ID: 1087251475

View in Genome Browser
Species Human (GRCh38)
Location 11:95904948-95904970
Sequence CTTGACAAAAGCATTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 318}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087251475 Original CRISPR CTTGACAAAAGCATTTTTGT TGG (reversed) Intronic
901752446 1:11419035-11419057 CTTGACAAGGGCAGTTTTGATGG - Intergenic
902910483 1:19593217-19593239 ATTGACAAAGGCATTTTTATTGG - Intergenic
906944688 1:50285666-50285688 CTTGAAAAATGCATCTTTGTTGG - Intergenic
907871103 1:58443987-58444009 CTTCACAAAAGCATCTGAGTGGG - Intronic
908757366 1:67481165-67481187 CTGGCCAAAAGCATTGTTATTGG - Intergenic
909296067 1:73950434-73950456 CATGAAAAAGACATTTTTGTAGG - Intergenic
911379809 1:97099058-97099080 ATTGACAAAAGCATTTGTCAGGG - Intronic
911964007 1:104342457-104342479 CTTGACAAAAGCAGTTTCAAGGG + Intergenic
912403253 1:109414127-109414149 CATGTCACAAGCAGTTTTGTAGG - Intronic
913006199 1:114634484-114634506 CTTGAAAAGAGTATTTTTGGTGG - Intronic
913480291 1:119281574-119281596 CTTTACAAAAGCACATTTTTTGG - Intergenic
916696438 1:167241998-167242020 CTTAACCAAGGCATTTTTTTAGG - Intronic
917147056 1:171903682-171903704 ATTGATAAAGACATTTTTGTTGG + Intronic
917916548 1:179708269-179708291 CTTGACAGGAGCAGTTTTGGTGG - Intergenic
918808083 1:189076617-189076639 TCTTACAAAAGCATTTTTATAGG - Intergenic
918938487 1:190956594-190956616 TTCGACAAAAGCAGTTTTTTTGG + Intergenic
919139628 1:193554667-193554689 TTGGACAAAAGCACTTTTATGGG + Intergenic
919929154 1:202209905-202209927 CTAGGTAAAAGCATTTCTGTAGG - Intronic
921106500 1:211986088-211986110 GTTGACAAATGCTTTTGTGTTGG + Intronic
922121257 1:222671351-222671373 CTTTAGAAATTCATTTTTGTTGG - Intronic
922426456 1:225500641-225500663 CTTGCCAAAATCAGATTTGTTGG + Intronic
922684988 1:227632134-227632156 CTTGACATAGGCAGTTATGTGGG - Intronic
924056406 1:240128422-240128444 CTTGACCCAACCATTTTTGCAGG + Intronic
924275556 1:242382607-242382629 CTTGATAAAAGCATTTTTACTGG + Intronic
924381737 1:243471568-243471590 CTTGACAAAGGCCTTTTCGGAGG + Intronic
924634868 1:245775970-245775992 ACTGACAAAATAATTTTTGTGGG + Intronic
924890014 1:248266181-248266203 CTTAAAAAAAGAATTTTTATAGG - Intergenic
1063237667 10:4135218-4135240 CTGGACAAGAGCAGTTTGGTTGG + Intergenic
1063754332 10:8989306-8989328 CTTGACTAAAGCTTTATTGAAGG - Intergenic
1063997472 10:11633920-11633942 CTTGAAAAAAGAATAGTTGTTGG - Intergenic
1065432957 10:25677996-25678018 CTTGATAAAAGCACTTTTGGCGG - Intergenic
1068491237 10:57726897-57726919 TTTGACAAATGCATCTTTATTGG + Intergenic
1068568342 10:58600228-58600250 TTTTTCAAAATCATTTTTGTTGG + Intronic
1068625226 10:59238395-59238417 CATAACAAAAATATTTTTGTAGG + Intronic
1068716012 10:60189177-60189199 CTTGATTAAAACATTTTTTTAGG - Intronic
1068722563 10:60262390-60262412 CATGACAAAAGCAGTTTTGGGGG + Intronic
1071045274 10:81366303-81366325 ATTGACAAGAGTACTTTTGTGGG - Intergenic
1071368215 10:84923239-84923261 CTTTACAAATGCATTTTTCAAGG + Intergenic
1071552233 10:86575479-86575501 CTTGAGAAAAAAATTTTTGGGGG + Intergenic
1071807860 10:89143767-89143789 CTTGAGAAAAGCTGTTTTGGTGG - Intergenic
1072231284 10:93416022-93416044 CTAGACAAGAGCAGTTTTGGTGG - Intronic
1072402332 10:95117671-95117693 CTTGACAAGAGGTTTTTTTTTGG + Intergenic
1074166445 10:110881120-110881142 CATGACATTACCATTTTTGTAGG - Intronic
1076151580 10:128166367-128166389 CTTGTCAAAACCAGTATTGTTGG + Intergenic
1076201276 10:128560604-128560626 TTTTTCAAAAGCATTTTGGTTGG - Intergenic
1078372352 11:10759405-10759427 CTTGATAAAAGCAGTTTTACTGG + Intronic
1078635699 11:13047721-13047743 CTTGGCAAAAGCAATTTTATTGG - Intergenic
1079489396 11:20970699-20970721 CTGGACCAAAGGATTTTGGTAGG + Intronic
1081165738 11:39807666-39807688 CATGACAAAAATATCTTTGTAGG + Intergenic
1081285936 11:41270276-41270298 CTTGACTATAGCAATTTTGCAGG + Intronic
1082582516 11:54890288-54890310 TTTGAAAACACCATTTTTGTAGG + Intergenic
1082798693 11:57397614-57397636 CTGGGCAAAAGCAGTTTTGGTGG - Intronic
1082954082 11:58850307-58850329 CTTATCAAATGCTTTTTTGTGGG + Intronic
1083032103 11:59602453-59602475 CTTGATATAATCATATTTGTGGG - Intronic
1083063801 11:59902085-59902107 ATCTACAAAGGCATTTTTGTAGG - Intergenic
1084255344 11:67938348-67938370 CTCGAAAAAATCATTTTTTTGGG - Intergenic
1085437031 11:76515187-76515209 CTTGGTAAAAGCATTTTTTTGGG + Intronic
1085440586 11:76559066-76559088 CTTGGGAAAAGCAGTTTTGGTGG + Intergenic
1085888193 11:80545701-80545723 ATTGGCAAAAGCACTTTAGTAGG - Intergenic
1087251475 11:95904948-95904970 CTTGACAAAAGCATTTTTGTTGG - Intronic
1087671473 11:101112119-101112141 CTTGACAAGAGAAGTTTTGGTGG + Intronic
1088631757 11:111780264-111780286 CTTTACAAAAGCATTTTAGAAGG - Intergenic
1091123172 11:133073732-133073754 CTTGGCAAAAGCATTGTTGAAGG - Intronic
1091335113 11:134760696-134760718 TTTTACAAAATCATTGTTGTAGG + Intergenic
1091496273 12:975776-975798 CTTGACAAGAGCAGTTTACTGGG - Intronic
1093040322 12:14371540-14371562 CTTGAGAAATGCATTTTGGTAGG + Intronic
1093250801 12:16802158-16802180 CTTTATAAAAACATTTTGGTTGG + Intergenic
1095295168 12:40519129-40519151 CCTGTGAAGAGCATTTTTGTTGG + Intronic
1098434532 12:70454341-70454363 CTTCTCAAAAGCATTTTGGATGG + Intergenic
1099222495 12:79932005-79932027 ATTTTCAAAAGCATATTTGTGGG + Intronic
1100418860 12:94409034-94409056 CTTAGAAAAAGCATTTTTGTAGG + Intronic
1100770377 12:97914855-97914877 CTTGACTAAAGCAGTATTGGTGG - Intergenic
1100913780 12:99394491-99394513 CTTGACAAGAGCAATTTGGTTGG - Intronic
1101026414 12:100611453-100611475 TTTGACCAAATCATTTTTCTAGG + Intronic
1101390628 12:104296602-104296624 CTTTACAAAAGGCTTTTTGTTGG + Intronic
1101806473 12:108068579-108068601 CTTTAAAAAAGGATTTTGGTGGG + Intergenic
1102207586 12:111101019-111101041 CTTGACAAAACCATCTTGGTTGG - Intronic
1102334920 12:112070421-112070443 ATTGACAAAAGAATATTTGGTGG - Intronic
1105320879 13:19320441-19320463 CTTGAGAAAAACAATTTTGGAGG + Intergenic
1105453317 13:20519349-20519371 CATGACAAGAGCAGATTTGTGGG + Intronic
1107126262 13:36850096-36850118 CTTGACAAGAAAAGTTTTGTTGG - Intronic
1107212594 13:37875242-37875264 GAGGACCAAAGCATTTTTGTAGG + Intergenic
1108097162 13:46915065-46915087 CTTCTCAAAAGCATTTATCTCGG - Intergenic
1108476181 13:50820165-50820187 CTTGACAAGAGAAGTTTTGATGG + Intronic
1108512120 13:51165715-51165737 CTTGACAAGAGCAATTTTGGTGG + Intergenic
1108916137 13:55614367-55614389 CTTAAGGAAAGCATGTTTGTAGG + Intergenic
1108934844 13:55871155-55871177 CTTATCAAAAGCTTTTTTGTTGG - Intergenic
1108962012 13:56246454-56246476 CTTTACAACAGCCGTTTTGTGGG - Intergenic
1110290467 13:73800160-73800182 CTTGACAAAAGGCTTATTCTAGG - Intronic
1112360589 13:98714235-98714257 CTTGGAAAAAGCTTTTTGGTGGG + Intronic
1115252753 14:31366538-31366560 ATTTAGAAAAGCATTTTTATTGG + Intronic
1115957666 14:38799149-38799171 AGTGACAAAAGCAGTTTTGTAGG + Intergenic
1116104750 14:40487568-40487590 CTTGCCAAAAGGAATTTTGAGGG - Intergenic
1116598034 14:46879067-46879089 ATTGACATATGCATTTTTATGGG - Intronic
1116798261 14:49414694-49414716 CTTGACCAAAACATTGTTATGGG - Intergenic
1117516989 14:56511760-56511782 CTTGACAAAGGCAGTTCTGAAGG + Intronic
1117670303 14:58099501-58099523 CTTGACAAAAGTTGTTTTGGAGG + Intronic
1118939186 14:70316918-70316940 CTTGACAAAACCCTCTTTCTTGG - Intergenic
1118995362 14:70830776-70830798 GTTGAAAAAATTATTTTTGTAGG - Intergenic
1120826274 14:88958493-88958515 CTTATCAAAAGCCTATTTGTAGG - Intergenic
1122758025 14:103997844-103997866 CTTGACAAGAGCAGCTTTGGTGG + Intronic
1124918350 15:33998636-33998658 CTTCACAAGTGCAGTTTTGTTGG - Intronic
1126776274 15:52103299-52103321 CTTAAGAAAAGCAATTTTGCTGG - Intergenic
1127738881 15:61877436-61877458 CTTGACATAACCATTTTTAACGG + Intronic
1134605750 16:15569911-15569933 CTTTACAAAGGCAGTTTAGTTGG + Intronic
1135105330 16:19644661-19644683 CTTGAGAACAGCATATTTGAGGG + Intronic
1139538851 16:67598710-67598732 CTCGATAAAAGCAATTCTGTAGG + Intronic
1139695729 16:68673129-68673151 TTTGGCAAATGTATTTTTGTTGG + Intronic
1140822565 16:78676975-78676997 TTTGCCAAATGCATTTTTATTGG + Intronic
1141971226 16:87484385-87484407 TTTGACAAAAACAATTTTTTCGG - Intronic
1144113183 17:12059018-12059040 CTTAAAAAAAGGATTTTTGGGGG + Intronic
1144378706 17:14671369-14671391 CTTGGAAAAGGCATTTTTCTAGG + Intergenic
1144485510 17:15660970-15660992 CTTGTCAAGAGTATTTTAGTAGG + Intronic
1144684483 17:17216800-17216822 CTTGGTAAAAGCTTCTTTGTGGG - Intronic
1144904308 17:18627602-18627624 TTTGATAAGAGCAATTTTGTTGG - Intergenic
1145197092 17:20903346-20903368 TTTGAGAAGAGCAATTTTGTTGG - Intergenic
1147975116 17:44242935-44242957 CTTTACAAAAAAATTTTAGTTGG + Intergenic
1149406572 17:56357838-56357860 GTAGACAAAACCATTTTTGTAGG - Intronic
1151784905 17:76270628-76270650 TTTTATAAAAGAATTTTTGTGGG + Exonic
1153439903 18:5104682-5104704 ATTGACAAAATCATATTGGTAGG - Intergenic
1153609585 18:6869950-6869972 CTTGAGAAAAACATTTTTAAGGG + Intronic
1153658074 18:7303034-7303056 ATTGCCAAAATCAATTTTGTTGG - Intergenic
1153690728 18:7590712-7590734 AGTGACAAAATCATTTGTGTAGG + Intronic
1155108419 18:22689635-22689657 CTTGACAGGAGCAGTTTTGATGG - Intergenic
1158204134 18:54972878-54972900 CATGACAACAACAGTTTTGTTGG - Intergenic
1159994209 18:74947182-74947204 AAGGACAAAAGCAATTTTGTGGG + Intronic
1163068329 19:14816195-14816217 CTTTTTAAAAGAATTTTTGTGGG - Intronic
1164637152 19:29799925-29799947 AGTGACAAAGGCATTTTGGTGGG + Intergenic
1164745432 19:30609305-30609327 CTAGACAAGAGCTATTTTGTGGG - Intronic
1165997537 19:39855056-39855078 CTTGAGAAAAGCTATTTTGGTGG - Intergenic
1166881475 19:45933067-45933089 CAAGACAAAAGCCTGTTTGTGGG + Intergenic
925681568 2:6427541-6427563 CTTGACAAAGGCTTTCCTGTTGG - Intergenic
927312318 2:21645075-21645097 CTTTATAAAAGCATTTTAGGAGG - Intergenic
929753252 2:44739672-44739694 TTTGACAGCAGCATTTTTGGTGG + Intronic
931519571 2:63080927-63080949 CTTAACCATACCATTTTTGTGGG + Intergenic
931554766 2:63490304-63490326 CAGGACAAAATCCTTTTTGTAGG + Intronic
931799626 2:65746308-65746330 ATTGATAAAGGCCTTTTTGTTGG + Intergenic
931835251 2:66092355-66092377 CTTGGGAGAAGCATGTTTGTTGG - Intergenic
933237656 2:79882876-79882898 CATGAAAAAAGCAGTTTTGCCGG + Intronic
933647571 2:84825014-84825036 CTTGACAAAAGTTCTGTTGTTGG - Intronic
935012964 2:99153236-99153258 CTTAGCAAAAGCACTTTTGCTGG + Intronic
935202592 2:100870810-100870832 CTTGCCACAAGCATATCTGTTGG - Intronic
936797123 2:116220029-116220051 ATTGACTTTAGCATTTTTGTAGG - Intergenic
936961689 2:118081774-118081796 CATCACAGTAGCATTTTTGTCGG - Intergenic
936999310 2:118450194-118450216 CTTAAGATAAGCATTTTTGCTGG - Intergenic
937469674 2:122164463-122164485 CTTGACAAGAGCAGTTTTGATGG + Intergenic
938542687 2:132298231-132298253 CTTGTTAAAAACATTCTTGTGGG + Intergenic
939418217 2:141928952-141928974 CCTGATAAAAGTATCTTTGTAGG + Intronic
939523911 2:143267742-143267764 CATGCCAAAAACATTTATGTAGG - Intronic
939615716 2:144360156-144360178 CTTGACAAAATCTTTTTCATGGG + Intergenic
940342882 2:152600005-152600027 CCTGACAAAACCACTTTTCTGGG - Intronic
940898362 2:159103194-159103216 CTGGACAAAAGTATTCCTGTTGG - Intronic
940898621 2:159105468-159105490 CTGGACAAAAGTATTCCTGTTGG - Intronic
941079897 2:161048525-161048547 TCTAACAAAGGCATTTTTGTAGG - Intergenic
941396459 2:164980106-164980128 CTAGAAAAAAGGATTTTTCTTGG + Intergenic
941447624 2:165622301-165622323 CTTGATATATACATTTTTGTAGG + Intronic
941909722 2:170752427-170752449 GTTGACAAAAGAAGTTTTCTTGG - Intergenic
943388977 2:187238371-187238393 ATTGAAAAATGTATTTTTGTTGG + Intergenic
943671002 2:190660336-190660358 CTTTTAAAAAACATTTTTGTAGG + Intronic
944556986 2:200896928-200896950 CCTGACAAAATCATTCTTCTAGG - Intronic
944651030 2:201830471-201830493 CGTTGCAAAAGCATTTTTATAGG + Intronic
946599611 2:221345074-221345096 CTTAGCAAGAGCAGTTTTGTAGG - Intergenic
1169632593 20:7649490-7649512 CTTGACAGAAGCATTTGGCTGGG - Intergenic
1170212816 20:13862217-13862239 CTTGACATATTCATGTTTGTTGG - Intronic
1170878049 20:20268910-20268932 CTTATTAAAAGCATGTTTGTAGG + Intronic
1171871567 20:30531079-30531101 CTTGTTAAAAACATTCTTGTGGG + Intergenic
1172157278 20:32836585-32836607 CTTGCCAAAAGCCTCTTTTTTGG + Intronic
1172333764 20:34096677-34096699 GTTGACAAAAGAAGTTTTCTTGG + Exonic
1173738655 20:45380170-45380192 CTTGTGAAAAACATTTTTGTGGG + Intronic
1175694438 20:61090871-61090893 ATTGACAAAAGAATTTTCCTGGG + Intergenic
1176082294 20:63279841-63279863 CTTTAAAAAATGATTTTTGTAGG + Intronic
1176129334 20:63489879-63489901 GTTAACAAAAGCGTTTTTCTAGG + Intronic
1177084559 21:16687343-16687365 GCTTACAAAACCATTTTTGTAGG - Intergenic
1177547349 21:22576040-22576062 CATGGCAAAAGAAATTTTGTAGG + Intergenic
1178031800 21:28536171-28536193 CTTGAAAAAAGCTTTTCTGAAGG - Intergenic
1178220297 21:30649632-30649654 CTTCACAAGATCATTTATGTAGG + Intergenic
1181336100 22:22130516-22130538 CTTGATAACAGCAATATTGTAGG - Intergenic
1183861495 22:40673544-40673566 CTTGACAAAGTCATTGTTGAGGG + Intergenic
1184114213 22:42412878-42412900 CATGACAAAGCCAGTTTTGTAGG + Intronic
949946823 3:9196169-9196191 CTTGTCAAATGCATGGTTGTTGG - Intronic
950818782 3:15735447-15735469 CTTGTCAAAAGCATTAATATTGG + Exonic
951189022 3:19747884-19747906 CTTAACAAAAGCAATTTTCATGG + Intergenic
951844721 3:27073037-27073059 CTTTCCAATAGCAGTTTTGTAGG - Intergenic
951899840 3:27645938-27645960 CCTGACAATAGCATATTGGTCGG + Intergenic
951925065 3:27900493-27900515 CTTGACTAAAATGTTTTTGTGGG + Intergenic
953152875 3:40341079-40341101 CTTGGGAAAGGCATTTTGGTGGG + Intergenic
954823220 3:53348972-53348994 CTGGACAAAAATATTTATGTGGG - Intergenic
955208325 3:56917620-56917642 CTTGGCAAATGCATTTTCATGGG + Intronic
956228446 3:66986269-66986291 CCTGGCAAAAGGATATTTGTGGG + Intergenic
956228774 3:66989164-66989186 CCTGGCAAAAGGATATTTGTGGG - Intergenic
956567562 3:70656164-70656186 CTTGAGACAAGGATTTTAGTGGG - Intergenic
956920365 3:73921894-73921916 CTTCACAAAAGCTTTCCTGTGGG + Intergenic
957566456 3:81890517-81890539 CTACACCACAGCATTTTTGTGGG + Intergenic
958649280 3:96916747-96916769 CTTGAGAATATCATTTTTATAGG + Intronic
959790541 3:110355972-110355994 ATTTACAAAAGGTTTTTTGTTGG - Intergenic
960634726 3:119772928-119772950 CTTGACAAAAGCATCTATAAAGG + Intergenic
961929786 3:130521193-130521215 GTTGGCAAAGGCATTTGTGTTGG + Intergenic
962159215 3:132981103-132981125 CTTGACAAAACAGTTGTTGTTGG + Intergenic
962744141 3:138384971-138384993 CTTGACAAGATCAGTTTTGATGG + Intronic
963118337 3:141753197-141753219 CTTTAAAAAAGCAATTTTGGAGG - Intergenic
963419729 3:145046168-145046190 CTTTACAAAAATATTTTTGCTGG + Intergenic
963471759 3:145750096-145750118 CTGGACAAAAGGTTTTTTGTTGG - Intergenic
963538743 3:146560914-146560936 CTTCAAACAAGCATTTTTATAGG - Intergenic
964602631 3:158518651-158518673 TTTGACAAAAGCAGTTTTAATGG - Intronic
964734726 3:159905089-159905111 CAAGACAAAAGCATTTTCATGGG + Intergenic
964987576 3:162763514-162763536 CATGACAAAAGATATTTTGTAGG - Intergenic
964993297 3:162843003-162843025 ATTCACAAAAGCAATTCTGTAGG - Intergenic
965192159 3:165545501-165545523 CTTGACCAATACATTTTTCTAGG + Intergenic
965379919 3:167975428-167975450 ATTAACACAAGCATTGTTGTAGG + Intergenic
965685752 3:171300491-171300513 CTTTAAAACAGCATATTTGTAGG - Intronic
966450215 3:180050532-180050554 TTTGACAAAAGCAGTTTTAGTGG - Intergenic
966483714 3:180444189-180444211 ATTGACAGGAGCAGTTTTGTTGG - Intergenic
966684722 3:182681942-182681964 CCTGTCAAAAGCATTCATGTTGG - Intergenic
968596100 4:1486374-1486396 CTTGACAAGAGCAATTTTCATGG - Intergenic
969857026 4:10008187-10008209 CTCAACAAAGGCATTTTTCTTGG + Intronic
969958068 4:10912372-10912394 CTTGACAAAAGCATTTTCTGTGG - Intergenic
970213889 4:13738588-13738610 CTTGACAGAATCAGTTTTGGTGG + Intergenic
971901227 4:32660730-32660752 CTTGAAAAAATTGTTTTTGTTGG + Intergenic
973158383 4:46986783-46986805 CTTGACAACTCCATTTTTCTAGG + Intronic
973544219 4:51964333-51964355 TTTGACAGAGGCACTTTTGTAGG + Intergenic
973787748 4:54349314-54349336 CTGGACAAAAGCAGTTTTAGTGG + Intergenic
974844470 4:67334599-67334621 CTTGAAAATAGGATTTTTGAGGG - Intergenic
975770231 4:77712345-77712367 CTTCACAGAAGCCTTTGTGTTGG - Intergenic
976652100 4:87446952-87446974 TTTGACAAAAGCATGTATGTTGG - Intronic
977534880 4:98245589-98245611 CTTAAAAGAAGCATTTTTGGTGG + Intergenic
977980159 4:103311711-103311733 CTTGACAAAAGCAGTTTTGGTGG + Intergenic
978082154 4:104606400-104606422 ATAGACAAAAGCATCTCTGTAGG - Intergenic
979221317 4:118228998-118229020 TTTGTCAAAAGTATTTTTCTGGG + Intronic
979793687 4:124817641-124817663 TTTGAGAAAAACATTTTTTTTGG - Intergenic
980017190 4:127663454-127663476 CTTGACTAAATCACTTGTGTTGG - Exonic
980592706 4:134912171-134912193 CCTGAGAAAAACATTTTTTTGGG - Intergenic
981269628 4:142830366-142830388 CTTGACAAAAGCAATTTCATTGG + Intronic
981579767 4:146239615-146239637 CTTAAGGAAAGCATTTTTGAGGG - Intergenic
981870138 4:149475857-149475879 CTTGACATGAGCAGTTTTGATGG + Intergenic
982219732 4:153114270-153114292 CTTGACAAAAGGAGTTTCGGGGG - Intergenic
984554902 4:181202050-181202072 CTTGATAAGACCATTTTTGCTGG - Intergenic
984620183 4:181944003-181944025 CTGGACAAAACCAGTTCTGTGGG - Intergenic
985199675 4:187471940-187471962 CATGGCAAAAACATTTTAGTAGG + Intergenic
986854491 5:11853164-11853186 CCTGACCAAAGCAGTTTTGGTGG - Intronic
990646799 5:57854569-57854591 CTTGTCAAAAGCCTTTTGCTTGG - Intergenic
990759893 5:59117281-59117303 TTTGACAAAAGCAATTTTTAAGG - Intronic
991694864 5:69261432-69261454 CTTGATAAGAGCAGTTTTGATGG + Intronic
992192918 5:74311809-74311831 TCTGACAAAAGCACTTTAGTGGG + Intergenic
992479020 5:77131767-77131789 CTTAACAAAAGGCTTTTTTTGGG + Intergenic
993894413 5:93514631-93514653 CTTAAGAAAAGCATTTTAGTTGG + Intergenic
993995197 5:94714306-94714328 CTTGAAAAAAATATTTTTGCAGG + Intronic
994729660 5:103476850-103476872 CTAGACAAAAGCATCTTAGTGGG - Intergenic
994965157 5:106660271-106660293 CTTGATAACAGCATTGTTGGAGG + Intergenic
995904741 5:117109948-117109970 CTTGAGAAAGGCACTTTTCTAGG + Intergenic
996081950 5:119267093-119267115 CATGGCAAAAGAATTTTTGCAGG - Intergenic
996102052 5:119454196-119454218 TTTCACAAAATCAATTTTGTGGG - Intronic
996228303 5:121029736-121029758 CTTGGTAAAAGCATTTTAATTGG + Intergenic
996409974 5:123147697-123147719 CTTGGCAAAAGCATATATGCTGG - Intronic
996987910 5:129590860-129590882 CTTCACAATTACATTTTTGTTGG + Intronic
997977786 5:138450262-138450284 CATGAAGAAAGCATTCTTGTGGG + Intergenic
998018080 5:138748724-138748746 CTTCATAAAAGCAGTTTTGGTGG + Intronic
998065112 5:139151773-139151795 CTTCCCACAAGCATTTCTGTCGG + Intronic
998890934 5:146744913-146744935 TTTGATAAAAGTATTTTTGTTGG - Intronic
1000402674 5:160848200-160848222 CTTCTCAATAGCATTTCTGTTGG - Intronic
1000404257 5:160869920-160869942 CCTGACAGAAGCATGTTTGAAGG - Intergenic
1000982360 5:167829482-167829504 ATTGACAAAAGAATGTCTGTGGG - Intronic
1001885060 5:175282380-175282402 CTTCACAAAAATCTTTTTGTAGG - Intergenic
1002676135 5:180914760-180914782 ATGAACAAAAGTATTTTTGTAGG + Intronic
1002817613 6:694203-694225 CTTGACAAAAGCAGTTTCAAAGG + Intergenic
1005126816 6:22455980-22456002 CTTTACAAAGGCATTTTTACTGG - Intergenic
1005148487 6:22720921-22720943 CTTGACAAACACAGATTTGTAGG + Intergenic
1005489925 6:26338302-26338324 TTTGATAATAGGATTTTTGTTGG + Intergenic
1008655565 6:53609298-53609320 TTTGACATAATCATTTTTGGTGG - Intronic
1008764713 6:54897757-54897779 CTTGCCAAAAGCATTACTGATGG - Intronic
1008893646 6:56526068-56526090 GTAGACAAAAGCATTTTGTTTGG + Intronic
1011274075 6:85611603-85611625 CTTGGCAAAAAAATTTTTGAGGG + Intronic
1011320599 6:86088173-86088195 GCTGACAAAAGCACTTTTGCAGG + Intergenic
1011891610 6:92169535-92169557 CATGACAAAAACATTTTTAAAGG - Intergenic
1011962438 6:93107604-93107626 CTTGACAAAAGCAGTTTCAGGGG - Intergenic
1011973027 6:93252538-93252560 CTAGATAAAAGCTTTTTTCTAGG - Intronic
1012185167 6:96205385-96205407 CTTGAAACAATCATTTTTCTGGG - Exonic
1012914646 6:105156510-105156532 CTTAACAAGAGCAGTTTTGGTGG - Intergenic
1014336508 6:120143412-120143434 TAAGACAAAAGCATTTTTGTGGG - Intergenic
1014973018 6:127842512-127842534 CTTAAAAAAATCATTTTTATTGG - Intronic
1015686972 6:135875853-135875875 CCTCACAAAAGAATTTTTGTTGG - Intronic
1015708117 6:136110191-136110213 CTTCCAAAAAGCATTTTTGAGGG - Intronic
1015768552 6:136745402-136745424 CCTGACAAAACCTTTTTTCTAGG - Intronic
1016578047 6:145592773-145592795 CTTTAAAAAAGCTTTTTTGGTGG - Intronic
1016639283 6:146330242-146330264 CTTGTTAAATGGATTTTTGTTGG + Intronic
1017814968 6:158010083-158010105 CTTTTTAAAAGAATTTTTGTAGG + Intronic
1017837272 6:158189831-158189853 CTTGGCAATAGCAGTTTTGGTGG - Intronic
1020482013 7:8672974-8672996 CTTGACTAAAGCAATCTTGATGG - Intronic
1020647998 7:10839398-10839420 CTTAAAAAAAGCATTTTTGGGGG - Intergenic
1023026502 7:36055473-36055495 CTGGCCAGAAGCATTTCTGTAGG + Intergenic
1024188634 7:46981984-46982006 TTTGACAAAAACATTTGTTTTGG - Intergenic
1024430010 7:49277291-49277313 CCTGAAAAAAATATTTTTGTGGG - Intergenic
1025970632 7:66321008-66321030 CATGAATAATGCATTTTTGTTGG + Intronic
1026367577 7:69664672-69664694 CTATACACAAGCATTTATGTAGG + Intronic
1026478355 7:70757136-70757158 TTTGAAAAAAGCAATTTTGTGGG + Intronic
1026661347 7:72305288-72305310 CCTGCCAAAAGCATTCCTGTCGG - Intronic
1027418937 7:78001288-78001310 CCTAACAAAAGCAGTTTTGGAGG + Intergenic
1028380102 7:90190694-90190716 CTTTATAAAAGGAATTTTGTAGG - Intronic
1028672086 7:93412860-93412882 TTTCACATTAGCATTTTTGTGGG - Intergenic
1029046624 7:97636000-97636022 CTACACAAAAGAAGTTTTGTTGG - Intergenic
1029392083 7:100282246-100282268 CTTGACAAACACCTATTTGTAGG - Intergenic
1030149136 7:106385360-106385382 CTTGTGAAAAGCAATTTTATTGG + Intergenic
1030161100 7:106509252-106509274 CTACAGAAAAGCATTTTTGCAGG - Intergenic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1031306786 7:120138555-120138577 CTTAACAAAAGCCCATTTGTTGG + Intergenic
1032423547 7:131802279-131802301 CATGAAAAAGCCATTTTTGTGGG + Intergenic
1036106216 8:5843558-5843580 CATGACAAAACCATTTATTTAGG - Intergenic
1036507863 8:9372092-9372114 CGTGACAAAAGCATTCATGTTGG + Intergenic
1037426099 8:18756407-18756429 AATGACAAAAGCAATTTTCTTGG + Intronic
1037583079 8:20257448-20257470 CTTGACAAGAGCAGTTTTGGAGG + Intronic
1037919542 8:22795613-22795635 CTTGACAAAATGATCTTTATTGG - Intronic
1039203271 8:35120351-35120373 CTTGAGAATAGCATTTTGGAAGG + Intergenic
1040277921 8:46023381-46023403 CTTCACAACAGCATTTGTGCTGG - Intergenic
1040407450 8:47119568-47119590 CTTGAGAAAAACAATTTTGGAGG + Intergenic
1040574849 8:48642843-48642865 ATTGACAAAAACATTTCTCTGGG - Intergenic
1042171916 8:65999928-65999950 CTTAACAAAAGCATCTTTAGTGG + Intergenic
1042691566 8:71505430-71505452 TTTCACAAAAGTGTTTTTGTTGG - Intronic
1042856633 8:73274075-73274097 CTTGTCAAAAGGACTTTTTTTGG + Intergenic
1043609239 8:82041833-82041855 CATGAGAAAAGCATATTTGGGGG - Intergenic
1044421865 8:92005759-92005781 CTTGACAAAAGATATTTTCTGGG - Intronic
1045114863 8:98971852-98971874 TTTTAAAAAAGCTTTTTTGTTGG + Intergenic
1045219554 8:100185116-100185138 CATGGGAAAAGCATTTTTGATGG - Intronic
1045811547 8:106226070-106226092 GTTGACAAAAGCATTTTTGGAGG - Intergenic
1045847145 8:106650830-106650852 CTTGAGAAAAGTATTTTTAAGGG - Intronic
1046658030 8:116917341-116917363 ATTGACAAAAGCTTTATTGGAGG - Intergenic
1046818716 8:118613846-118613868 CTTAACACCAGCAATTTTGTAGG - Intronic
1047028587 8:120851490-120851512 TATGAAAAAAGGATTTTTGTAGG - Intergenic
1047531120 8:125676766-125676788 CTTAACAAAAGCAATGTTTTTGG + Intergenic
1047932569 8:129745105-129745127 TTTGACAAAAGCAATTTTCATGG - Intergenic
1048267770 8:133002808-133002830 CTTGACAAGAGAATTAATGTGGG - Intronic
1048511148 8:135064028-135064050 CTTGAGAAAGGGATTCTTGTGGG + Intergenic
1049998787 9:1053803-1053825 CTGGCCAAAAGCATTTTAGAAGG + Exonic
1052584074 9:30402002-30402024 ATTGAGAAAAGGATTTTTGGAGG + Intergenic
1055581763 9:77713522-77713544 ATTGACATAAACATTTGTGTGGG + Intergenic
1055726999 9:79241037-79241059 TTAGGGAAAAGCATTTTTGTTGG + Intergenic
1055926317 9:81514036-81514058 TCAGACAAAAGCATTATTGTGGG + Intergenic
1056507877 9:87274798-87274820 CTTTACAAAAGCATGTGTATTGG + Intergenic
1058253600 9:102733116-102733138 CTTGACAAGAACATTTTTGATGG - Intergenic
1059646250 9:116270935-116270957 CTTAAAAAAAGCATATTTGAAGG - Intronic
1059970138 9:119658866-119658888 CTTGACAAGAGCAGATTTGGTGG + Intergenic
1060383028 9:123194666-123194688 CTTGACAAGAGCTGTTTTGATGG - Intronic
1185812162 X:3120696-3120718 CTTGACAAATGTATTGTTCTTGG - Intergenic
1186367807 X:8913677-8913699 CTTGAGAAAAGGATTTTGGTTGG + Intergenic
1187661884 X:21556677-21556699 CTTGACAATAGCAGTTTTGGTGG + Intronic
1188012066 X:25067400-25067422 CTTGACAAAATGATTTTTGAGGG + Intergenic
1191167319 X:57404533-57404555 CTTGACATGAGCAGTTATGTGGG - Intronic
1192595228 X:72399918-72399940 CTTGACAAGAGCAGTTTTGATGG - Intronic
1194265592 X:91749909-91749931 AATGAAAAGAGCATTTTTGTAGG + Intergenic
1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG + Intergenic
1195419169 X:104654341-104654363 GTTGAGAAAGGCCTTTTTGTGGG + Intronic
1197793215 X:130275771-130275793 TTTGACAAACCCATTTTTGATGG - Intergenic
1198459847 X:136852635-136852657 CTTGACAAGAGCAGTTTCGGTGG + Intronic
1198516739 X:137416244-137416266 CTTGATAAGAGCAGTTTTGGTGG + Intergenic
1198635865 X:138699566-138699588 CTTAACAAAAACAGTTTTGGTGG - Intronic
1198861575 X:141076413-141076435 TTTGACAAGAGCAGTTTTATTGG - Intergenic
1198901116 X:141510970-141510992 TTTGACAAGAGCAGTTTTATTGG + Intergenic
1199689647 X:150298643-150298665 CTTGACGTAAGCATTTGTTTTGG + Intergenic
1199838573 X:151619706-151619728 CTTGACAAAAGCAGTTTCAGTGG + Intronic
1200276310 X:154736245-154736267 CTTGACAAGAGCAGTTTTGATGG + Intronic
1200582742 Y:4970351-4970373 AATGAAAAGAGCATTTTTGTAGG + Intergenic
1200760081 Y:7029567-7029589 CTTTAAAAAATCATTTTGGTTGG - Intronic