CTAACTGTACATTTTAATCATGG - Intronic
1072307545 10:94121920-94121942 CACACTGGACATTTCCAGCTGGG + Intronic
1072430437 10:95366454-95366476 AGCACTGAACATTTTCAGCTGGG + Intronic
1072449465 10:95528320-95528342 AAAATTAAAAATTTTCATCTGGG - Intronic
1073086235 10:100891116-100891138 CAAACTGCTCATTTTCCCCTAGG + Intergenic
1073646581 10:105310925-105310947 GAAGCTGAACGTTTTCATTTAGG + Intergenic
1074028515 10:109661876-109661898 CGAACTTCACATTTTCTTCTTGG - Intergenic
1074324282 10:112432782-112432804 CATACAGAACATTTCCATCATGG - Intronic
1074816028 10:117141032-117141054 CAAACTTAAAATTTGCATTTGGG - Intergenic
1076505061 10:130966512-130966534 TAAATTGAACTTTTCCATCTTGG - Intergenic
1078758981 11:14236474-14236496 GCCACTCAACATTTTCATCTGGG - Intronic
1080317894 11:30970767-30970789 CCAACTCAACCTTTTCATCAGGG + Intronic
1080358610 11:31484861-31484883 CAAATTTTACATTTGCATCTGGG - Intronic
1080549347 11:33358083-33358105 TAACATGAACATTTTCATTTAGG + Intergenic
1083281812 11:61631423-61631445 CATCCAGAACTTTTTCATCTTGG + Intergenic
1087245716 11:95833995-95834017 CAAACTGAACATTTTCATCTGGG + Exonic
1087403509 11:97698525-97698547 AAAACTGTACTTTTTAATCTAGG + Intergenic
1087600285 11:100305715-100305737 CCAAGTGAACATTTTCAACTGGG - Intronic
1087780385 11:102295368-102295390 CAATCTGAGCATTCTCAACTTGG + Intergenic
1087972111 11:104497151-104497173 CAAACTGAAGATTTTCATTTTGG + Intergenic
1088192602 11:107242063-107242085 GAAACTGACCATTATCATCTTGG + Intergenic
1088984245 11:114891464-114891486 CAAACTAAAAATTTTGATGTAGG - Intergenic
1092806706 12:12230393-12230415 GAAACTGAACATTTTCATTATGG - Intronic
1093163154 12:15772938-15772960 AAAACTAAACATTTTCCTTTTGG + Intronic
1093376953 12:18440872-18440894 ACTATTGAACATTTTCATCTGGG + Intronic
1094007050 12:25765234-25765256 CAAAATTAACATTTTCATCTGGG - Intergenic
1094035920 12:26071334-26071356 CAAATATAAAATTTTCATCTGGG + Exonic
1095467484 12:42503103-42503125 CAATCTGAATATTTTCACCTAGG + Intronic
1096140826 12:49241285-49241307 CAAAATGAACATGATAATCTTGG - Intronic
1102423416 12:112822000-112822022 CAAACAAAACATTTTCAGCCTGG + Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1102844430 12:116163967-116163989 AAAACTGAAAATGTTCTTCTTGG + Intronic
1106546139 13:30732422-30732444 AAAACTGGAAATTTTAATCTGGG + Intronic
1107623597 13:42259530-42259552 AAAACTGTAAATTTTCATCTTGG - Intergenic
1108073888 13:46658989-46659011 CAAATTTAACATTTTAATTTGGG + Intronic
1110042374 13:70779579-70779601 TAAACTGAACATTTTAACTTTGG + Intergenic
1110304398 13:73968567-73968589 CAAAATGAATACTCTCATCTTGG + Intronic
1110596377 13:77325522-77325544 CCAACTGAACATCTACATCAAGG + Intronic
1111021959 13:82461909-82461931 CACACTAAAAATTTTCATTTTGG + Intergenic
1112818576 13:103303277-103303299 CAATCAGAACATTTTCATAAAGG + Intergenic
1114310790 14:21465071-21465093 CAATTTGAAAATTTTCATTTGGG + Intronic
1114875545 14:26713141-26713163 AAAACTGGACTTTGTCATCTGGG + Intergenic
1114885326 14:26842689-26842711 CAGGCTGAACAATTTTATCTGGG - Intergenic
1115714657 14:36089696-36089718 CCAATTGCTCATTTTCATCTTGG + Intergenic
1115783186 14:36793889-36793911 CAAAATGAACATTTCACTCTAGG - Intronic
1118439429 14:65799296-65799318 AAAACTGAACAGTTTCAGCCAGG + Intergenic
1119048725 14:71345032-71345054 CATCCTGAACATTTTCCCCTGGG + Intronic
1119511354 14:75214028-75214050 GAAACTGCACATTTTCCTCCAGG - Intergenic
1121150626 14:91630466-91630488 CAAACTGAACATTTCCAATGTGG + Intronic
1121887659 14:97559429-97559451 CAACCTGGTCAGTTTCATCTGGG - Intergenic
1124413493 15:29455936-29455958 GCAACTGGACAGTTTCATCTGGG - Intronic
1125227868 15:37415466-37415488 ACAACTGAACATAATCATCTAGG + Intergenic
1125754715 15:42055660-42055682 CAATCTGGACATTTTAATTTAGG - Intergenic
1126228769 15:46300850-46300872 CCAACTGAAAATTGTTATCTAGG + Intergenic
1128164470 15:65451058-65451080 CAAAATGGACATTCTCATCCAGG + Exonic
1129044642 15:72723577-72723599 CAAACTAAACATTGTCAAATGGG - Intronic
1133989142 16:10691375-10691397 CACCCTGAATATTTTCCTCTTGG - Intronic
1134301637 16:12996765-12996787 CAAACAGAACAGCTTCCTCTAGG + Intronic
1134374507 16:13659321-13659343 CAAATCAAACATTTGCATCTGGG + Intergenic
1134798527 16:17063473-17063495 CATTCTGAACATTATTATCTGGG + Intergenic
1137083163 16:36091344-36091366 CTAACTGAAAACTTTCATCAGGG + Intergenic
1137834857 16:51582447-51582469 AAAAATGATGATTTTCATCTAGG - Intergenic
1138209216 16:55148998-55149020 CAAACTGTGCATGTACATCTGGG + Intergenic
1140319714 16:73937796-73937818 AAAACTGAGCATCCTCATCTTGG - Intergenic
1144417443 17:15064500-15064522 CAAACTGAAAATATTCAGGTGGG - Intergenic
1146050376 17:29546758-29546780 CATACTGTACATTTCCATCAGGG + Exonic
1150930329 17:69577875-69577897 CAAAATTAACATTTTTAACTAGG - Intergenic
1151128794 17:71874234-71874256 GAAACTGAAAATTTTTATCTAGG + Intergenic
1151241081 17:72758445-72758467 GAAACTGAATATTTTTATCCAGG - Intronic
1151510096 17:74552982-74553004 CCTACTGAACATGTTCACCTAGG + Intergenic
1151510652 17:74557343-74557365 CCTACTGAACATGTTCACCTAGG + Intergenic
1152173744 17:78772164-78772186 CACTCTGAAGACTTTCATCTTGG + Intronic
1157438395 18:47690569-47690591 CAAACTGAATTTTTCCATATTGG + Intergenic
1157578579 18:48759982-48760004 CATCCTAAACATTTTCATCAGGG + Intronic
1157628835 18:49076127-49076149 CAAAGTAAATATTTTCATTTGGG + Intronic
1158226037 18:55202531-55202553 CAGACTGTACATCTTTATCTGGG + Intergenic
1158227979 18:55220135-55220157 CAAACTGAAAATTTTCACTCTGG - Intergenic
1161917247 19:7237938-7237960 ATAACTGAACATTTTGATTTTGG - Intronic
1164958758 19:32408316-32408338 CCAACTTCACATTTTCTTCTTGG - Exonic
925713355 2:6763058-6763080 AAAATTGAGCATTTTCACCTTGG - Intergenic
926233494 2:11022341-11022363 CAAACTGAAGATTTTGAAGTTGG + Intergenic
927578123 2:24217360-24217382 CAGACTGAAAATTTCCTTCTTGG - Intronic
928466061 2:31523587-31523609 AAAACTCAACATTTTCTTCAAGG + Exonic
928468252 2:31544945-31544967 GAATCTGAACTTTTTCATGTAGG - Intronic
928563666 2:32519392-32519414 CAGACAGAACATTTTCCCCTAGG + Intronic
929374136 2:41263680-41263702 AAAACTGAACATCTTCATGGTGG - Intergenic
931080820 2:58768467-58768489 CAAAATGAACAGTTTCCTGTTGG - Intergenic
933227974 2:79772946-79772968 CAAACATAACATTTTATTCTAGG + Intronic
933262859 2:80149853-80149875 GTAACTAAACATTTGCATCTTGG - Intronic
934127318 2:88909178-88909200 CAAAGTGAACATATTCTTTTGGG - Intergenic
934178809 2:89601389-89601411 GAACCTGAATATTTTCATCCAGG + Intergenic
934289096 2:91675675-91675697 GAACCTGAATATTTTCATCCAGG + Intergenic
935303078 2:101711011-101711033 CATCCTGAACATTCTCATATGGG + Intronic
936102392 2:109593982-109594004 GAATCTGAATTTTTTCATCTAGG - Intronic
936714533 2:115170665-115170687 CAAACCCAACATCTTCATCAGGG + Intronic
938627102 2:133122631-133122653 CCAACAGAAATTTTTCATCTAGG + Intronic
938916992 2:135951850-135951872 CAAACTGCACATTTTTTTCAAGG + Intronic
939044521 2:137234310-137234332 AACACTGAAAAATTTCATCTGGG + Intronic
939106295 2:137952431-137952453 AAAAATGAACATTGTCAACTTGG - Intergenic
939525461 2:143288271-143288293 CATACTGACCATTTTCCCCTTGG + Intronic
940656006 2:156488939-156488961 CAAACACAAAATTTTTATCTTGG - Intronic
942488820 2:176469087-176469109 CAAACTCAAGATTTTCAAGTTGG - Intergenic
942614956 2:177781981-177782003 TAAAATTAACATTTTAATCTGGG - Intronic
942912148 2:181257277-181257299 CATACTGTACATTTTCTTCTTGG - Intergenic
943599402 2:189896376-189896398 CAAAATGTACATTTTCCCCTAGG - Intronic
945414006 2:209548288-209548310 CAAACTTCATATTTTTATCTAGG + Intronic
946188492 2:217994966-217994988 CAAACTCCTCATTTTCATGTGGG - Intronic
947564993 2:231188095-231188117 CAAACCAAACATTTTTAGCTGGG - Intergenic
947798948 2:232915030-232915052 AAAAAAGAACATTTTCATCAAGG + Intronic
948555544 2:238807513-238807535 CAAACTGCTCATTTTCATAATGG + Intergenic
948973008 2:241443720-241443742 CAAATTGAACAGTGTCATCTAGG - Intronic
1168824258 20:798784-798806 CCAACCAAACATTTACATCTTGG - Intergenic
1168848453 20:960647-960669 CAAACTGAACCTTTCTCTCTAGG + Intronic
1169551422 20:6705438-6705460 CAAACTGAACTTTATAAGCTGGG - Intergenic
1169999527 20:11598959-11598981 AAATCTGTCCATTTTCATCTAGG - Intergenic
1170306994 20:14949159-14949181 TAAAGTGAACATTTTGGTCTTGG - Intronic
1170788051 20:19484733-19484755 TAGGCAGAACATTTTCATCTTGG - Intronic
1170800141 20:19583899-19583921 CTAACTGAGGATTTTGATCTAGG - Intronic
1171461810 20:25302292-25302314 CAAACTGAACTTTGAAATCTCGG + Exonic
1174463708 20:50701014-50701036 CAATCTGACCATTCTCATCAGGG - Intergenic
1176691771 21:9920089-9920111 CAAACTGAACAGTTTTCTCTGGG - Intergenic
1177508525 21:22050696-22050718 AATACTGAAAATTTTCTTCTTGG + Intergenic
1182432513 22:30308374-30308396 CAACCTGAAGATCTTCATCCTGG + Intronic
1182865066 22:33597363-33597385 AATACTGGACATTTTCTTCTGGG - Intronic
1184600778 22:45542112-45542134 CAAACTAAAGGTTTTCATCATGG + Intronic
949763072 3:7494813-7494835 CAAACTGCAGACTTTCATCAAGG - Intronic
949844836 3:8358758-8358780 AAAGCAGAACATTTTCATCTGGG - Intergenic
950816641 3:15710812-15710834 CAAAATGAACATTTTTTTCCTGG + Intronic
951314862 3:21177804-21177826 CAAACTGAACAATTTAATAGAGG - Intergenic
952096791 3:29963525-29963547 CACAATGAACATTTTCACATTGG + Intronic
954478192 3:50769473-50769495 CAAAGTGGGCATCTTCATCTAGG - Intronic
955090737 3:55748242-55748264 TAAACTGAATATGTTCCTCTAGG + Intronic
955555155 3:60128920-60128942 CAAACTGAAGCAATTCATCTTGG - Intronic
955585917 3:60477765-60477787 CATAGTAAACATTTTTATCTTGG + Intronic
955792361 3:62601832-62601854 GAAAGTGAACACTTTGATCTGGG + Intronic
958747624 3:98155976-98155998 CAAAGTGAAGATCTTCAACTGGG - Intergenic
959044643 3:101459796-101459818 CAACCTTAACATTTTCTTTTTGG - Intronic
960475468 3:118119038-118119060 CAAACTGACCTTTTTCTACTGGG + Intergenic
961792486 3:129386135-129386157 CAAACTGAATATTCTCAGCCAGG - Intergenic
961968623 3:130934123-130934145 GAAACTGAAGATTTTCCTCAAGG - Intronic
963120121 3:141769175-141769197 CAAACTGAACACCTTCTTCCAGG + Intergenic
963817770 3:149852025-149852047 TAAGCTGAACATTTTTATCCAGG - Intronic
965676573 3:171203628-171203650 CAAACTCAACATATTTATCATGG + Intronic
965841784 3:172913753-172913775 CACACTGATAATTTTTATCTTGG - Intronic
965980943 3:174689574-174689596 CTACCTGGAGATTTTCATCTAGG - Intronic
966561584 3:181326458-181326480 AAAATTGAACATTTTCATACTGG - Intergenic
969830457 4:9792023-9792045 GAACCTGAATATTTTCATCCAGG - Intronic
970717972 4:18949890-18949912 CAAAGAGAACTTTTTCATTTTGG + Intergenic
971591018 4:28469513-28469535 CCAGATGAACATTTTTATCTTGG + Intergenic
972655643 4:41061019-41061041 CACACTAAACATTTTCAGCAGGG + Intronic
972704310 4:41526734-41526756 CAAACTTAACATATTCAAATGGG + Intronic
973228455 4:47813924-47813946 TAAAATGAACATTCTCATTTTGG - Intronic
973791481 4:54382100-54382122 CAAACTGAACTTTTTAAGCAAGG - Intergenic
974595329 4:64007507-64007529 CAAACTAAAGATTTTTTTCTAGG - Intergenic
975571557 4:75823110-75823132 CAAAGTTAACACTTTCATATAGG - Intergenic
977084641 4:92577457-92577479 CAAAATGAACTTAGTCATCTGGG + Intronic
978357765 4:107895124-107895146 AATACTGAACAGTTTTATCTTGG - Intronic
979137282 4:117125476-117125498 CAAACTGTCCATCTTTATCTTGG - Intergenic
979247249 4:118521948-118521970 CAAAAACTACATTTTCATCTGGG - Intergenic
979497823 4:121404575-121404597 AAGACTGTACATTTGCATCTAGG + Intergenic
980077053 4:128305031-128305053 GAAACTGATCATTTGCATCCAGG + Intergenic
980364353 4:131780295-131780317 CAAACTGAACAATTTTCTCTGGG - Intergenic
983294377 4:165847341-165847363 AAAACTCAGTATTTTCATCTGGG + Intergenic
983708456 4:170686917-170686939 CCAACTGGGCATTTGCATCTTGG - Intergenic
983743615 4:171166995-171167017 AAAACAGAAGAATTTCATCTGGG + Intergenic
984075067 4:175166735-175166757 CAACTTCAACATTTTCATTTTGG - Intergenic
984305794 4:177988742-177988764 CAAACTGAACCTCTTCATCGAGG - Intronic
986474912 5:8119378-8119400 CAAAGTCTCCATTTTCATCTTGG + Intergenic
986989294 5:13532884-13532906 GAAGCTGAACATTTCCATCATGG - Intergenic
988213008 5:28230979-28231001 AAATCTCAACATTTTCCTCTTGG + Intergenic
988219692 5:28327380-28327402 CAAACTCAACAAATTCATTTGGG + Intergenic
989314255 5:40058863-40058885 CCAACTGAACATCTTCCTTTTGG + Intergenic
990060869 5:51646791-51646813 CAAAGTTACCATTTTCATCAAGG - Intergenic
991648840 5:68830588-68830610 CAGAGTGAAAATATTCATCTTGG - Intergenic
992174784 5:74139378-74139400 CAAAGTCCACATTTTCATTTTGG - Intergenic
993386725 5:87269864-87269886 CCATCTCAACATTTTCATCAAGG - Intronic
993673443 5:90789719-90789741 CAAACTGAACAACTCCATTTGGG - Exonic
993830570 5:92752733-92752755 CTCACTGAACATTCCCATCTGGG - Intergenic
994402077 5:99293649-99293671 CATATTGAACATTTTCTACTCGG - Intergenic
994557418 5:101320878-101320900 CAAACCCACCATTTTCATATTGG + Intergenic
995958626 5:117811652-117811674 CATAGTAAACATTTTCATCTTGG + Intergenic
996920641 5:128763870-128763892 CAAACTAACCACATTCATCTTGG - Intronic
997001802 5:129770502-129770524 CCACCTGAACATTTCCATCCTGG + Intergenic
997107650 5:131039040-131039062 TAAACAGAACATTTCCATCTTGG - Intergenic
997875937 5:137546912-137546934 CAAACTTAACATTTTGATAAAGG + Intronic
997934072 5:138095625-138095647 CAATCTGAACATCTTTATCTAGG - Intergenic
998649552 5:144102752-144102774 TAAACAGAACATTTTAATGTGGG + Intergenic
999693053 5:154165577-154165599 TAAACTGAACATTTCCTCCTTGG - Intronic
1000071695 5:157745765-157745787 CATACTGAAAATTTTCACCATGG + Intronic
1002900648 6:1407169-1407191 CAGACTTAACATTTTCATGTGGG - Intergenic
1003102865 6:3190532-3190554 CAACCTGAACCTTTGCATTTGGG + Intergenic
1003800142 6:9654958-9654980 CAAACTGAACTTGTGAATCTTGG - Intronic
1004173439 6:13317396-13317418 AAAGCTTTACATTTTCATCTAGG + Intronic
1005196662 6:23295209-23295231 CACACTGAAAATTTTCATGTGGG + Intergenic
1005461953 6:26077832-26077854 CCAACTGGGCATTTGCATCTTGG - Intergenic
1008693480 6:54007005-54007027 CAAACTGGATCTTTTCTTCTGGG + Intronic
1011441719 6:87394233-87394255 TAAAATGAAAATTTTCAGCTGGG + Intronic
1012019039 6:93892792-93892814 CAGACTCAATATTTTCCTCTGGG + Intergenic
1012538447 6:100328472-100328494 CGAACTGAACATCCTCATCTGGG + Intergenic
1013054014 6:106565399-106565421 GAATCTGGACATTTTCATCAGGG + Intronic
1013772473 6:113643167-113643189 CAAACCAAATATTTGCATCTGGG + Intergenic
1014756284 6:125304797-125304819 TAAACTGAAGATGTTCATCAGGG + Intergenic
1015095769 6:129413769-129413791 CAAACTGTACATTTTCCTGTTGG - Intronic
1015571616 6:134626870-134626892 CAAAGTGAACACTATTATCTTGG + Intergenic
1016174908 6:141069053-141069075 GAAACTGAACATTTGCATATGGG - Intergenic
1016576252 6:145572545-145572567 GAAACTGAACATTTGCATATGGG - Intronic
1017167870 6:151426634-151426656 GAAACTTAACATTTCCATTTTGG + Intronic
1018592402 6:165441930-165441952 AAAACTGTTCATTTTTATCTAGG + Intronic
1019156968 6:170045728-170045750 CAAACTCAACATTTTCAGTGTGG + Intergenic
1020368260 7:7403719-7403741 CATAATGAAAATATTCATCTAGG + Intronic
1020571583 7:9870461-9870483 CTAACTGAGCAGTTTCATTTGGG + Intergenic
1020679757 7:11221893-11221915 CCAACTGAAAATTTTAGTCTTGG - Intergenic
1021035905 7:15798242-15798264 CAGACAAATCATTTTCATCTAGG - Intergenic
1021238007 7:18166948-18166970 CTAACTGATCATACTCATCTAGG - Intronic
1024779091 7:52825446-52825468 CAAAATAAATAATTTCATCTTGG - Intergenic
1024867766 7:53923224-53923246 AAAACTGAACATTTTCTTAAAGG + Intergenic
1025552225 7:62265160-62265182 CAAACTGCAAACTTTCATCAGGG + Intergenic
1025558031 7:62334234-62334256 CTAACTGCAAATTTTCATCAGGG + Intergenic
1025836832 7:65102309-65102331 CAAACTGAAGATTTACCTCCAGG - Intergenic
1025906611 7:65791745-65791767 CAAACTGAAGATTTACCTCCAGG - Intergenic
1027650288 7:80858393-80858415 ATAACTAAACATTTTCCTCTGGG - Intronic
1028007281 7:85590777-85590799 AAGACTGAATATTTTCATTTAGG - Intergenic
1028038402 7:86016073-86016095 TAAAATGAACATTTTAGTCTTGG + Intergenic
1028483264 7:91331333-91331355 CAAAGAGAACATTTTCAACTAGG - Intergenic
1029209047 7:98890403-98890425 GAAACTGAACTTCTCCATCTTGG - Exonic
1029234063 7:99098301-99098323 CAAAATGAGCATTTTCCTATGGG + Intronic
1030263322 7:107589367-107589389 ACAACTGGACATTCTCATCTGGG + Intronic
1031241898 7:119256139-119256161 CAAAGTGAACCTTTTCATGTTGG + Intergenic
1032277694 7:130474198-130474220 GAAAAGGAACATTTTCAGCTTGG - Intergenic
1032357677 7:131225543-131225565 CAAAGTGAATGTTTTTATCTTGG - Intronic
1032648150 7:133848377-133848399 CAAGTTGAACATTTTCACATGGG - Intronic
1035772368 8:2157982-2158004 CAGACAGAACAAGTTCATCTGGG - Intronic
1035834905 8:2739719-2739741 GAAACTGAGGATTTTCTTCTGGG - Intergenic
1036025092 8:4898269-4898291 CAAAATGAACATTTTATTTTTGG - Intronic
1038093235 8:24278158-24278180 CAAATTAACCAGTTTCATCTTGG + Intergenic
1038207190 8:25477777-25477799 CAAACTGAACATAGTCAAATAGG + Intronic
1038953155 8:32438121-32438143 GATACAGAACATTTTCATCCAGG + Intronic
1039360883 8:36875605-36875627 GAAACTGGACATTTTTATTTTGG - Intronic
1041061948 8:54043218-54043240 TCAAATGAAAATTTTCATCTAGG - Intergenic
1041597623 8:59675419-59675441 AAAACTGAGCATTTTAATATTGG - Intergenic
1041959883 8:63600988-63601010 CAAATTCAATAGTTTCATCTTGG + Intergenic
1042650724 8:71038136-71038158 CAAATTGAACTTTGTCAGCTTGG + Intergenic
1043356736 8:79422615-79422637 CATACTGAACATTTTCATCAAGG - Intergenic
1044760967 8:95517146-95517168 CACACTGGACATTGTCATCCTGG + Intergenic
1047373228 8:124273412-124273434 CAAAGGGAAACTTTTCATCTGGG + Intergenic
1047535611 8:125717137-125717159 CAACCGGGACATTTCCATCTCGG - Intergenic
1048056884 8:130875526-130875548 CAAAATGCACATTTTTGTCTTGG - Intronic
1048113457 8:131493007-131493029 AAAACTGAACAATTTTCTCTTGG - Intergenic
1048621551 8:136138698-136138720 CAAAATCAGCATTTCCATCTTGG - Intergenic
1050340536 9:4633341-4633363 CAATCTGACCATTCTCAACTTGG + Intronic
1050641630 9:7674361-7674383 CAAAGTGAAAAATTACATCTAGG + Intergenic
1050742555 9:8839267-8839289 CAATCTGAAAATTATCATCTAGG - Intronic
1051638218 9:19200713-19200735 CAATCTGAGCATTCTCAACTTGG - Intergenic
1052456283 9:28702846-28702868 CAAATTGCACTATTTCATCTCGG + Intergenic
1053777357 9:41560162-41560184 CAAACTGAACAATTTTCTCTGGG + Intergenic
1054364375 9:64318324-64318346 CAAACTGAACAATTTTCTCTGGG - Intergenic
1054712357 9:68523960-68523982 CAAACTGAACTTCTTACTCTGGG - Intronic
1054893350 9:70278190-70278212 GACAGTGATCATTTTCATCTTGG + Intronic
1054923499 9:70565254-70565276 ACAAATAAACATTTTCATCTTGG + Intronic
1055193277 9:73553777-73553799 CATATGGAACATTTTCATTTTGG + Intergenic
1055275342 9:74609656-74609678 AAAACTGAACTTTATCAGCTGGG + Intronic
1056103483 9:83323515-83323537 CAAACTGAATATATTCATGAAGG - Intronic
1056582085 9:87896477-87896499 CAAAATGAAAATTTTTGTCTAGG + Intergenic
1057328187 9:94086160-94086182 CAACCTGTACTTTTTCATATTGG + Intronic
1058601202 9:106672333-106672355 CATATTGAATATTGTCATCTAGG + Intergenic
1059505113 9:114791548-114791570 CAGACTGAAAATTTTCTTATAGG + Intronic
1060863965 9:126980174-126980196 AAAACTGAAAATTTTCCTCTTGG + Intronic
1060956295 9:127643162-127643184 CAAACTTTATATTTTCATTTAGG + Intronic
1061004161 9:127918888-127918910 CAAAGTGAAGATCTTTATCTGGG - Intergenic
1185796584 X:2970545-2970567 ATAACTTAACATTTTCATATGGG + Intergenic
1186608474 X:11115227-11115249 CCAAATGAATATTTTCTTCTGGG + Intronic
1186906139 X:14112816-14112838 CAAACAGAACACTGACATCTAGG - Intergenic
1187280860 X:17857811-17857833 CAGACTGTACCCTTTCATCTTGG - Intronic
1193829478 X:86271635-86271657 CAAAATGTACATTTTGATTTGGG + Intronic
1194319822 X:92431341-92431363 CAAACACAGCATTATCATCTAGG - Intronic
1194361677 X:92959867-92959889 CAAACAGAACTTCTTCAACTAGG + Intergenic
1194655018 X:96562182-96562204 AAAATTGAGCCTTTTCATCTAGG + Intergenic
1194714957 X:97277443-97277465 CATACCTAACATTTTCTTCTAGG - Intronic
1195043876 X:101038639-101038661 CAAACAGAACATTTCCATTGTGG - Intronic
1195936447 X:110130324-110130346 CAGACTGCCCATTTTCATCCTGG + Intronic
1198787291 X:140302934-140302956 CATCCTGAACATTTTACTCTGGG + Intergenic
1198798659 X:140427151-140427173 CAACCTGAATCTTATCATCTTGG - Intergenic
1200500149 Y:3938823-3938845 AAAAGTGAAAATTATCATCTGGG - Intergenic
1200627948 Y:5544474-5544496 CAAACACAGCATTATCATCTAGG - Intronic
1200669868 Y:6075743-6075765 CAAACAGAACTTCTTCAACTAGG + Intergenic
1201679653 Y:16629831-16629853 CAAACTGAGGATTTTAATATAGG - Intergenic
1201903944 Y:19070426-19070448 CAATCAGAACATTTTCTTATAGG - Intergenic
1202029787 Y:20559617-20559639 CCAACTGAAGATTTCCAGCTGGG - Intergenic