ID: 1087250863

View in Genome Browser
Species Human (GRCh38)
Location 11:95898053-95898075
Sequence ATGTAGTATTTGAAAGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 732
Summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 663}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087250863 Original CRISPR ATGTAGTATTTGAAAGAAAA AGG (reversed) Intronic
900235820 1:1589912-1589934 TTGTGGTATTTTAGAGAAAAAGG + Intergenic
900712933 1:4126169-4126191 ATCTATTCTTTGAATGAAAAAGG - Intergenic
901366833 1:8759356-8759378 ATGAAGAATTAGAAAGAAAAAGG + Intronic
903597480 1:24506505-24506527 CTGAAGTATTTGGAAGTAAAAGG + Intronic
904221411 1:28972986-28973008 ATGTGGTCTTTGGATGAAAATGG - Intronic
904264191 1:29308714-29308736 ATATATTTTTTAAAAGAAAAAGG - Intronic
906241566 1:44245342-44245364 TTGTAGTCTTTGAATGAAGAGGG - Intronic
907291670 1:53417638-53417660 ATACAGCATTTGAAAGAAATTGG + Intergenic
907884622 1:58581298-58581320 ATAATGTAGTTGAAAGAAAATGG + Intergenic
908279574 1:62517708-62517730 ATCAAGTATTAGAAAGAACATGG + Intronic
908916804 1:69137456-69137478 ATAAAGTATTTGATAAAAAAAGG + Intergenic
909166687 1:72235129-72235151 ATGTTGAATATGAAAGAACATGG + Intronic
909195346 1:72614530-72614552 ATGGAGTATTTTAAAAAAATAGG + Intergenic
909684803 1:78335864-78335886 ATGTAATAATTGGAAGAACAAGG - Intronic
910014997 1:82511219-82511241 TTGTTGTATTTGCAATAAAAGGG + Intergenic
910499319 1:87871334-87871356 ATCTAGTATCTGAAACAAACTGG + Intergenic
910897755 1:92085996-92086018 ATGTAGGGGTTGAAAGAAAGTGG + Intronic
911232125 1:95372648-95372670 ATTGAGTATCTGAAAGGAAAGGG + Intergenic
911622088 1:100076397-100076419 TTGTTGACTTTGAAAGAAAAAGG + Intronic
911643864 1:100318308-100318330 ATGCAGTAGGTTAAAGAAAAAGG + Intergenic
911886114 1:103301744-103301766 ATCTAGTAATAGAAAGTAAATGG + Intergenic
912054013 1:105571837-105571859 ATTTAGTATTATAAACAAAATGG - Intergenic
912118110 1:106432776-106432798 AAGTGGCATTGGAAAGAAAAAGG + Intergenic
913454335 1:119015615-119015637 ATGTAGAAATAGAAAGAAAATGG - Intergenic
914372227 1:147037026-147037048 ATGTTGTATTTAAAATAATATGG - Intergenic
914463146 1:147903211-147903233 TTGTAGAATTTGAGTGAAAAGGG - Intergenic
914577286 1:148985819-148985841 ATGTTGTATTTAAAATAATATGG + Intronic
915170767 1:153975712-153975734 ATGGAATATCTGAAAGAAGAGGG - Intronic
915618407 1:157060704-157060726 ATGCAGTACTTGAAGGAGAACGG - Intergenic
915788209 1:158639258-158639280 ATCTGGTATTTGAAAGAAAGTGG - Intronic
915952171 1:160196776-160196798 ATATTGTATTAGAAAGAACATGG - Intronic
916374677 1:164139440-164139462 ATGAAGTCTTTGAAGGAAAAGGG + Intergenic
916676599 1:167069098-167069120 ATGTAGTTTTTGTTTGAAAACGG + Exonic
916964498 1:169922008-169922030 AGGTACTATTTGAAACAAAGTGG + Intronic
917385294 1:174466453-174466475 ATAAAATATTTGAAACAAAAGGG - Intronic
917606770 1:176639225-176639247 CTCTAGTATTTGGAACAAAAAGG - Intronic
918574372 1:186038815-186038837 ATGTAATAACTGAAAGAAGAAGG - Exonic
918867065 1:189915407-189915429 ATTTTGTATTTGAAAAAGAAAGG - Intergenic
918972740 1:191440712-191440734 ATGTTGTAGTTGGAAGAATAGGG - Intergenic
919618192 1:199833907-199833929 ATGCAGTATTAGGAATAAAAAGG - Intergenic
919660884 1:200245190-200245212 AAGTTTTATTTCAAAGAAAAGGG - Intergenic
920018178 1:202930627-202930649 ACCTAGTATTTGATAGAACAGGG - Intergenic
921121057 1:212138026-212138048 ATCTAGTATTTGATAGCACAAGG + Intergenic
921374501 1:214459953-214459975 CTGTAGTAAAAGAAAGAAAACGG - Intronic
921486629 1:215722863-215722885 ATTTGGGATTTTAAAGAAAAAGG - Intronic
921664983 1:217858303-217858325 ATTTAATTTTTGAAAGAACATGG + Intronic
923216738 1:231855535-231855557 ATGTTGTAAATGCAAGAAAAGGG - Intronic
923366797 1:233269538-233269560 ATCTAGGATTACAAAGAAAATGG + Intronic
923398218 1:233588557-233588579 AGGTTTTATTTAAAAGAAAAAGG + Intergenic
923638894 1:235731414-235731436 ATTTAATAGTTGAAAGAAACTGG - Intronic
923728308 1:236526411-236526433 TTGTAGTTTTTAAAGGAAAATGG + Intronic
923936520 1:238766484-238766506 ATGTAGAATTTGATATAGAAAGG + Intergenic
924191695 1:241559717-241559739 ATGTTGAATTTGAAAAAAATGGG - Intronic
1062942162 10:1431786-1431808 GTGTAGTTTTTAAAAGAATAAGG + Intronic
1063063851 10:2588789-2588811 AGGAATTACTTGAAAGAAAAAGG - Intergenic
1063906760 10:10788256-10788278 AAGTAGTTTTAGAAAAAAAAAGG - Intergenic
1064740878 10:18432893-18432915 ATGTTGTATTTCAAAGCAATAGG + Intronic
1064740927 10:18433599-18433621 ATCTAGTATTTGCATGAGAAAGG - Intronic
1064790854 10:18956577-18956599 ATGTAGAAATGGATAGAAAAGGG - Intergenic
1064805634 10:19127889-19127911 TTGTGATATTTAAAAGAAAATGG + Intronic
1064809352 10:19177441-19177463 ATGTAGTATTTGGAGGTATAGGG + Intronic
1064859403 10:19811164-19811186 ATGGAATATTGGAAATAAAAAGG + Intergenic
1065099294 10:22318017-22318039 AGGTAGTATTTGAAAATAAATGG - Intronic
1065274356 10:24070244-24070266 AGGCATTATTTGAAAGATAATGG + Intronic
1065775297 10:29114114-29114136 AGGTAGAATTTTGAAGAAAAAGG + Intergenic
1066105489 10:32152817-32152839 ATGTAGTTATTGAAGGAAATTGG - Intergenic
1067606353 10:47666991-47667013 ATGGGAAATTTGAAAGAAAATGG - Intergenic
1068596689 10:58909622-58909644 ATCTATTATTTGGGAGAAAAAGG - Intergenic
1069003913 10:63296828-63296850 ATGAAGTTCTTAAAAGAAAAGGG + Intronic
1069286299 10:66719950-66719972 AAGTAGCAAGTGAAAGAAAAGGG + Intronic
1069806387 10:71127656-71127678 AGATAGCATTTGAAAGAAAACGG - Intergenic
1070448589 10:76534137-76534159 ATGTAATATGTTAAAGAGAATGG - Intronic
1070943415 10:80367417-80367439 ATGTGGGAGTTGAAAGAAAGTGG + Exonic
1070951952 10:80438127-80438149 ATGTAGGATGTGACAGAAAGAGG + Intergenic
1071135979 10:82455166-82455188 ATATATTATCTGAAAGTAAATGG - Intronic
1071444911 10:85736450-85736472 AGGTAGTATTGGAAGGCAAAAGG + Intronic
1071621913 10:87128344-87128366 ATGGGAAATTTGAAAGAAAATGG - Intronic
1071662446 10:87518327-87518349 ATCTACTATTAGAAATAAAAAGG - Intronic
1071779283 10:88824932-88824954 AAGTTCTATTTGAAATAAAAGGG + Intronic
1071884839 10:89938480-89938502 ATGTAGAATGTGAAAGATCAAGG - Intergenic
1072489117 10:95886490-95886512 AAGTAGTATTTGACCTAAAATGG + Intronic
1073199549 10:101724151-101724173 ATTTAGTATATGACAGAAACTGG - Intergenic
1073538846 10:104301743-104301765 CTCTATTATTTAAAAGAAAAGGG - Intronic
1074316749 10:112368261-112368283 CCTTAGTATGTGAAAGAAAAGGG - Intergenic
1077740204 11:4837979-4838001 TTGTTGTATATGCAAGAAAAAGG + Intronic
1077750949 11:4968921-4968943 ATGTTGTTTAGGAAAGAAAAAGG - Intronic
1077823412 11:5776087-5776109 ATGTTGTATTTGAAAGCACTAGG - Intronic
1079697802 11:23505284-23505306 AGGTAGAAATAGAAAGAAAAGGG - Intergenic
1080548317 11:33344155-33344177 ATGTACTATTTGAAATTAAATGG + Intronic
1080761735 11:35257046-35257068 GTGTAGTATTTGCAAAAACATGG + Exonic
1081245577 11:40762617-40762639 ATGTAGTATTTTGATGAAAAGGG + Intronic
1081361241 11:42181407-42181429 GTGTATTATTTGAAAAGAAAAGG + Intergenic
1082737493 11:56873022-56873044 TGGTTGGATTTGAAAGAAAATGG - Intergenic
1084789928 11:71467795-71467817 AGGCGGTATTTGAAAGAAAATGG + Intronic
1084913925 11:72413432-72413454 ATGAAGTATTTGGAGGTAAAGGG - Intronic
1085905432 11:80755408-80755430 AAGTAGTGGTTGACAGAAAATGG - Intergenic
1086157118 11:83679633-83679655 ATGTTGATTTTGAAAGAAATTGG - Intronic
1086379733 11:86239754-86239776 AGATAGTATTTGAAAGCTAAAGG + Intergenic
1086592089 11:88526758-88526780 ATCTAGTATTTGAAGAAAAATGG + Intronic
1086744382 11:90406427-90406449 ATATAGCATTTAAAAAAAAATGG + Intergenic
1087135847 11:94719149-94719171 ATGTAGTATATGAAAAAAATTGG - Intronic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087250863 11:95898053-95898075 ATGTAGTATTTGAAAGAAAAAGG - Intronic
1087321493 11:96665145-96665167 ATTTAGTTTCTGAATGAAAATGG - Intergenic
1087369883 11:97270161-97270183 CTGCAGAATTTCAAAGAAAAAGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088073460 11:105818030-105818052 ATGTGGAATTAGAAAGACAAAGG + Intronic
1091267711 11:134283534-134283556 TTGTGGGATTTGAAAGGAAACGG - Intronic
1091345618 11:134851595-134851617 ATTTACTATCTGAAATAAAAGGG + Intergenic
1091427354 12:402677-402699 ATGTATTTTATTAAAGAAAATGG + Intronic
1092373763 12:7938445-7938467 ATTTAGTATCTAAAGGAAAAAGG + Intergenic
1092520273 12:9265195-9265217 ATCTCTTATATGAAAGAAAATGG + Intergenic
1093118520 12:15240165-15240187 ATTAAGGATTTGAAAGAAAATGG + Intronic
1093215199 12:16353679-16353701 AAGTACTACTTGAAAAAAAAGGG - Intronic
1094239891 12:28210522-28210544 ATGAAGTCTTTGGAAGAACAGGG + Intronic
1094785558 12:33844840-33844862 ATCTAGTATTTGATAGCACAAGG - Intergenic
1095296087 12:40529315-40529337 ATGTAATATTTCAAAATAAAAGG - Intronic
1095373769 12:41501976-41501998 ATGTAGGATTAGAAAAAAAGTGG - Intronic
1095643723 12:44517309-44517331 TTGTAGTTTTTGATAGATAAAGG + Intronic
1096432523 12:51558658-51558680 ATGTAGTTCTTGTGAGAAAATGG - Intergenic
1096447779 12:51709812-51709834 ATGTGGTTTTTAACAGAAAAGGG + Intronic
1096880280 12:54662041-54662063 ATGGGGTCTTTGATAGAAAAGGG - Intergenic
1097242920 12:57588542-57588564 CTGTTGTGTTTGAAAGAAGAGGG - Intergenic
1097533240 12:60832650-60832672 ATGCAGAAAATGAAAGAAAAGGG - Intergenic
1097622003 12:61950205-61950227 ATGTAGTATTGCTATGAAAAAGG + Intronic
1097937790 12:65272977-65272999 ATGTGGAATGTGAAAGAAGAAGG - Intergenic
1098368616 12:69734071-69734093 ATATAGAATTTGATAGAAGAAGG - Intergenic
1098580074 12:72089127-72089149 ATGTAGTGTCTGAAAGAAAGAGG - Intronic
1098664336 12:73141727-73141749 TGGTATTTTTTGAAAGAAAAAGG - Intergenic
1098744986 12:74224761-74224783 ATGTAGTACTTGTAAGGGAAAGG - Intergenic
1098777300 12:74636682-74636704 CTGCAGAATATGAAAGAAAAGGG - Intergenic
1099061517 12:77916251-77916273 ATTTATTATTTGAAAGACATTGG + Intronic
1099319952 12:81133562-81133584 ATGTAGAAGTTGAAAAAAAGTGG - Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099472159 12:83063950-83063972 GTGTAGTATTTCTAGGAAAAGGG + Intronic
1099788541 12:87299263-87299285 GTGTAGTATTTGGGAGAAATTGG + Intergenic
1100669095 12:96790420-96790442 ATATAGTATTTGAAAGGTAATGG + Intronic
1101288829 12:103345090-103345112 ATGTAGTATTTGAAGCCAAAAGG - Intronic
1101494383 12:105239750-105239772 ATGTAGTATGTGAGAGAAAGTGG + Intronic
1102123904 12:110464893-110464915 ATGTAAGATTTAAAAGTAAATGG - Intronic
1102634423 12:114310563-114310585 ATGCTGTTTTTGAAAGAAGAGGG + Intergenic
1102734516 12:115146429-115146451 ATGTAATTATTGGAAGAAAAAGG + Intergenic
1104163024 12:126199044-126199066 ATGTGGAATTTTAATGAAAAGGG + Intergenic
1104368660 12:128202198-128202220 ATGTAAAATTTAAAAGAGAAAGG - Intergenic
1104723973 12:131064786-131064808 ATGTTGTTTTAGAAAGCAAAGGG + Intronic
1105366003 13:19765469-19765491 ATGTGGTAATTTTAAGAAAAGGG + Intronic
1105520142 13:21124157-21124179 CTGCATTATTTGAAAGACAAAGG - Intergenic
1105739868 13:23312811-23312833 ATGTGACATTTGAAAAAAAATGG + Intronic
1106673149 13:31929021-31929043 ATTTACTATTAGAAAGTAAAAGG + Intergenic
1107212443 13:37873594-37873616 ATTTCCTACTTGAAAGAAAATGG + Intergenic
1107579988 13:41772833-41772855 AGATAGTATCTGCAAGAAAAAGG + Intronic
1107647474 13:42509865-42509887 AGGTAGTTTTTGAAAGAAGAAGG - Intergenic
1108172554 13:47757247-47757269 ATGTAGTATTCCAAAGGGAAAGG + Intergenic
1108617879 13:52152684-52152706 ATTAAGTATCTGTAAGAAAAAGG + Exonic
1109187593 13:59289092-59289114 ATATAGTATTTGAATGATAGGGG - Intergenic
1109205265 13:59476271-59476293 AAGTTGTATTTGAACTAAAACGG + Intergenic
1109225031 13:59683335-59683357 ATTTAGTATTTAAGACAAAATGG - Intronic
1109477859 13:62907903-62907925 ATGCAGTATTTGTAAGATATAGG + Intergenic
1109554756 13:63957812-63957834 ATGTACTATCTTTAAGAAAATGG + Intergenic
1109590886 13:64479898-64479920 AAATTGTTTTTGAAAGAAAATGG + Intergenic
1109927265 13:69159932-69159954 ATCTATTATTTGATAGAACAGGG + Intergenic
1110019551 13:70453396-70453418 AAGAAGTATTTGAAATATAATGG - Intergenic
1110297941 13:73890893-73890915 TTGTGGTATTTTAAAGAATAAGG + Intronic
1110316880 13:74118874-74118896 ATGTAGTACTTGAAAGATCCAGG + Intronic
1111249787 13:85588520-85588542 TTGCTGTATTTGAAAGATAAAGG - Intergenic
1111561711 13:89958725-89958747 ATAGAGTAATTGAAAGCAAAAGG - Intergenic
1111573464 13:90118185-90118207 ATTTAGTTTTGGAAATAAAATGG + Intergenic
1111675022 13:91376396-91376418 ATGCAGAATTAGAAAGAAAAGGG + Intergenic
1111784729 13:92772023-92772045 ATTCAGTGTGTGAAAGAAAAGGG - Intronic
1111854408 13:93619343-93619365 ATGGATTATTTTAAATAAAAGGG + Intronic
1112061803 13:95748027-95748049 ATGTTGGATTTGAGATAAAAGGG - Intronic
1112066104 13:95794861-95794883 ATGTAGTGTTTTAATAAAAAAGG + Exonic
1112888662 13:104205829-104205851 AATTAGAGTTTGAAAGAAAATGG + Intergenic
1115067909 14:29287435-29287457 AAGCAGTATTTGAATTAAAAAGG - Intergenic
1115257008 14:31413825-31413847 ATGAAGTAGTTGAAAGAATGTGG - Intronic
1115772342 14:36677610-36677632 ATGTTGTAATTTAAAGAAAATGG + Exonic
1116168975 14:41373707-41373729 ATTTAGTATTTAAAATAAAAGGG - Intergenic
1116266957 14:42704470-42704492 ATGTAGTTTTTGCAATTAAATGG + Intergenic
1116279319 14:42882457-42882479 ATATAATATTTGAACTAAAATGG + Intergenic
1117025245 14:51612941-51612963 ATGTGGGGTTTGAAAGCAAAGGG + Intronic
1118383036 14:65233314-65233336 ACCTAGTATTTGATAGAATAGGG - Intergenic
1119102399 14:71892132-71892154 TTGTATTGTTTGAAAGAGAAGGG - Intergenic
1120026252 14:79587802-79587824 ATCTAGAATTTGAATGGAAACGG + Intronic
1120337361 14:83174057-83174079 ATGGATTTTTTGTAAGAAAAGGG + Intergenic
1120666984 14:87317756-87317778 CTGAAGTATTTTAAAGTAAATGG - Intergenic
1121356753 14:93222252-93222274 ATTTTGTTTTTGAAAGCAAATGG + Intronic
1121382254 14:93482955-93482977 ATGTAGTAATTGAAACAGGAAGG - Intronic
1121878621 14:97478741-97478763 ATGTAGAATAGGAAAGAAAAGGG + Intergenic
1122187398 14:100010755-100010777 TTGTTATATTGGAAAGAAAAGGG + Intronic
1123216771 14:106815470-106815492 TTGTAGTATTTGAGGTAAAAAGG + Intergenic
1123737675 15:23200992-23201014 AAGTAGAATTTTAAAGGAAAAGG - Intergenic
1124288884 15:28429658-28429680 AAGTAGAATTTTAAAGGAAAAGG - Intergenic
1124294339 15:28487656-28487678 AAGTAGAATTTTAAAGGAAAAGG + Intergenic
1124811292 15:32941491-32941513 TTGTATTGTTTGAGAGAAAATGG - Intronic
1125395659 15:39244724-39244746 ATGTATTTTGAGAAAGAAAAGGG - Intergenic
1125925955 15:43563365-43563387 AGGTAGTAGGTAAAAGAAAAAGG - Intronic
1125939099 15:43662916-43662938 AGGTAGTAGGTAAAAGAAAAAGG - Intronic
1127219019 15:56858099-56858121 ATGTAGTATATGTCAGAAACTGG - Intronic
1127407355 15:58665133-58665155 ATTCAGTATTTGAAAGAATGAGG - Exonic
1127551278 15:60041029-60041051 ATGTTATTTTTTAAAGAAAAAGG - Intronic
1127755827 15:62091007-62091029 ATGTTGTATTTTACAGTAAAAGG + Intergenic
1128489230 15:68129625-68129647 AAGTAGTATATTAAAGATAAAGG + Intronic
1129642979 15:77400965-77400987 ATGTAGTGTTTGAAATAGTAAGG - Intronic
1129968068 15:79754423-79754445 ATGGAGTTATCGAAAGAAAAAGG + Intergenic
1130164023 15:81434334-81434356 ATCTAGAATTTGGGAGAAAACGG - Intergenic
1130349298 15:83076810-83076832 ATGTGGCATTTAAAACAAAATGG - Intergenic
1130683527 15:86017097-86017119 AGGTAGTATTTGAAAGTGATAGG - Intergenic
1130759211 15:86800380-86800402 ATGTACTATTTGCAAGGATATGG - Intronic
1132105367 15:99059183-99059205 ATTTGGTCTTGGAAAGAAAAGGG - Intergenic
1132137097 15:99351945-99351967 ATGTAGTTCTGGCAAGAAAAGGG + Intronic
1132194702 15:99904701-99904723 ATGTCGTATTTGGAAGCAAATGG + Intergenic
1132424170 15:101700091-101700113 TTGTAGTTTTTGAGAGAAATTGG + Intronic
1133955166 16:10436390-10436412 ATGTATTATTTAAAAAAAAAAGG - Intronic
1134871009 16:17652564-17652586 ATGAAGTATTAGTAAGAAAAGGG + Intergenic
1135330998 16:21559666-21559688 TTCTAGTATATGAAAGGAAAAGG + Intergenic
1137227518 16:46528881-46528903 CTGTACTATTTTAAGGAAAAGGG - Intergenic
1138721309 16:59083516-59083538 ATGAAGTATTGGCAAGAATATGG - Intergenic
1138857675 16:60714051-60714073 ATGTCTCACTTGAAAGAAAATGG + Intergenic
1138975591 16:62203381-62203403 CTGTATTATTTGAAATAAAATGG + Intergenic
1139020767 16:62746167-62746189 ATGGAGTGTTTGAAAGAACGGGG + Intergenic
1139084831 16:63572169-63572191 ATGCTGCTTTTGAAAGAAAATGG + Intergenic
1139123323 16:64046704-64046726 ACCTAGTATTTGATAGAAAAGGG + Intergenic
1140272818 16:73481825-73481847 ATGCCGTATTTTAAACAAAAGGG - Intergenic
1140374940 16:74437624-74437646 AGTAAGTATTTGAAAGAAGATGG + Intergenic
1140666787 16:77235190-77235212 ATGTATTAATTTAAAGGAAATGG - Intergenic
1140876130 16:79153993-79154015 ATTTAGAATTTGGGAGAAAAAGG + Intronic
1141378993 16:83558639-83558661 ATTTAGCTTTTGAAAAAAAAGGG - Intronic
1141896852 16:86963896-86963918 ATGTAGTATTTAAAAGTTATTGG - Intergenic
1142328116 16:89431611-89431633 ATGTAGCAAGTGAAACAAAATGG - Intronic
1142335182 16:89484502-89484524 ATGCAGTATTTCCAAGTAAAGGG - Intronic
1142947652 17:3446381-3446403 CTGTTTTATTTGGAAGAAAAAGG + Intronic
1143343849 17:6234976-6234998 ATGTAATATCTGTAAAAAAATGG + Intergenic
1144390554 17:14789597-14789619 ATGTACTATGGGAAAGAAAGTGG + Intergenic
1146358597 17:32156047-32156069 ATGTAGTTATTTAAGGAAAAAGG + Intronic
1148540317 17:48475086-48475108 ATTTATTTTTTTAAAGAAAAAGG - Intergenic
1148949406 17:51297013-51297035 CTGCAGAATTTGTAAGAAAAGGG - Intronic
1149125269 17:53222336-53222358 CTGTAGTATTTGAAAGAGCATGG + Intergenic
1149171734 17:53820249-53820271 ATTTGAAATTTGAAAGAAAATGG + Intergenic
1149401388 17:56299815-56299837 ATGTACTATTTGAATCACAATGG - Intronic
1149813457 17:59700782-59700804 ATGTGGTTTTGGAAAGGAAAAGG + Exonic
1150534066 17:66016911-66016933 ATGTAGTTTGTGAAGGAACAGGG - Intronic
1150855051 17:68744740-68744762 ATGTATGAGATGAAAGAAAAGGG - Intergenic
1151087769 17:71400889-71400911 TTGAAGGTTTTGAAAGAAAATGG - Intergenic
1151126738 17:71853263-71853285 ATGTTATATTTGCAAAAAAAGGG + Intergenic
1152501248 17:80710761-80710783 ATTTAATATATGAAACAAAATGG - Intronic
1153034927 18:752473-752495 ATCAATTATTTGACAGAAAAAGG + Intronic
1153041225 18:814130-814152 ATGTAGTAATAAAAAAAAAAAGG - Intergenic
1153444767 18:5158574-5158596 CTGTAGTGTTTGAAACCAAATGG - Intronic
1155035670 18:22022917-22022939 ATGTGGCATGTGAAAGAAAAAGG + Intergenic
1155465735 18:26133493-26133515 ATTTAGAATTTGAAACCAAAGGG + Intergenic
1156220589 18:35047373-35047395 GTGGAGTGTTAGAAAGAAAAAGG - Intronic
1156385333 18:36599539-36599561 ATGTAGTATGTGAAAAGACATGG + Intronic
1156628503 18:38939415-38939437 AAATAGTACTTGAAAGAATATGG - Intergenic
1156861829 18:41845696-41845718 GTGTAGCATTTAAATGAAAAAGG + Intergenic
1156936155 18:42710255-42710277 GTGTTGTGTTTGAAAGAAATAGG - Intergenic
1157953790 18:52071678-52071700 TTGTATTATTTGAAACATAAAGG - Intergenic
1158045635 18:53152270-53152292 ATGATGTATATGAAAGATAAGGG - Intronic
1158192918 18:54850872-54850894 GTGTTGTATTTAAAAGAAAAGGG + Intronic
1158793368 18:60810300-60810322 ATGTTGTCTTTGAAACATAACGG + Intergenic
1159126058 18:64226083-64226105 AAGTAGAAATAGAAAGAAAACGG + Intergenic
1159192114 18:65059883-65059905 GTGTAATAACTGAAAGAAAAGGG - Intergenic
1159298079 18:66522625-66522647 ATATTATATTTAAAAGAAAAAGG - Intronic
1159495634 18:69199941-69199963 ATGTAGTAGAGGAAAAAAAAGGG - Intergenic
1159646304 18:70922198-70922220 TTGCAGTATCTGAAAGAAATGGG + Intergenic
1159688564 18:71456465-71456487 ATTTAGGACATGAAAGAAAATGG - Intergenic
1159741067 18:72171369-72171391 ATGTAGTATCAGTGAGAAAAGGG + Intergenic
1159745349 18:72227792-72227814 ATGTTGTATTTAAAATATAATGG - Intergenic
1160134376 18:76260084-76260106 AGTTATTATTTGAAATAAAATGG + Exonic
1161775863 19:6261751-6261773 ATATAATACTTGAAGGAAAAAGG - Intronic
1162683995 19:12366585-12366607 GTGTAGTATGGGAAAGGAAAGGG - Intergenic
1163699348 19:18779520-18779542 ATGTAGGACTTAAAAAAAAATGG + Exonic
1163880334 19:19915101-19915123 ATGTATTATCTGAGAAAAAAAGG - Intronic
1164493051 19:28731835-28731857 ATCTAAAATTTAAAAGAAAAAGG - Intergenic
1165206245 19:34189451-34189473 AGCAAGTATTTGAAAGAAATGGG + Intronic
1165207247 19:34200480-34200502 TTGAAGTATTTAAAAGTAAAAGG + Intronic
1167777416 19:51568380-51568402 ATGAGATATATGAAAGAAAAGGG + Intergenic
1168135930 19:54351962-54351984 TTGTAGTAGGGGAAAGAAAATGG - Exonic
1168367510 19:55801384-55801406 ATGTAGAAATTGAAATCAAAAGG + Intronic
925445986 2:3927392-3927414 ACGTAATATCTGAAAAAAAATGG - Intergenic
925474329 2:4196350-4196372 AGGTAGTATTTGAAAGAAATGGG + Intergenic
925987696 2:9229710-9229732 ATGGAGTAGTTGATAGCAAAGGG + Intronic
925993271 2:9270638-9270660 ATCTAGTATTTGATAGAAACAGG - Intronic
926461366 2:13133638-13133660 AAATAGTATTTGAAAGAAATAGG + Intergenic
928849321 2:35724405-35724427 AAGTAGTGGTTGCAAGAAAATGG - Intergenic
929526729 2:42710770-42710792 ATGTAATTTTTTAAATAAAATGG + Intronic
930134603 2:47888577-47888599 AAGTAATTTTTAAAAGAAAAAGG - Intronic
930335730 2:50042651-50042673 ATGCAGTGTTTGATACAAAAAGG - Intronic
930463160 2:51709843-51709865 ATGCAGTACTTGAAAACAAATGG + Intergenic
930580308 2:53203228-53203250 AGGTAGTATTTATAAGGAAAGGG - Intergenic
930586087 2:53268385-53268407 ATGCAGTGTTTGGAAGAAAGAGG - Intergenic
930595807 2:53386939-53386961 CTGCAGTATTTCAAAGGAAAAGG + Intergenic
931683177 2:64769454-64769476 ATATAGTATGTGAAAGAGACTGG + Intergenic
932001836 2:67892516-67892538 ATGTTTCATTTGCAAGAAAATGG - Intergenic
932220043 2:69992188-69992210 AAGTAGAATTGGAAACAAAATGG + Intergenic
932693431 2:73933229-73933251 ATACAGTATTTGAAATAAATAGG - Intronic
932964625 2:76457223-76457245 ATGTAGTATTGCAAAAAGAAAGG + Intergenic
933032505 2:77348403-77348425 ATATAATATTTTCAAGAAAAAGG + Intronic
933038979 2:77436776-77436798 ATGTAGTATATAAAACTAAAAGG + Intronic
933058930 2:77710710-77710732 ATGTAGTAATTGAAAGGTTATGG - Intergenic
933507025 2:83190074-83190096 ATATAGTATTTGAAAGATATGGG + Intergenic
933680579 2:85096367-85096389 ATGTAGTATAAAAAAGAAAAGGG + Intergenic
934510513 2:94936962-94936984 ATGTAGTATGTGAAAAAACCTGG - Intergenic
934589280 2:95531528-95531550 AGGTTGTTTTTGAAAGAAACAGG + Intergenic
934777050 2:96946202-96946224 ATGTATTATTTTAAAAAAAGAGG - Intronic
936803268 2:116292817-116292839 ATATAGAATTTGAAAGACAAAGG - Intergenic
936814890 2:116447898-116447920 ATGTCATTTTAGAAAGAAAAGGG + Intergenic
938666558 2:133544729-133544751 TGGTTGTATTTGAAAGGAAAGGG - Intronic
939271873 2:139949523-139949545 ATGTTTTAGTTGCAAGAAAATGG - Intergenic
940021212 2:149157716-149157738 ATCTAATAGTTGAAAGAAAAGGG - Intronic
940112818 2:150172557-150172579 AAGCAATATTTGAAAAAAAATGG + Intergenic
940115286 2:150201662-150201684 TTGTAATACTTGAAAAAAAAAGG + Intergenic
940200591 2:151145909-151145931 CTGTAGTAGTTAAAAAAAAAAGG - Intergenic
940225246 2:151394260-151394282 ATCTAGTATCTGAAGTAAAAGGG - Intergenic
940523469 2:154781486-154781508 ATATAGTCTGAGAAAGAAAAAGG + Intronic
940561881 2:155308240-155308262 ATGTAATAATTTAAGGAAAATGG - Intergenic
940692107 2:156931395-156931417 CTGAAGAATTTGAAAGAAAGAGG - Intergenic
940717205 2:157239750-157239772 TTGTAATGTTTGTAAGAAAAAGG + Intergenic
941380150 2:164782977-164782999 ATGTAATATATGAAAAAAAATGG - Intronic
941525870 2:166606358-166606380 TTGTATTATTACAAAGAAAATGG + Intergenic
941947442 2:171115114-171115136 ATGCAGTACTTGAAAGATAATGG - Intronic
942276170 2:174325673-174325695 ATGTAGTAATAGAGAGAAAAAGG + Intergenic
942827797 2:180201113-180201135 AGGTAGTTTTTGAAACAAAATGG - Intergenic
943429507 2:187781508-187781530 ATGTACTATTTTATGGAAAATGG + Intergenic
943502853 2:188713294-188713316 AAGCAGCATTTGAAAAAAAATGG - Intergenic
943648510 2:190431886-190431908 ATGTATATTTTTAAAGAAAAAGG - Intronic
943823528 2:192358834-192358856 ATGTTCTATAAGAAAGAAAATGG - Intergenic
943970612 2:194401240-194401262 ATACAGTATTTGAAAGTAATAGG - Intergenic
944013986 2:195009924-195009946 ATGTAGAATTTCAAGGAAAGGGG - Intergenic
944358353 2:198820760-198820782 ATGTAAAATTTGAAATAAATGGG + Intergenic
944776982 2:202976647-202976669 ATGCAGTATCTGAAAAAATATGG + Intronic
944843268 2:203643814-203643836 ATGTAGTTTTTGAAAAAGATGGG + Intergenic
945170356 2:206989017-206989039 ATGATGTATTTCAAAGAATAAGG - Intergenic
945332721 2:208558329-208558351 AATTAGTATTTTAAAGAAAATGG + Intronic
945478296 2:210313610-210313632 TTGAAGTATTTGAAAAAAATTGG - Intronic
945557052 2:211290318-211290340 ATGGAGTTTTAAAAAGAAAATGG + Intergenic
946581953 2:221138937-221138959 ATCTAATATTTGGAAGAGAAGGG - Intergenic
946926416 2:224631535-224631557 ATGTGGAGTGTGAAAGAAAAGGG + Intergenic
947284532 2:228497833-228497855 AGGTTGCATTTAAAAGAAAAAGG + Intergenic
947694355 2:232171439-232171461 TTCTTGGATTTGAAAGAAAATGG + Intronic
948094913 2:235325633-235325655 AGGTAGCATTTGAATGAGAAAGG - Intergenic
1169253170 20:4075719-4075741 ATGTAATCTTTGAAGGAAACAGG - Intergenic
1169270340 20:4194477-4194499 ATGTGGAATATGAAAGAAAAAGG - Intergenic
1169667951 20:8059772-8059794 ATTTATAATTTGAAATAAAAAGG - Intergenic
1169808302 20:9582055-9582077 AAATTTTATTTGAAAGAAAAGGG - Intronic
1169942144 20:10948703-10948725 ATATAGAAATTGAAAGAAAACGG - Intergenic
1169981238 20:11386771-11386793 ATTTAGTATTTGATAAAATAAGG + Intergenic
1170283721 20:14681404-14681426 ATGGAGTATTACAAATAAAAAGG + Intronic
1170527834 20:17259134-17259156 ATCCAGTGTTTGGAAGAAAAGGG - Intronic
1171203539 20:23260914-23260936 ATGTGGTATAGGCAAGAAAAGGG + Intergenic
1171333185 20:24359267-24359289 ATGTAAGATTTCAAAAAAAAAGG - Intergenic
1171429700 20:25074472-25074494 ATGTAATATTACAAAGGAAAAGG - Intronic
1172608825 20:36234229-36234251 ATTTAGTATTTGAAAGTATACGG - Intergenic
1173079306 20:39850677-39850699 ATGAAGTTTTTAAAAGCAAAAGG + Intergenic
1173303340 20:41824506-41824528 ATCTAGCATTTGATAGAATAGGG - Intergenic
1174567291 20:51474542-51474564 CTGAAGTATTTAAAAGTAAAAGG + Intronic
1175088441 20:56481441-56481463 GTGTAATATTTAAAAGCAAAAGG - Intronic
1175620329 20:60439889-60439911 TTGTAGTATTTTCAAAAAAATGG - Intergenic
1176588804 21:8619917-8619939 ATGTAGCATATGAAACAAATAGG + Intergenic
1176703395 21:10087237-10087259 ATTTAGAATTTGATAGATAATGG - Intergenic
1177127173 21:17209475-17209497 ATGTAGTATTATAAAGAATTTGG - Intergenic
1177915469 21:27083784-27083806 ATGTAGTATTTCAAACACTAAGG + Intergenic
1178027181 21:28481421-28481443 AAGTAGAGTTTGAATGAAAATGG - Intergenic
1178289952 21:31358601-31358623 ATGTGGGATGTGAAAGGAAAGGG - Intronic
1178484696 21:33011409-33011431 ATGAAATATTTTGAAGAAAATGG + Intergenic
1178869050 21:36356768-36356790 ATGTGGTATTAGAGAGTAAAGGG + Intronic
1180271630 22:10596913-10596935 ATGTAGCATATGAAACAAATAGG + Intergenic
1181870786 22:25897608-25897630 ATTCAGTATTTGAAGGCAAATGG - Intronic
1181873665 22:25923152-25923174 ATGTGCTATTGGAAAGAATATGG + Intronic
1181918160 22:26297240-26297262 ATATACAATTTTAAAGAAAACGG + Intronic
1182001553 22:26924074-26924096 ATGAAGCATTGCAAAGAAAAGGG - Intergenic
1183129063 22:35815435-35815457 ATGTAATCTTTGAGAGAGAAGGG + Intronic
949148410 3:732900-732922 ATGTATTTTTTTAGAGAAAAAGG - Intergenic
951209674 3:19961455-19961477 ATGTAGTATTTGACAGGTAGGGG + Intronic
951363617 3:21753483-21753505 ATGTAGCCTTTGAAAGAATATGG + Intronic
951436532 3:22671231-22671253 ATCTAGTAATTCAAAGCAAATGG - Intergenic
951599383 3:24356407-24356429 ATGTACTATTCTTAAGAAAAGGG - Intronic
951746415 3:25982611-25982633 ATGTATTATGGGAAAGAAAGTGG - Intergenic
952804016 3:37329176-37329198 ATGTGTTTTTTGAACGAAAAGGG + Intronic
952847332 3:37699411-37699433 ATGTGGTGTATGAGAGAAAAGGG - Intronic
953852213 3:46472984-46473006 ATGTAGTGACTGAAAGAGAAAGG - Intronic
954205589 3:49056722-49056744 ATTTAGTATTTGGGAGAAGAGGG - Intronic
954453825 3:50586257-50586279 AGGTAGTCTTTGGAAGAAAAGGG - Intergenic
955185001 3:56706622-56706644 ATATAGTATCAGAATGAAAATGG + Intergenic
955209879 3:56930753-56930775 ATGTAGTAAGTGAAGGGAAATGG + Intronic
955707061 3:61738430-61738452 CTTTGGTATTTGAAAGAAATAGG - Intronic
956178507 3:66496880-66496902 CTGTAAAATTTGAAAGACAAAGG + Intronic
956247811 3:67203815-67203837 ATATAGTGATTGAAAGAACAAGG + Intergenic
956403263 3:68902341-68902363 AGGTATTATCTGAAAGAAAATGG - Intronic
956556473 3:70528789-70528811 ATGTAGGATTGGAAAAAAGATGG - Intergenic
956857337 3:73288040-73288062 GTAGAGTATTTGCAAGAAAAGGG + Intergenic
956956402 3:74346305-74346327 TTTTAGTATTTGAATGTAAAAGG + Intronic
956982828 3:74658757-74658779 ATGGGGTATCTGATAGAAAAAGG - Intergenic
957347186 3:78976975-78976997 ATGAAGAAATTTAAAGAAAATGG - Intronic
957366590 3:79232201-79232223 AAATAGAAATTGAAAGAAAAAGG + Intronic
957749394 3:84392809-84392831 GTGTATTATTAGAAAGAAACAGG - Intergenic
957971554 3:87389018-87389040 ATCTAGGATTTGAAATTAAAAGG - Intergenic
958592626 3:96177462-96177484 ATGTTGTATGTTAAATAAAATGG - Intergenic
958699825 3:97574294-97574316 ATGTGGTAGTTGAATGAAAGAGG + Intronic
959187013 3:103057330-103057352 ATTTAGTTTGTGAAAGGAAAAGG + Intergenic
959637393 3:108590302-108590324 ATGTAGAAATTGTAAGAATAGGG + Intronic
960621775 3:119643984-119644006 ATGTTTTATCTGCAAGAAAAGGG - Intronic
961074570 3:123969894-123969916 ATGGATGATCTGAAAGAAAACGG - Intronic
961973025 3:130990365-130990387 AGGTACTATTTGACAGAAGAGGG + Intronic
963071002 3:141305286-141305308 ATGTAGCTTTTCCAAGAAAACGG + Intergenic
963369846 3:144385243-144385265 ATTTATTATTTAAAACAAAAAGG + Intergenic
963633856 3:147768448-147768470 ATGAAATACTTGAAAAAAAAAGG - Intergenic
963695058 3:148556303-148556325 ATGGAATATTAGGAAGAAAAAGG - Intergenic
965666916 3:171104970-171104992 ATATAGTCTTTGAAAATAAATGG - Intronic
965683662 3:171278285-171278307 ATGTAGCAATTAAAAGACAAGGG - Intronic
965919025 3:173890135-173890157 ATGTAGAATTTTAAAGGGAATGG - Intronic
965951354 3:174311889-174311911 AAGTAGAATTAGAAAGAAAAAGG - Intergenic
965952969 3:174333448-174333470 ATGTAGTATTTAATATATAAAGG - Intergenic
966021040 3:175211012-175211034 ATCTAACATTTGAAACAAAAAGG + Intronic
966072863 3:175900560-175900582 GCTTAGTAATTGAAAGAAAAAGG + Intergenic
966249660 3:177849819-177849841 ATGTAGTTTGTGAAAGCAAAAGG + Intergenic
968012152 3:195290037-195290059 ATGGAGTCTATGAAATAAAATGG + Intronic
969224804 4:5788616-5788638 ATGTAGGGTGTGAAAGAAAGAGG - Intronic
970211967 4:13719286-13719308 ATCAAGAATGTGAAAGAAAATGG + Intergenic
970220918 4:13809922-13809944 ATGTTCTGTTTCAAAGAAAAGGG - Intergenic
970994959 4:22256047-22256069 ATGTCGTTTTTCAAAGAATAAGG - Intergenic
971635798 4:29055832-29055854 ATGTAGTATTTTTAACAAAGTGG + Intergenic
971662898 4:29443002-29443024 ATGAGGTACTTGAAAGAAGAGGG + Intergenic
971996684 4:33974381-33974403 ATGTGCCTTTTGAAAGAAAAGGG + Intergenic
972108662 4:35526234-35526256 AAGTAGTATTAAAAAGTAAATGG - Intergenic
972156062 4:36163567-36163589 ATCTTGTCTATGAAAGAAAAAGG + Intronic
972295990 4:37738979-37739001 ATATAGCATTTCAAAAAAAAGGG - Intergenic
972429629 4:38968241-38968263 ATGTTATAATTGAAAGAAACTGG - Intronic
972915069 4:43866817-43866839 AAGCAGTGTTTGAAAGATAAGGG - Intergenic
973019025 4:45176999-45177021 CTATAGTATTTGAAAGACTATGG + Intergenic
973607435 4:52601575-52601597 ATGAAGAATTTGAAATAACATGG - Intronic
973805326 4:54520138-54520160 ATGTGGCATTTAAAACAAAAAGG + Intergenic
973986830 4:56362703-56362725 ATATATCATTTGAAAGAAACTGG + Intronic
973993990 4:56438120-56438142 ATTCAGGATTTGAATGAAAAGGG - Intronic
974104385 4:57452878-57452900 ATGAAGGATTTGAAAAAAACTGG - Intergenic
975358891 4:73442716-73442738 AAGGAGTAAGTGAAAGAAAACGG + Intronic
976059757 4:81113315-81113337 TAGTAGAATTTGAAAAAAAAGGG - Intronic
976059764 4:81113368-81113390 TAGTAGAATTTGAAAAAAAAGGG - Intronic
976136938 4:81947824-81947846 ATCTTGTATTTGAACTAAAAAGG - Intronic
976261765 4:83152168-83152190 CTGAAGTATTTAAGAGAAAAGGG + Intergenic
976654346 4:87472356-87472378 TTTGACTATTTGAAAGAAAATGG - Intergenic
977169045 4:93737754-93737776 ATATAGGATTTCAATGAAAATGG - Intronic
977272609 4:94936557-94936579 ACGTAGTGTTTGAAAGACATTGG + Intronic
977508865 4:97936993-97937015 TTGGAGTACTTGAAAGAGAAAGG - Intronic
977844763 4:101755601-101755623 ATGTTTTATTTCAAATAAAATGG - Intronic
978272223 4:106904691-106904713 ATGCAGCATGTGAGAGAAAAGGG - Intergenic
978272375 4:106906488-106906510 ATGGATTCTTTGAAAGAGAATGG - Intergenic
978577575 4:110201782-110201804 AAGGAGTAATTGAAAGAAACAGG + Intergenic
978802166 4:112765601-112765623 ATGTAGTATTATAAGGTAAAAGG - Intergenic
978967669 4:114761821-114761843 ATGTGATGTTTGAAAGAGAATGG + Intergenic
978970943 4:114806042-114806064 ATATAGTATTTGATAAAAAGTGG + Intergenic
978979708 4:114928492-114928514 TTGGAGTAAGTGAAAGAAAATGG - Intronic
979397491 4:120206132-120206154 ATGTAGTATGTGAAAGAAAGAGG + Intergenic
979582653 4:122378929-122378951 ATGGAGTCTTTGAGAGCAAATGG - Intergenic
979744172 4:124189360-124189382 TTGTAGTATTTAACAGAAAAAGG + Intergenic
979803683 4:124943857-124943879 ATTTAATATTTGAAAAAAGATGG + Intergenic
980085922 4:128389925-128389947 AAGGAGTAATTGAAAGAAATAGG - Intergenic
980245548 4:130235428-130235450 ATATAATATTTGAAGGAGAAGGG - Intergenic
980375617 4:131943603-131943625 ATTTAGAATTTGATAGATAATGG - Intergenic
980833779 4:138164447-138164469 ATGTGATATGTGAAATAAAATGG - Exonic
980890069 4:138805311-138805333 ATGCAGAATTTGGAAGAAAAAGG - Intergenic
980959675 4:139462498-139462520 ATGTGTTCTTTGAAAGAATAGGG - Intronic
981452537 4:144915167-144915189 ATGTTATATTTGAAAGCATAAGG + Intergenic
981652766 4:147077952-147077974 AAGTAGTCTTTGTAATAAAATGG + Intergenic
982268324 4:153560734-153560756 GTGTATTATTTGCAATAAAAAGG - Intronic
982542877 4:156696727-156696749 ATATTGTAATTGTAAGAAAATGG - Intergenic
982732119 4:158967255-158967277 ATATATTATTTTCAAGAAAAAGG + Intronic
982850117 4:160303980-160304002 ATATACAATTTGAAAGTAAAAGG - Intergenic
983002294 4:162431647-162431669 ATGTAGTTTTTAGAAAAAAATGG - Intergenic
983048417 4:163014280-163014302 ATGTAGTATTTCAAATAACTAGG + Intergenic
983082384 4:163402481-163402503 ATGAAGTGTTAGAAAGAACATGG - Intergenic
983086979 4:163458256-163458278 ATGTTATATTTGAATTAAAAAGG + Intergenic
983410238 4:167387013-167387035 ATATACTATATGTAAGAAAAAGG - Intergenic
983704061 4:170636095-170636117 ATATATAATTTTAAAGAAAAAGG + Intergenic
984367794 4:178821077-178821099 ATGTAGCTTGTGAAAAAAAATGG + Intergenic
984453667 4:179937488-179937510 ATTTAGTGGTGGAAAGAAAATGG + Intergenic
984536066 4:180977138-180977160 ATTTAGTATTTTAATTAAAAAGG - Intergenic
984861996 4:184249290-184249312 ATCTAGTATTTGATAGCACAAGG + Intergenic
985073313 4:186190063-186190085 ATCTAAAATTAGAAAGAAAAAGG - Intergenic
985348170 4:189029107-189029129 ATGATGTATTGGAAAGAGAATGG + Intergenic
986308709 5:6534976-6534998 ATGTAGTAATAGAAACAATATGG - Intergenic
986763490 5:10901420-10901442 ATTTTGTATTTGAAAAGAAAGGG - Intergenic
987287803 5:16476240-16476262 GTGCAGTGTTTGAAAGAAGATGG - Intronic
987568027 5:19618558-19618580 ATCTATTATTTTACAGAAAATGG + Intronic
987599539 5:20048858-20048880 ATGTTGTATTTCCAAGAAGATGG - Intronic
987785724 5:22496070-22496092 ATGTTGTAGGTGAAAGAAATGGG + Intronic
988046164 5:25957233-25957255 CTATATTCTTTGAAAGAAAATGG - Intergenic
988122353 5:26982409-26982431 ATGTACCATTTGTCAGAAAAAGG + Intronic
988270663 5:29011372-29011394 AAGTAGTATGTGAAACTAAATGG + Intergenic
988939890 5:36133420-36133442 ATCCAGTATTTGATAGAACAGGG + Intronic
989221207 5:38967316-38967338 AGGTAGAATTTAAAATAAAAAGG - Exonic
989236153 5:39150680-39150702 ATTTAGTGTATGAAGGAAAATGG - Intronic
989274948 5:39577564-39577586 ATCAAGTATTTGCAAGAAGATGG + Intergenic
990059293 5:51627636-51627658 ATCTATTAATTGAAAGAAATCGG - Intergenic
990093031 5:52078945-52078967 ATGTAGTAGTTGAAGTCAAAAGG - Exonic
990755826 5:59068698-59068720 ATGTAGTTTTTGAAAAAGAAGGG + Intronic
991241339 5:64464296-64464318 ATTTTGTATATGACAGAAAATGG - Intergenic
991630742 5:68654282-68654304 AAATAGTTCTTGAAAGAAAATGG - Intergenic
992681847 5:79161327-79161349 ATGTAGGAGCTGAAAAAAAAAGG + Intronic
993195774 5:84743540-84743562 GTCTAGTATTTGATAGAACAGGG - Intergenic
993614487 5:90094930-90094952 ATAAAGTATTTGAAAAAAAAAGG + Intergenic
993698861 5:91094669-91094691 ATGCAGCATATGAAGGAAAATGG + Intronic
993860797 5:93134442-93134464 AAATAGTTTTTGAAAGAAAGAGG + Intergenic
993890527 5:93466808-93466830 ATGTAGGAGGTGAAAGAGAATGG - Intergenic
994347017 5:98698847-98698869 ATGTAGGACTTGAAAATAAATGG + Intergenic
994998085 5:107090510-107090532 CTGAAGTATTTTAAAGGAAAGGG - Intergenic
995000940 5:107128892-107128914 ATGAAGTGTTTTAAAGAACACGG + Intergenic
995820592 5:116226283-116226305 ATGTACTATTTGAAATCAATAGG - Intronic
996042350 5:118829505-118829527 TTTTATTATTTTAAAGAAAATGG - Intergenic
996443503 5:123517648-123517670 GGGTAGTTTTTGCAAGAAAAAGG + Intronic
996932724 5:128909373-128909395 AACTAGTGTTTGAGAGAAAAGGG - Intronic
998668522 5:144326857-144326879 ATGTTGTATTTGTAATTAAAAGG + Intronic
998769181 5:145522738-145522760 ATGTTATCTTTGGAAGAAAAAGG + Intronic
998921674 5:147075018-147075040 TTGCAGTATCAGAAAGAAAATGG + Intronic
999021979 5:148176101-148176123 ATGAAGTATAAGAGAGAAAAAGG - Intergenic
999643394 5:153694743-153694765 ATGTATTATTTTAAAAAAGAGGG - Intronic
1000437563 5:161231625-161231647 ACGTAGAATATTAAAGAAAAGGG + Intergenic
1001046337 5:168374905-168374927 ATGTAAAGTATGAAAGAAAAAGG + Intronic
1002915274 6:1523837-1523859 ATTAAGTATTTTAGAGAAAATGG - Intergenic
1002934884 6:1663030-1663052 ATGTCATATTTGAAACAGAAAGG - Intronic
1003481294 6:6535847-6535869 AACTAGCATTTGAAATAAAAAGG + Intergenic
1004395910 6:15246199-15246221 ATGTAGTTTTTGGAGGAAAAAGG + Intergenic
1005047903 6:21659532-21659554 ATGGAGTATTTGAAACTGAATGG + Intergenic
1005677771 6:28173323-28173345 GTGTAGTATTATACAGAAAAGGG - Intergenic
1005769236 6:29049692-29049714 AAGTGGTTTTTAAAAGAAAAAGG - Intergenic
1006215362 6:32437487-32437509 AATTAGAGTTTGAAAGAAAACGG + Intergenic
1006339129 6:33436682-33436704 ATGTAGAATTTGAAGGGAACTGG - Intronic
1008383886 6:50865172-50865194 ATTTTGTATGTGAAAGAAGAGGG + Intergenic
1008475951 6:51935987-51936009 ATCAAGTATTACAAAGAAAAAGG - Intronic
1008592189 6:53005506-53005528 ATGTGGTATATGAAAAAAAGAGG - Intronic
1008739072 6:54582935-54582957 ATGAAGTATTTTTAAGGAAACGG - Intergenic
1009196105 6:60686855-60686877 GTTTAGTGTTTAAAAGAAAAAGG + Intergenic
1009506426 6:64486117-64486139 TTGTAATATTAGAAATAAAAAGG + Intronic
1009533681 6:64853328-64853350 TTGTAGTATGTTAAACAAAAGGG + Intronic
1009563859 6:65284310-65284332 ATGTATTATTAAAAACAAAATGG - Intronic
1010379926 6:75212626-75212648 ATGTAGTATCTGAAATACAGTGG - Intergenic
1010380806 6:75222781-75222803 ATGTAATCTTGGAAAGAATAAGG - Intergenic
1010516936 6:76784698-76784720 ATGTGGTATATGAGAGAAAGAGG - Intergenic
1010581952 6:77610189-77610211 ATGTAGTATGTAAGAGAAAGAGG + Intergenic
1010745252 6:79553245-79553267 ATGTAGGATGTTAAGGAAAATGG + Intergenic
1011174868 6:84549272-84549294 TTGTATTATTTGAAACACAAAGG - Intergenic
1011786522 6:90852166-90852188 ATGTTTTATTTGAATGTAAAAGG + Intergenic
1011837267 6:91448558-91448580 ATATTTTATTTGAAATAAAATGG - Intergenic
1012013339 6:93822006-93822028 ATATAGTGTTTAAAAAAAAATGG - Intergenic
1012029491 6:94039586-94039608 ATATAGTATTAGAAATAAATTGG - Intergenic
1012177060 6:96100925-96100947 ACTTAGTGTTTGAATGAAAATGG + Intronic
1012359302 6:98357248-98357270 ATGGCCTGTTTGAAAGAAAATGG - Intergenic
1012389293 6:98718944-98718966 AAGTAGTAATAAAAAGAAAAGGG - Intergenic
1012423505 6:99090127-99090149 ATGAAGGATTGGAAAGCAAAGGG - Intergenic
1012565388 6:100642676-100642698 ATGTAGTATTGGGAAGGCAAAGG + Exonic
1012670310 6:102036869-102036891 ATGTACTTTTTGAAAGAAAAGGG + Intronic
1012726733 6:102823383-102823405 ATGTTATATTTAAAAGAAACAGG + Intergenic
1013052562 6:106550450-106550472 ATAAAGTCTTTGAAAGGAAAAGG - Intronic
1013392477 6:109700530-109700552 GGGAAGTATTTGAAAGAAATGGG + Intronic
1013668292 6:112370543-112370565 ATTTTCTTTTTGAAAGAAAAGGG + Intergenic
1014248070 6:119088445-119088467 ATATAAGATTTGAAAGAAAGAGG + Intronic
1014465595 6:121752812-121752834 AGGTAGAAATTGAATGAAAAAGG + Intergenic
1014730103 6:125022498-125022520 ATGTGCTAATTGAAAGAAAAAGG - Intronic
1014803431 6:125802721-125802743 TTGTAGAATTCAAAAGAAAATGG - Intronic
1014807716 6:125849170-125849192 TTGTAGTAGCTGAATGAAAACGG - Intronic
1015039066 6:128694412-128694434 ATGTAGAAATTGTAAGAAAGAGG + Intergenic
1015069524 6:129074594-129074616 TTGTTGTCTTTGAGAGAAAATGG + Intronic
1015099037 6:129452320-129452342 AGGTATTATTCAAAAGAAAAGGG + Intronic
1016684061 6:146861817-146861839 AAGATGTATTTGAAATAAAATGG - Intergenic
1017020881 6:150139390-150139412 ATGAAATATTGGAATGAAAATGG + Intergenic
1017184883 6:151590812-151590834 ATGTAGAAATAGAAAGAAAGAGG + Intronic
1017299810 6:152843857-152843879 TTGTATTTTTTGATAGAAAAGGG + Intergenic
1017354391 6:153485643-153485665 ATGAACTAGTTGAAAGCAAAAGG - Intergenic
1018139660 6:160817668-160817690 ATGTATTATTAAAAACAAAATGG - Intergenic
1018752065 6:166815464-166815486 CAGTAGTATTTGAATGATAAAGG - Intronic
1019232067 6:170575356-170575378 ATTCAGTATCTGAAATAAAAAGG + Exonic
1020233362 7:6336952-6336974 ATGTAAGGTTTGAAAGAATATGG - Intronic
1020490048 7:8770819-8770841 ATGTAGAATTGGAAAGCAGAAGG + Intergenic
1020501569 7:8929154-8929176 ATGTAGGATTTGAAAGGTAGAGG + Intergenic
1020594886 7:10194205-10194227 ATATATTATTTAAAGGAAAAAGG - Intergenic
1020668746 7:11079383-11079405 ATGTGGCATTTGAAAGATTATGG - Intronic
1021715451 7:23457891-23457913 ATGTTGTATCTGAACAAAAAAGG + Intronic
1022264495 7:28740801-28740823 ATGAATTATTTGAAAGAAAAAGG + Intronic
1022272495 7:28822995-28823017 ATGTAGTCAGTGAAACAAAATGG + Exonic
1022547422 7:31201925-31201947 ATGTAGCATCTGAAAGGAAAGGG + Intergenic
1023308870 7:38861595-38861617 ACGTTGTATGGGAAAGAAAAAGG - Intronic
1023461435 7:40401805-40401827 ATTTAGTATTTGAACAAAGAAGG + Intronic
1023556718 7:41430926-41430948 ATGTAGGGTATAAAAGAAAAGGG - Intergenic
1023772318 7:43569221-43569243 ATGTACTCTTTGGAATAAAATGG - Intergenic
1024365755 7:48518544-48518566 ATGAAGTGTTTGCCAGAAAATGG + Intronic
1024429996 7:49277026-49277048 ATATAGAATTTCAGAGAAAAGGG + Intergenic
1024750411 7:52458668-52458690 ATGCAGTATATTAATGAAAATGG + Intergenic
1024850348 7:53707444-53707466 ATGTATTATTTGAAACTTAAGGG - Intergenic
1025984636 7:66438364-66438386 AGGAAGTCTTAGAAAGAAAAAGG - Intergenic
1026030078 7:66784581-66784603 AGGAAGTCTTAGAAAGAAAAAGG + Intronic
1026567129 7:71498502-71498524 ATGTAATATTGGAAAGAAACAGG + Intronic
1027207841 7:76116953-76116975 AGGAAGTCTTAGAAAGAAAAAGG - Intergenic
1027350952 7:77310408-77310430 ATGAAGTATTTGACCAAAAAGGG + Intronic
1027492380 7:78845214-78845236 ATACTGTATTTGAAAGACAATGG - Intronic
1027696473 7:81417245-81417267 ATGTACCTTTAGAAAGAAAAAGG + Intergenic
1027781529 7:82526497-82526519 CTTTAGTATTTGAAAGGAATGGG + Intergenic
1028326513 7:89533437-89533459 AAAGAGAATTTGAAAGAAAATGG + Intergenic
1028335128 7:89643140-89643162 ATGTAGTGTTTGGAATAATAGGG - Intergenic
1028434723 7:90789231-90789253 CTGTGGTTTTTGAAAGCAAAAGG + Intronic
1028535444 7:91886646-91886668 AAGTAGTATTTCAAAGCAAAGGG - Intergenic
1030048381 7:105517573-105517595 ATCTAGTATTTTAATGAAAAGGG - Intronic
1030349329 7:108466206-108466228 ATGTAGTATTTTAATTAAATTGG - Intergenic
1030618577 7:111764807-111764829 AGTTAGTATTAGAAAAAAAATGG - Intronic
1030637092 7:111962756-111962778 ATGAAGTATTTCAAGAAAAATGG + Intronic
1030748706 7:113202342-113202364 ATATAGTATATGAAAGTTAAGGG + Intergenic
1031086461 7:117306198-117306220 TTGTAGTAATAGAAAAAAAAGGG - Intronic
1031501267 7:122520429-122520451 ATATAGTATTTAAAGGAAAATGG - Intronic
1031790868 7:126102524-126102546 ATGTAGTTCTTGAAATTAAATGG - Intergenic
1032327676 7:130946531-130946553 GTATAGTATTTGAATGTAAAAGG + Intergenic
1032548708 7:132764732-132764754 CAGTATTATTTGAAATAAAAAGG + Intergenic
1032562777 7:132909807-132909829 ATGAAGTTTCTAAAAGAAAATGG - Intronic
1033133084 7:138761984-138762006 AAATAGTATTTTAAAGAGAAAGG + Intronic
1033875687 7:145815412-145815434 ATTAAGTATTTAAAAAAAAAAGG + Intergenic
1033900871 7:146137489-146137511 ATTTAGGACTTGAAAGAAGAAGG + Intronic
1034356549 7:150454735-150454757 ATGCAGCATTTGAAATAAAAAGG + Intronic
1034506360 7:151495092-151495114 ATGAAGTTATTGAGAGAAAAAGG - Intronic
1035237075 7:157504658-157504680 ATGTATTATTAGAAATAAAGAGG - Intergenic
1035984713 8:4414402-4414424 ATTTATTTTATGAAAGAAAATGG - Intronic
1036969919 8:13344096-13344118 ATGTATTGAATGAAAGAAAAAGG - Intronic
1037326695 8:17698975-17698997 ATGTAGAATCTGGAAGGAAAAGG - Intronic
1037348978 8:17929075-17929097 ATGTATTATTGGAAGGAAGAGGG - Intronic
1038003135 8:23407325-23407347 ATGAAGCATGTGAAGGAAAAGGG - Intronic
1039383497 8:37108263-37108285 ATGAAGTATTTGAATGAAATTGG + Intergenic
1039416309 8:37397249-37397271 AAGGACTATTTAAAAGAAAAAGG + Intergenic
1039678085 8:39693699-39693721 ATGTAATATTTCATAGTAAAAGG - Intronic
1039685790 8:39801003-39801025 ATGGAGTAATTGACAGAAGATGG - Intronic
1040789795 8:51213735-51213757 ATGTAGTGGTAGAAAAAAAATGG - Intergenic
1040833496 8:51705952-51705974 AAGCAGTATTTAAAAGATAATGG + Intronic
1040965699 8:53078766-53078788 ATATAGGCTTTTAAAGAAAAAGG - Intergenic
1041518118 8:58725282-58725304 ATTTCATTTTTGAAAGAAAATGG + Intergenic
1041541498 8:58990087-58990109 AGGTAGTATTTGAAAGAGCTTGG - Intronic
1041789027 8:61670749-61670771 ATGCAGTGTCTGAAAAAAAAAGG + Intronic
1042403387 8:68375639-68375661 ATGAAGTATTTGTTAGAGAATGG + Intronic
1043337596 8:79195851-79195873 ATTTAGTTTTTTAAAGAAAGAGG + Intergenic
1044091835 8:88011444-88011466 ATGAAGTATTTAAGAGTAAAGGG - Intergenic
1044797076 8:95912941-95912963 ATGTAGTATTTTAAAGTAGCAGG - Intergenic
1044888923 8:96811393-96811415 TTGTATTATTTGGAACAAAATGG + Intronic
1045123871 8:99068114-99068136 AGGAAGTATCTGTAAGAAAATGG - Intronic
1045760853 8:105605356-105605378 ATGCAATATTTGAAATAGAATGG + Intronic
1045823252 8:106366903-106366925 ATGTAATACATGAAAGAAGATGG - Intronic
1046006928 8:108497889-108497911 ATGTTGTATGGGAAAGGAAAAGG - Intergenic
1046737622 8:117794091-117794113 ATGCAGTAGTTGAAACCAAAGGG + Intergenic
1046852051 8:118985494-118985516 ATGTGTTATTTTAAAAAAAAAGG + Intergenic
1047397186 8:124512016-124512038 ATGTAGTGTCTGAAAAATAATGG - Intronic
1047625874 8:126655611-126655633 CGGTAGCATTTAAAAGAAAAAGG + Intergenic
1047676792 8:127211406-127211428 ATGTAGTATTTTGCACAAAATGG + Intergenic
1047809699 8:128395081-128395103 ATGTAATGTTTAAAAGAGAAAGG + Intergenic
1048053765 8:130844975-130844997 ATGTATTATTTTCAACAAAAGGG - Intronic
1049450075 8:142656055-142656077 ATGCTGGATTTAAAAGAAAAAGG - Intergenic
1050079046 9:1895493-1895515 ATGTGGCAGATGAAAGAAAAGGG + Intergenic
1050651218 9:7778976-7778998 ATGGAGGATTGGAAAGACAATGG - Intergenic
1050858450 9:10392569-10392591 GTGTATTATTTGAAGGAATAAGG - Intronic
1050876582 9:10645860-10645882 CTTTAGTATTGGAAAGAACATGG + Intergenic
1051000091 9:12271094-12271116 ATGAAGTAGTGGTAAGAAAATGG + Intergenic
1051025203 9:12601479-12601501 ATGATGTATTTTAAATAAAATGG - Intergenic
1051037875 9:12770777-12770799 ATGTAATTTTTAAAAAAAAATGG - Intergenic
1051301290 9:15653729-15653751 ATGTATTTTTTAAAAGATAAGGG + Intronic
1051494703 9:17706946-17706968 ATGTAGCATTTCAGAGTAAAAGG + Intronic
1051754628 9:20385277-20385299 TAGTATTATTTGAAAGAGAAGGG + Intronic
1052163988 9:25299359-25299381 ATGTAATCTGTGAAATAAAAAGG + Intergenic
1052466402 9:28835854-28835876 GTGCAGTAATAGAAAGAAAATGG - Intergenic
1053124112 9:35565589-35565611 ATTTACTATTTGACATAAAAAGG - Intergenic
1053640659 9:40074243-40074265 ATTTAGAATTTGATAGATAATGG - Intergenic
1053765477 9:41391219-41391241 ATTTAGAATTTGATAGATAATGG + Intergenic
1054321348 9:63670235-63670257 ATTTAGAATTTGATAGATAATGG - Intergenic
1054544092 9:66302378-66302400 ATTTAGAATTTGATAGATAATGG + Intergenic
1054749517 9:68890221-68890243 ATGTAATATTTTAGAGACAAAGG + Intronic
1054786958 9:69219305-69219327 ATGAAGATTTTCAAAGAAAAAGG + Intronic
1054966439 9:71033116-71033138 ATGTGGTATTTAAAAAGAAAGGG + Intronic
1055698854 9:78918852-78918874 ATCTAGTATATGACAGAAAGAGG + Intergenic
1056516033 9:87351133-87351155 ATGTGGAATCTAAAAGAAAAAGG + Intergenic
1057544973 9:96011738-96011760 ATGTTGTATTTGTAAAAGAAGGG + Intronic
1058327788 9:103719756-103719778 AAGTAGGATTTGAAACAGAAAGG + Intergenic
1058628870 9:106965236-106965258 ACGTAGAATTTGCAAGAAATTGG + Intronic
1058661996 9:107275033-107275055 ATGTGGTATGTGAGAGAAAGAGG - Intergenic
1058926519 9:109669266-109669288 ATGTATTCATTGAAAAAAAAAGG - Intronic
1058976655 9:110131158-110131180 ATCAAGTATGTGAAAGTAAATGG + Intronic
1059306416 9:113356716-113356738 ATGTAGGCTATGAAAGAAAGAGG + Intronic
1059746792 9:117209056-117209078 ATATATTTTTTGAAAGAGAAAGG + Intronic
1059980766 9:119769453-119769475 ATGTAGTCTCTGGAATAAAATGG + Intergenic
1060019235 9:120114856-120114878 ATGTCATAATTGAAAGAAAGGGG - Intergenic
1060280948 9:122215067-122215089 ATGAAGTATTAAAAATAAAATGG - Intronic
1061471470 9:130829653-130829675 TTGAAGTATTTGAGGGAAAATGG + Intronic
1202788431 9_KI270719v1_random:57339-57361 ATTTAGAATTTGATAGATAATGG - Intergenic
1203618811 Un_KI270749v1:98496-98518 ATGTAGCATATGAAACAAATAGG + Intergenic
1185628544 X:1499688-1499710 ATGTAGTATTTTAAATTATAGGG - Intronic
1185925839 X:4144916-4144938 ATGTATATTTTGAAAAAAAAAGG + Intergenic
1185956415 X:4495745-4495767 ATGTAGCATTTTAGAGAAACGGG + Intergenic
1186189189 X:7052571-7052593 ATGGGGTAATGGAAAGAAAAAGG - Intronic
1186734767 X:12450100-12450122 ATGTATTATTTAAAAGCCAAAGG + Intronic
1186830127 X:13381893-13381915 ATTTAGTATATGAAGAAAAAAGG + Intergenic
1188604360 X:32010320-32010342 ATGCAGAATTGGAAAGAAACGGG - Intronic
1188653114 X:32656063-32656085 ATGTAGTATTAGAAAGTTTAGGG + Intronic
1188657244 X:32713525-32713547 ATATAGTAGCTGAAAGGAAAGGG - Intronic
1188979153 X:36711297-36711319 TTCTAGTATTTGAAACAACATGG + Intergenic
1189644510 X:43112633-43112655 ATATAGTTTTTGAAAGAGATGGG + Intergenic
1189843021 X:45102331-45102353 ATAATGTATGTGAAAGAAAAGGG - Intronic
1190051305 X:47151404-47151426 ATGAAGTATTAGAAATAATAAGG - Intronic
1190774545 X:53542245-53542267 CTGTAGTAAAGGAAAGAAAATGG - Intronic
1190952358 X:55158947-55158969 ATATAGTATCTCACAGAAAATGG - Intronic
1191061355 X:56300173-56300195 GTGTAGTATTCGAACAAAAATGG - Intergenic
1191062578 X:56315324-56315346 GTGTAGTATTTGAACAAAAATGG + Intergenic
1192041380 X:67626135-67626157 ATATAGTATTTGATAGCACAAGG - Intronic
1192780064 X:74284850-74284872 ACGTTGTTTCTGAAAGAAAATGG - Intergenic
1193691791 X:84655128-84655150 ATATACTATTTTAAAGTAAAAGG + Intergenic
1194001834 X:88439338-88439360 TTATTGTGTTTGAAAGAAAAGGG + Intergenic
1194391808 X:93327913-93327935 ATATAATATTTGAAAAATAATGG + Intergenic
1194616967 X:96116519-96116541 TTGTATTATTTGAAACAAAAAGG - Intergenic
1195407596 X:104533461-104533483 ATGTAGTCTCTTAAAGAAAGTGG - Intergenic
1195804770 X:108752169-108752191 ATATAGTATTTGATAGCACAAGG - Intergenic
1195989334 X:110667111-110667133 CTCTAGTAGTTAAAAGAAAAAGG - Intergenic
1196076812 X:111586684-111586706 AAATAGTATTTAAATGAAAATGG - Intergenic
1196506367 X:116448892-116448914 ATGTCGTGTTGGAGAGAAAAGGG - Intronic
1196517741 X:116633029-116633051 ATGTACAATTTGTAAGGAAAGGG - Intergenic
1196894237 X:120318954-120318976 ATGTACAATTTTAAACAAAATGG - Intergenic
1196935595 X:120727546-120727568 ATGTACAATAAGAAAGAAAATGG + Intergenic
1196936930 X:120739632-120739654 ACTCAGTATCTGAAAGAAAAAGG - Intergenic
1197029252 X:121794158-121794180 ATTTATTATTAGAAAGAAAGAGG + Intergenic
1197388974 X:125837498-125837520 TTTTAGTACTTGAATGAAAATGG - Intergenic
1197937433 X:131753848-131753870 ATGTAATTTTTGATAGAACAAGG - Intergenic
1197965909 X:132061584-132061606 ATGTAGAATTTGTAAGAGAAAGG - Intergenic
1197971885 X:132122979-132123001 ATGGAGTATTGAAAGGAAAATGG - Intronic
1198175866 X:134153834-134153856 ATGAAGGAAATGAAAGAAAAGGG + Intergenic
1198848455 X:140939191-140939213 CTGAATTTTTTGAAAGAAAATGG + Intergenic
1199382671 X:147189278-147189300 TTTTAGTCTTTGACAGAAAATGG + Intergenic
1199384936 X:147213061-147213083 TTTTAGTCTTTGACAGAAAATGG + Intergenic
1199386127 X:147225430-147225452 TTTTAGTCTTTGACAGAAAATGG + Intergenic
1199819988 X:151435194-151435216 ATTTAGTAGTTAAAAAAAAATGG + Intergenic
1201706413 Y:16942143-16942165 ATGTAGTTTTTGAAAAGGAAAGG + Intergenic
1202282609 Y:23205938-23205960 TTTTAGTATTTTAAAGAAAGGGG - Intergenic
1202283282 Y:23212581-23212603 TTTTAGTATTTTAAAGAAAGGGG + Intergenic
1202434283 Y:24820323-24820345 TTTTAGTATTTTAAAGAAAGGGG - Intergenic
1202434956 Y:24826967-24826989 TTTTAGTATTTTAAAGAAAGGGG + Intergenic