ID: 1087250718

View in Genome Browser
Species Human (GRCh38)
Location 11:95896146-95896168
Sequence GAGGTGATATTTCAGTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087250718 Original CRISPR GAGGTGATATTTCAGTTGAG AGG (reversed) Intronic
901012538 1:6209750-6209772 GAGGTGACATTTAAGGTGACGGG + Intronic
902046679 1:13529940-13529962 GAGCTGATGTTTCTGTTGGGGGG + Intergenic
902697113 1:18147510-18147532 GAGGTGACATTTCAATGGGGTGG - Intronic
903843948 1:26265641-26265663 GAGCTGATACTTCAGTTCAGAGG + Intronic
906207101 1:43992605-43992627 CAGGAGATATTCCAGATGAGAGG + Exonic
907350861 1:53829717-53829739 TATGTAATATGTCAGTTGAGGGG - Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909397922 1:75191571-75191593 GAGCTGAGATTTCTGTTCAGTGG - Intergenic
909519273 1:76548223-76548245 GAGGGGACATTTAAGTTGAGAGG - Intronic
911049256 1:93655735-93655757 GAGCTGATTTACCAGTTGAGAGG - Intronic
911533662 1:99075768-99075790 GAGGTAATATTTGAGTTGAGAGG - Intergenic
911789707 1:101997696-101997718 GGGGGGATATTTCAGCTGGGGGG - Intergenic
911896603 1:103443701-103443723 GACTTGCTCTTTCAGTTGAGAGG + Intergenic
916117171 1:161495877-161495899 TAGGTCATATTGCAGTAGAGTGG + Intergenic
916343023 1:163757723-163757745 GAGGTCATATTTGATTAGAGTGG + Intergenic
917043268 1:170829887-170829909 GAGCCAATATTTCAGGTGAGTGG - Intergenic
917640694 1:176980581-176980603 GAGGTGAGATCTAGGTTGAGTGG + Intronic
917713249 1:177708906-177708928 GAGGTTGTGTTTCAGGTGAGAGG - Intergenic
918882790 1:190147493-190147515 GAATTGATATTTTATTTGAGAGG - Intronic
918970382 1:191407762-191407784 GAGGTTGTATTTCAGTTGTTAGG - Intergenic
922553644 1:226516747-226516769 TAGTTAATATTTCAGTTGAATGG + Intergenic
1065939457 10:30551043-30551065 GAGGAGATGTTTGAGTTAAGTGG + Intergenic
1065957797 10:30708439-30708461 TAGCAGAAATTTCAGTTGAGTGG + Intergenic
1066357381 10:34698094-34698116 AAGTTGATATTTAAGTTGATTGG - Intronic
1068574935 10:58674655-58674677 GAGGTGATATAGCAGCTCAGAGG + Intronic
1068828367 10:61465365-61465387 AAGTTGATATTTCAGTTCAAAGG + Intergenic
1071916333 10:90297971-90297993 GATGGGATATTGCCGTTGAGCGG - Intergenic
1074740912 10:116483624-116483646 GATGGGATATTGGAGTTGAGCGG - Intergenic
1074900506 10:117812507-117812529 GAAGTGGTCTTTCAGTTGACTGG - Intergenic
1075101627 10:119510270-119510292 GTGGTGAAAGTTCAGTTGGGAGG - Intronic
1080767339 11:35309115-35309137 GGGGAGATATTTCAGCTGAGAGG - Intronic
1087250718 11:95896146-95896168 GAGGTGATATTTCAGTTGAGAGG - Intronic
1087554164 11:99693449-99693471 GAGGAGGTATTTGAATTGAGGGG + Intronic
1088527736 11:110774745-110774767 GAGGTGATATTACACTTAACTGG - Intergenic
1089810764 11:121129623-121129645 GACTTGATTTTTCAGTTGAATGG + Exonic
1091083898 11:132701353-132701375 AAGGTGAGATTTCAGTGTAGAGG + Intronic
1091994189 12:4979996-4980018 CATGTGTTATTTCATTTGAGAGG + Intergenic
1097335671 12:58380160-58380182 GAGGAGCTATTCCAGTTAAGGGG - Intergenic
1098266369 12:68724975-68724997 GAGGTGACATTTCATTTCAGAGG + Intronic
1098553985 12:71797807-71797829 GAAGTGATGTTTCAGCTCAGTGG + Exonic
1099673902 12:85732040-85732062 GAGTTAATATTTAAGTTGACGGG - Intergenic
1100399793 12:94219304-94219326 AAAATGATATTTCAGTTCAGTGG + Intronic
1101350359 12:103924747-103924769 AAAGTGATATTTCAGTTCAGAGG - Intergenic
1106300962 13:28465113-28465135 GAGGTAATTTTGCAGCTGAGGGG - Intronic
1106630208 13:31463795-31463817 GACTTGATATTTCAGTTCTGAGG - Intergenic
1106853650 13:33822597-33822619 GAGGTGCTATTTCAAATCAGTGG + Intronic
1108150285 13:47526616-47526638 GAGGTGATATTTATATTGAAGGG + Intergenic
1109112644 13:58342114-58342136 GAGGCAATATTTCAGCTGAATGG - Intergenic
1110745328 13:79046579-79046601 CAGGTGATATAGCAGTGGAGGGG + Intergenic
1112090748 13:96080734-96080756 GAGAAGCTATTTCAGTTGAGTGG + Intergenic
1114144703 14:19961437-19961459 GAGTTGATATTTCAAATTAGTGG - Intergenic
1116351325 14:43867411-43867433 GCTGTGATATTGCATTTGAGGGG + Intergenic
1116608115 14:47029491-47029513 GACATGATATTTCTGTTAAGCGG - Intronic
1118102568 14:62623308-62623330 AAGGTCATATTGCAGTTGACAGG - Intergenic
1119067965 14:71549741-71549763 GAGGGCAAGTTTCAGTTGAGAGG - Intronic
1119438738 14:74613922-74613944 GAGCTGATATTTAATCTGAGAGG - Intergenic
1119522838 14:75298805-75298827 GAGGGGAGATTTTAGTAGAGAGG + Intergenic
1119648677 14:76367696-76367718 GAGGTGAGATTTCACCTGAGAGG + Intronic
1121546597 14:94767948-94767970 GAGGTACCATTGCAGTTGAGAGG - Intergenic
1123813142 15:23949431-23949453 TCTGTGATATTTCAGTTCAGTGG + Intergenic
1126558859 15:50021559-50021581 GAGGTAATATTTGAACTGAGAGG - Intronic
1128093426 15:64934433-64934455 GAGCTAATAATTCAGTTCAGAGG - Intronic
1131372490 15:91894417-91894439 GTGGTGGTATCTCAGGTGAGGGG + Intronic
1131846809 15:96497111-96497133 GAGGAGACATTGGAGTTGAGGGG + Intergenic
1133550549 16:6850410-6850432 GAGGTGATGTTCAAGCTGAGGGG + Intronic
1133679761 16:8109917-8109939 GAGGTGATATATGAGTTAAGAGG - Intergenic
1138013722 16:53410489-53410511 GAAGAGATATTTCACTTAAGAGG + Intergenic
1138793400 16:59937010-59937032 GCAGTGATATATCAGTTTAGTGG - Intergenic
1139187311 16:64822116-64822138 GAGGTGAGACCTCATTTGAGAGG - Intergenic
1139833455 16:69819515-69819537 GAGGTGATATTTCAGTGGACTGG - Intronic
1140339917 16:74147456-74147478 GATGTGATATTGCAGATTAGTGG - Intergenic
1141824077 16:86466989-86467011 GAGCTGTTATTTCAGTTTATAGG + Intergenic
1146184100 17:30713716-30713738 GAGGTGATATTTCAAGAGGGTGG - Intergenic
1146292248 17:31616899-31616921 AAGGTGATATTTCAATTTGGTGG + Intergenic
1146428430 17:32766177-32766199 AAGGTGACATTTCAGCTGGGCGG - Intronic
1146526549 17:33571933-33571955 GAGGTGAAATTCCAGGTGAGAGG + Intronic
1147675981 17:42205962-42205984 GAGGTGTTATTTTACTAGAGTGG - Intronic
1148583528 17:48760422-48760444 GAGGTGATATTTGAGGTGGCAGG - Intergenic
1148698205 17:49573700-49573722 GAGGTGATACTGCAGTTGTGAGG - Intergenic
1149526206 17:57357689-57357711 GACTTGATTTTTCAGTTGAGGGG + Intronic
1151925006 17:77188924-77188946 GAAGTGATATCTCACCTGAGAGG - Intronic
1155918110 18:31575813-31575835 GAAATAATATTTCACTTGAGAGG - Intergenic
1156317089 18:35980034-35980056 GAGGGGAAATTTCAATTAAGAGG + Intergenic
1157399269 18:47373492-47373514 GAGGTGGTAATTCAGGTAAGAGG - Intergenic
1158439698 18:57464396-57464418 GTGTTGAAATTTCAGATGAGGGG - Intronic
1162974682 19:14201965-14201987 GAGGTGATATTTCAAGAGGGTGG + Intronic
1168453327 19:56483369-56483391 GGGGTAATCTTTTAGTTGAGTGG - Intergenic
925287681 2:2726621-2726643 GAGGTGATATTTGATCAGAGAGG - Intergenic
925427778 2:3764974-3764996 GAGATGATGTTTCTGTTGTGAGG + Intronic
926437970 2:12856697-12856719 GAGGTGATATTTCAGTCCTGAGG - Intergenic
926972607 2:18481975-18481997 GAGTTGATATTTTAGGTGATGGG + Intergenic
927907294 2:26868599-26868621 GAAGTGATATTTCAATTCAGTGG - Intronic
929380695 2:41348708-41348730 GAGTTGGCATTTCAGTTGAATGG - Intergenic
932519477 2:72394891-72394913 TAAGTGAAATTACAGTTGAGAGG - Intronic
933431085 2:82180220-82180242 GAGGTGATATATCATTGTAGAGG + Intergenic
933587031 2:84190386-84190408 GAGGAGATATTTCATTGGTGAGG - Intergenic
934542607 2:95188552-95188574 GATGTGATTTTCCAGTTGAATGG + Intergenic
934903868 2:98182187-98182209 GAGGTGACACTGCATTTGAGGGG - Intronic
937523240 2:122736640-122736662 GAGGAAAGATTTCAGGTGAGAGG - Intergenic
938487667 2:131729080-131729102 AAGGTGATATTTCTGTTAGGAGG - Intronic
941758812 2:169218387-169218409 GAGGTGACATTTCAGCTTGGTGG - Intronic
941945272 2:171089538-171089560 AAGGTGATATTGCAGTGCAGTGG - Intronic
943496940 2:188631813-188631835 GAGGAAAAATTTCAGCTGAGAGG - Intergenic
945487637 2:210416682-210416704 GAGATGATATTTCATTTGGATGG + Intergenic
945800291 2:214420405-214420427 GTAGAGATATCTCAGTTGAGGGG + Intronic
946155982 2:217806898-217806920 GAGGGGCTATTTCAGGGGAGGGG - Intronic
948669002 2:239554578-239554600 AAGGTGATATTTCAAATCAGTGG + Intergenic
1168815443 20:733683-733705 GAGGAGGCATTTCAGTGGAGAGG + Intergenic
1172028295 20:31964521-31964543 GAGGTGATGTTCCAGTGGTGGGG - Intergenic
1174580749 20:51569850-51569872 GAGTTGATATTTTAGTTGGGAGG - Intergenic
1176056041 20:63149808-63149830 GAGGGGACATTTCGGTTGTGGGG - Intergenic
1177843964 21:26267512-26267534 CAGGTGATATTTCAAATTAGAGG - Intergenic
1178371934 21:32033550-32033572 AAGGTGATTTTTCAGTAAAGAGG - Intronic
1179729313 21:43358787-43358809 GGTGTGCTATTTCAGTTTAGTGG + Intergenic
1181413723 22:22744923-22744945 CAGGTGATATTTCAGGAGATGGG + Intronic
1182036673 22:27203897-27203919 GAAGGGTTATTTCAATTGAGAGG - Intergenic
1182091485 22:27598083-27598105 GGGGTGAAGTTTCAGTGGAGGGG - Intergenic
1183921702 22:41174744-41174766 GAAGTGGTAATTAAGTTGAGAGG + Intronic
949440801 3:4078130-4078152 GAGGTCATATTTCGGCTCAGTGG - Intronic
950359979 3:12443317-12443339 GAGGTGACATTTGAGATGAGTGG + Intergenic
952172423 3:30822712-30822734 GAGGTGACATATCAGTTAACTGG - Intronic
952289516 3:32001830-32001852 TGGGTGTTATTTCAATTGAGTGG - Intronic
954983304 3:54765840-54765862 GAGGTGATGTGTCAGATCAGTGG + Intronic
955120026 3:56048952-56048974 GAGGTGATATCTAAGGAGAGTGG + Intronic
955269896 3:57486937-57486959 GAGGTAATATTCAAGGTGAGGGG + Intronic
955857897 3:63293852-63293874 GAGGTCATATTAGAGTGGAGTGG - Intronic
956129711 3:66041474-66041496 GAGGTGAGAGTTGAGTGGAGAGG - Intergenic
956826158 3:72997934-72997956 GAGGTGGTAATTTGGTTGAGAGG + Intronic
957544654 3:81622014-81622036 TAGGTGATAGTTCAGCTGATGGG - Intronic
958576261 3:95952623-95952645 GAGCTGATATCTCAGCTGAGGGG + Intergenic
961204934 3:125074454-125074476 GAGCTGAAATGGCAGTTGAGTGG + Intergenic
962628337 3:137249761-137249783 GAGCTGAGACTTCAGCTGAGGGG - Intergenic
962936665 3:140087786-140087808 GAGGTGAATTTTGAGTTAAGTGG + Intronic
963578462 3:147094349-147094371 GAGGTGATAATTTAATTGTGAGG + Intergenic
965252990 3:166367005-166367027 GAGGTGATATTTCATTGTAGGGG + Intergenic
967131145 3:186471787-186471809 GTGGTGTTATTTGAGTTAAGTGG + Intergenic
969913054 4:10462407-10462429 AAGGTGATTTTTGAGTTGAGAGG - Intergenic
975222832 4:71833145-71833167 GAGGAAATAATTCAGCTGAGGGG + Intergenic
975288194 4:72645248-72645270 GAGGTGATTTTGCTCTTGAGTGG - Intergenic
975602869 4:76121205-76121227 AAGGTGGTATTTCAATTCAGTGG - Intronic
977044072 4:92047300-92047322 GAAGTGATAGTTCAGGTCAGGGG + Intergenic
977849883 4:101814010-101814032 GAGATGATATTTCTTTAGAGGGG + Intronic
978673830 4:111285420-111285442 GAGGTGATATTACAAATAAGTGG + Intergenic
981602660 4:146508209-146508231 CATGTGATTTTTCAGATGAGTGG - Intronic
981775193 4:148359158-148359180 CAGATGATATTTAAGTTGAATGG - Intronic
982107662 4:152024788-152024810 GAGGTCCTATTGCAGTAGAGTGG + Intergenic
983219838 4:165033352-165033374 GAGTTGGTAATTCAGTTGTGAGG + Intronic
984436569 4:179717721-179717743 GAGGAAATAATTCAGCTGAGGGG - Intergenic
984896363 4:184544711-184544733 AAAGTGATATTTGAGGTGAGTGG + Intergenic
987223979 5:15820598-15820620 GAGGAGATAATTCACTTGAAAGG - Intronic
987836680 5:23171328-23171350 GAGGTTATATATCAATTCAGGGG + Intergenic
988621792 5:32830379-32830401 GAGGTGATATTTGTGATGTGAGG + Intergenic
989699457 5:44244495-44244517 GAGATGAGATTACAGATGAGTGG - Intergenic
990739727 5:58900109-58900131 TAGGTGATATTTGATATGAGAGG + Intergenic
992361853 5:76046791-76046813 GAGGAGTTACTGCAGTTGAGAGG - Intergenic
992669139 5:79041380-79041402 GATGTGATATGATAGTTGAGTGG + Intronic
993088995 5:83400414-83400436 GAGCTAAGATTTCAGTTGAGTGG - Intergenic
993600450 5:89917486-89917508 AAGGTGACATTTCAGATCAGTGG + Intergenic
994719177 5:103361309-103361331 GAGATGATATTTTAGTTTAAGGG + Intergenic
995345476 5:111111109-111111131 GAGGTGAGATTTTAGTTCAAGGG + Intronic
997674628 5:135703579-135703601 GAAGTGATATTTTTGCTGAGAGG - Intergenic
1000962561 5:167617641-167617663 TAGGGGATATTAGAGTTGAGTGG - Intronic
1002096453 5:176834140-176834162 GAGCTGATACTCCAGTGGAGGGG + Intronic
1003689967 6:8344228-8344250 AAGGAGATATTTCAGTAGAATGG + Intergenic
1006323297 6:33333858-33333880 GAGGTCATACTGGAGTTGAGTGG + Intergenic
1007786673 6:44284180-44284202 GGGGAGCTATTTCAGTGGAGTGG - Intronic
1008292619 6:49736364-49736386 GAGGTGATATTGCAAAGGAGAGG - Intronic
1009161272 6:60285947-60285969 GAGGTCACATTGGAGTTGAGAGG - Intergenic
1015397963 6:132756269-132756291 GATGGGATGTTTCAGTAGAGAGG - Intronic
1015416634 6:132956555-132956577 GTGCTGATATTTCACTTGATTGG + Intergenic
1016957773 6:149643065-149643087 GAGCTGGTATTCCATTTGAGTGG - Intronic
1019914276 7:4122440-4122462 GAGCTGCTATTTCCATTGAGGGG - Intronic
1023036040 7:36132141-36132163 GAGGTGAAATTTGAGATGACAGG + Intergenic
1023593989 7:41809733-41809755 GAGTTAACATTTCAGTTGGGAGG - Intergenic
1027158448 7:75784898-75784920 GATGGGATATTGCCGTTGAGCGG - Intronic
1028485329 7:91351053-91351075 GAACTGATATGTCATTTGAGAGG - Intergenic
1030171511 7:106607422-106607444 GAGATGGTAAGTCAGTTGAGTGG - Intergenic
1030624747 7:111832165-111832187 CAGGTGATATTTTAATAGAGAGG + Intronic
1030735593 7:113044087-113044109 GAGTTAATATTTTAGTAGAGTGG + Intergenic
1030791586 7:113736296-113736318 GAGGTGAAAATTCAGTTCATTGG + Intergenic
1030907220 7:115201070-115201092 AAGGTGATAATTCTATTGAGTGG - Intergenic
1031843993 7:126782156-126782178 GAGTCTTTATTTCAGTTGAGAGG + Intronic
1032328264 7:130952186-130952208 AAGGTGGTATTTCAAATGAGTGG + Intergenic
1033044815 7:137952423-137952445 AAGGTGACATTTGAGTTGAAAGG - Intronic
1033195813 7:139326364-139326386 AAGGTGATATTTGAGCTGAGAGG - Intergenic
1033618194 7:143037685-143037707 GCCCTGATATTTCAGATGAGGGG - Intergenic
1034846107 7:154446857-154446879 GAAGTGCTATTGGAGTTGAGAGG + Intronic
1035627169 8:1079700-1079722 GAGGTTATAATCCAGTTGGGAGG + Intergenic
1035741868 8:1934567-1934589 GAGGTGACATTTCAATTCAGTGG + Intronic
1039268044 8:35849453-35849475 GAGATGATATTTCATCTTAGAGG - Intergenic
1043347911 8:79321686-79321708 AAGGTAAGATTTCAGTTGAATGG + Intergenic
1044301104 8:90584075-90584097 GAGGTGAAATTTTAATGGAGTGG - Intergenic
1044955371 8:97474792-97474814 GAGTTGAGATTACAGTTGTGAGG - Intergenic
1045181655 8:99790782-99790804 GAGGCGATATTCCAGCTAAGAGG + Intronic
1048072110 8:131032030-131032052 CAGCTGATTTTTCAGTTGACTGG - Intronic
1049041345 8:140114176-140114198 GAGGTGTTAGTTTAGGTGAGGGG - Intronic
1049365249 8:142233935-142233957 GAGGTGAGATTTGAGCTGGGAGG - Intronic
1050037705 9:1454636-1454658 GAGGTGATATTTGAGTGATGAGG + Intergenic
1052047825 9:23814761-23814783 GAGGTGATATGGCAGGTGAGGGG - Intronic
1052867920 9:33476993-33477015 GAGGTGATATTTATGCTGAGAGG - Intergenic
1054799243 9:69330322-69330344 TGGGAGATATTTCAGATGAGTGG + Intronic
1055590777 9:77811650-77811672 CAGGTCCTATTTCTGTTGAGAGG + Intronic
1056778761 9:89533643-89533665 GTGGTGATATTTCAGGTGGTTGG + Intergenic
1058846967 9:108970409-108970431 GAGGAGACATTTCAGGTGACTGG - Exonic
1059355286 9:113694546-113694568 GAGGTGATATTTGGGTCGTGGGG + Intergenic
1062702073 9:137912418-137912440 GAGGTAGCATTTCAGTGGAGAGG + Intronic
1187226725 X:17380281-17380303 GAGGTGCCATTTCATTGGAGGGG + Intronic
1187306934 X:18104199-18104221 GATGTGAGAATTCGGTTGAGGGG - Intergenic
1187333291 X:18360362-18360384 GAAGTGACATTTGAGTTGAGAGG + Intergenic
1187765408 X:22636444-22636466 GAGGTGGTAGTTCAGCTTAGGGG + Intergenic
1187968931 X:24640218-24640240 GTGGTGATGTTTCAGTGAAGTGG - Intronic
1190442352 X:50487396-50487418 CAGATGAGAATTCAGTTGAGTGG - Intergenic
1194293490 X:92102980-92103002 GATGGGATATTGCCGTTGAGCGG + Intronic
1195381120 X:104271941-104271963 GAGGAAATATTTCAGATGAAAGG - Intergenic
1196657581 X:118235130-118235152 GAGGTGATACTGGAGTAGAGTGG - Intergenic
1196940112 X:120767169-120767191 GAGCTTGTACTTCAGTTGAGAGG + Intergenic
1197403788 X:126026449-126026471 CAGGTCATATTTCAGTAGGGTGG + Intergenic
1198176708 X:134163689-134163711 GAGGTGACATTTGAGTAGATGGG - Intergenic
1198684928 X:139218324-139218346 AAGGTGATGTTTCATTTCAGTGG + Intronic
1200611010 Y:5327526-5327548 GATGGGATATTGCCGTTGAGCGG + Intronic