ID: 1087252403

View in Genome Browser
Species Human (GRCh38)
Location 11:95917766-95917788
Sequence CAGCATGTGCAACATGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 290}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087252403_1087252414 15 Left 1087252403 11:95917766-95917788 CCCTCATCATGTTGCACATGCTG 0: 1
1: 0
2: 5
3: 28
4: 290
Right 1087252414 11:95917804-95917826 GGTTGGTCTTGCTGTGTCAGGGG 0: 7
1: 188
2: 407
3: 461
4: 488
1087252403_1087252413 14 Left 1087252403 11:95917766-95917788 CCCTCATCATGTTGCACATGCTG 0: 1
1: 0
2: 5
3: 28
4: 290
Right 1087252413 11:95917803-95917825 GGGTTGGTCTTGCTGTGTCAGGG 0: 7
1: 202
2: 439
3: 506
4: 563
1087252403_1087252410 -6 Left 1087252403 11:95917766-95917788 CCCTCATCATGTTGCACATGCTG 0: 1
1: 0
2: 5
3: 28
4: 290
Right 1087252410 11:95917783-95917805 ATGCTGAGGAGGAAAAGGAGGGG 0: 1
1: 2
2: 33
3: 147
4: 1074
1087252403_1087252412 13 Left 1087252403 11:95917766-95917788 CCCTCATCATGTTGCACATGCTG 0: 1
1: 0
2: 5
3: 28
4: 290
Right 1087252412 11:95917802-95917824 GGGGTTGGTCTTGCTGTGTCAGG 0: 5
1: 181
2: 499
3: 581
4: 1001
1087252403_1087252408 -8 Left 1087252403 11:95917766-95917788 CCCTCATCATGTTGCACATGCTG 0: 1
1: 0
2: 5
3: 28
4: 290
Right 1087252408 11:95917781-95917803 ACATGCTGAGGAGGAAAAGGAGG 0: 1
1: 0
2: 6
3: 82
4: 695
1087252403_1087252411 -2 Left 1087252403 11:95917766-95917788 CCCTCATCATGTTGCACATGCTG 0: 1
1: 0
2: 5
3: 28
4: 290
Right 1087252411 11:95917787-95917809 TGAGGAGGAAAAGGAGGGGTTGG 0: 1
1: 25
2: 182
3: 697
4: 3310
1087252403_1087252415 18 Left 1087252403 11:95917766-95917788 CCCTCATCATGTTGCACATGCTG 0: 1
1: 0
2: 5
3: 28
4: 290
Right 1087252415 11:95917807-95917829 TGGTCTTGCTGTGTCAGGGGTGG 0: 5
1: 194
2: 426
3: 563
4: 634
1087252403_1087252409 -7 Left 1087252403 11:95917766-95917788 CCCTCATCATGTTGCACATGCTG 0: 1
1: 0
2: 5
3: 28
4: 290
Right 1087252409 11:95917782-95917804 CATGCTGAGGAGGAAAAGGAGGG 0: 1
1: 2
2: 6
3: 90
4: 711

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087252403 Original CRISPR CAGCATGTGCAACATGATGA GGG (reversed) Intronic
900009760 1:95556-95578 CAACAACAGCAACATGATGATGG + Intergenic
900025872 1:272140-272162 CAACAACAGCAACATGATGATGG + Intergenic
900035657 1:405997-406019 CAACAACAGCAACATGATGATGG + Intergenic
900057278 1:641747-641769 CAACAACAGCAACATGATGATGG + Intergenic
901335335 1:8444193-8444215 CAGCCTGGGCAAACTGATGAGGG - Intronic
901943187 1:12679540-12679562 CAGCCTGGACAACATAATGATGG + Intergenic
902875150 1:19336476-19336498 CAGCCTGGGCAACAGGGTGAGGG + Intergenic
903345841 1:22683909-22683931 AATCATGTGTGACATGATGATGG + Intergenic
904288910 1:29471255-29471277 CAGCATGTGCAAAAGGGAGAGGG + Intergenic
904532386 1:31177769-31177791 CAGCATGAGCAAAATGGTGGAGG - Intergenic
906980428 1:50622958-50622980 CACCAAGTGCAAGATAATGAGGG - Intronic
907020171 1:51059479-51059501 CGGCATGGACAACATGTTGATGG + Intergenic
907328799 1:53658115-53658137 CAGCATGTACAACAGCATGGGGG - Intronic
908012814 1:59798678-59798700 CAGCATTCTCAACATGATAAAGG - Intergenic
908057523 1:60305671-60305693 CAAAAAGTTCAACATGATGAAGG + Intergenic
908500743 1:64741710-64741732 TAGAATGTGCTACATGATGAAGG + Intergenic
911168495 1:94746039-94746061 TACCAAGAGCAACATGATGAAGG - Intergenic
911653732 1:100418988-100419010 CAGCCTGGCCAACATGGTGAAGG + Intronic
911708117 1:101038994-101039016 CAGCATGTGCAAAATGGTGATGG - Intergenic
912405904 1:109437308-109437330 CAGCCTGCCCAACATGGTGAGGG - Intergenic
912644354 1:111377867-111377889 CATCATTTGCAACAAAATGAAGG + Intergenic
913025204 1:114831927-114831949 CAGGATGTAAAACAAGATGAAGG + Intergenic
914720618 1:150285779-150285801 CAGCCTGGGCAACATGGTGAAGG + Intronic
915073568 1:153291843-153291865 CAGCATGTCCAAAATGCTGACGG + Intergenic
916082375 1:161242610-161242632 CAGTAAGTGAAAAATGATGAGGG - Intergenic
916667372 1:166978331-166978353 CAACATGTGCAAGGTGATGGAGG - Intronic
917670642 1:177270473-177270495 CAGCATGATGAACAAGATGATGG + Intronic
918010656 1:180583526-180583548 CAGCATGTGCAAAGTCATGGAGG - Intergenic
918790696 1:188823510-188823532 CAGCCTGGGCAATATGGTGAGGG - Intergenic
919099447 1:193076193-193076215 CATGATGTCCAACATGATGTAGG + Intronic
920021509 1:202959884-202959906 CAGCATGTGCAACAGCCTGGAGG - Intergenic
920632984 1:207670217-207670239 AATCAAGTGCATCATGATGATGG - Intronic
921015458 1:211186306-211186328 CAGCCTGGACAACATGGTGAAGG + Intergenic
921085335 1:211785799-211785821 CAGCCTGGCCAACATGGTGAAGG - Intronic
922258192 1:223911563-223911585 CAACAACAGCAACATGATGATGG + Intergenic
924339389 1:243014328-243014350 CAACAACAGCAACATGATGATGG + Intergenic
1063229709 10:4052456-4052478 CAGCATATGTAACATTATGCTGG - Intergenic
1063391496 10:5652646-5652668 CAGCCTGAGCAAATTGATGATGG - Intronic
1063902561 10:10749343-10749365 CAGCATGGGGAACAAGCTGAGGG + Intergenic
1064100141 10:12456582-12456604 CAGCCTGGGCAACATGGTGAGGG + Intronic
1064373124 10:14771709-14771731 CAGCCTGGGCAACATAACGAAGG - Intronic
1064782625 10:18859104-18859126 CAGCGTGTGCCACATGATAAGGG - Intergenic
1065473128 10:26103449-26103471 CAGCGTGAGCAACAAGAAGATGG - Intronic
1066253770 10:33659095-33659117 CACCATGTCCAACTTCATGAAGG + Intergenic
1067092711 10:43277443-43277465 GACCATGTGCAACTTTATGATGG - Intergenic
1067851480 10:49757533-49757555 CTGCAGGTGCAAGATGATGAAGG + Intronic
1067977859 10:51046280-51046302 CTGTATGTGGAACTTGATGATGG + Intronic
1069467903 10:68658331-68658353 CAGCCTGGGCAACATGGTGAAGG - Intronic
1072665289 10:97388345-97388367 CAGCATGTGCAGCGTGGTGGTGG + Exonic
1074895155 10:117770941-117770963 CAGAATGTGCAAAATGCAGAGGG + Intergenic
1075450939 10:122551625-122551647 CAGCATGAGCAACAGGAGGCAGG - Intergenic
1075466549 10:122655737-122655759 CAGCATGGACAACAAGAGGAAGG + Intergenic
1075514118 10:123095751-123095773 CAGCCTGAGCAACATACTGAGGG + Intergenic
1075948116 10:126455108-126455130 CTTCAGGTACAACATGATGAGGG - Intronic
1076729176 10:132429736-132429758 CAGCATGGGCCACAGGAGGAAGG - Intergenic
1078052179 11:7975354-7975376 CAACCTGGGCAACATGGTGAAGG + Intronic
1079963779 11:26955483-26955505 CATCATTTGCAAAATGTTGATGG - Intergenic
1080616112 11:33946401-33946423 CAGCATCTGGTACATAATGAGGG - Intergenic
1082177715 11:49080989-49081011 CAGCCTGGCCAACATGGTGAAGG + Intergenic
1083800315 11:65042734-65042756 CAGCATGGCCAACATGGTGTTGG - Intronic
1085138867 11:74121410-74121432 CAGCCTGGCCAACATGGTGAAGG + Intronic
1085379162 11:76097054-76097076 CCGCAAGTGCAAGATGGTGATGG + Intronic
1085736684 11:79045281-79045303 GGGCATGTGCAACACTATGAAGG + Intronic
1086020711 11:82226353-82226375 CAGCATCTGCGACAGGAAGATGG + Intergenic
1087252403 11:95917766-95917788 CAGCATGTGCAACATGATGAGGG - Intronic
1090292797 11:125560508-125560530 CAGCCTGGCCAACATGGTGATGG - Intergenic
1092786361 12:12030536-12030558 CAGCCTGGGCAACATGGTGAAGG + Intergenic
1093351501 12:18108283-18108305 CAGCTTGAGCAAAATCATGAAGG + Intronic
1093997373 12:25656260-25656282 CAGCTTGGGCAACATGGCGAGGG + Intergenic
1095150908 12:38796064-38796086 CAGCCTGGTCAACATGGTGAAGG + Intronic
1095359512 12:41319468-41319490 CAGTTTGTGCAGAATGATGAGGG - Intronic
1095540037 12:43299090-43299112 CAGCACCTGCCACATGATGAGGG - Intergenic
1096253475 12:50048721-50048743 CAGCCTGACCAACATGGTGAAGG + Intergenic
1096724207 12:53548059-53548081 CAGCCTGGGCAACACAATGAAGG - Intronic
1097851421 12:64414123-64414145 CATCTGGTGCAACATGCTGATGG + Intronic
1097860328 12:64512415-64512437 CAGCCTGAGCAACATGGTGAGGG + Intergenic
1100711662 12:97263770-97263792 AATCATATGCAACATAATGATGG + Intergenic
1100823861 12:98456867-98456889 CAGCGTGAGCAGCAGGATGAAGG + Intergenic
1100976297 12:100125617-100125639 CAGCATGGGCAACAGAGTGAGGG + Intronic
1101107460 12:101454547-101454569 CAGCCTGGTCAACATGGTGAAGG - Intergenic
1101255002 12:102967964-102967986 CAGCAAGAGCAAAATGATGTGGG + Intergenic
1102778862 12:115545913-115545935 CAGCAAGTGGAACTTGGTGAAGG + Intergenic
1103200169 12:119081715-119081737 ATGCAGGTGCAAGATGATGAGGG + Intronic
1104136845 12:125948640-125948662 CAGCCTGGGCAACATACTGAGGG - Intergenic
1104706688 12:130952658-130952680 CAGCCTGAGCAACAGGATAAAGG + Intergenic
1106167955 13:27265743-27265765 CAGCATGCGCAAAATCATGGAGG - Intergenic
1106825825 13:33519382-33519404 CAGCCTGACCAACATGGTGATGG - Intergenic
1108086778 13:46801812-46801834 CAGCATGTGCAAAATCATGATGG - Intergenic
1108635715 13:52332964-52332986 CAGCCTGGGCAACATGACGAAGG + Intergenic
1108652092 13:52490284-52490306 CAGCCTGGGCAACATGACGAAGG - Intergenic
1109359756 13:61280802-61280824 CAGCCTTTGCAAAATTATGATGG - Intergenic
1110078257 13:71277566-71277588 CAGAATGTGTGAGATGATGAGGG + Intergenic
1110188062 13:72698436-72698458 CAGCGTGTGCAACATCTTGGAGG - Intergenic
1112060329 13:95733064-95733086 CAGCATATGCAACATTCTCAAGG - Intronic
1112257802 13:97850665-97850687 CAGCCTGACCAACATGGTGAAGG + Intergenic
1112355581 13:98672247-98672269 CAGCCTGGGCAACATGGTGAGGG + Intergenic
1113223895 13:108138233-108138255 CAGCCTGGCCAACATGGTGACGG - Intergenic
1114403505 14:22432014-22432036 CAGCATGGGCCAAATGAGGATGG - Intergenic
1115955450 14:38773945-38773967 GAGCATGTGATACAGGATGATGG - Intergenic
1116514122 14:45785606-45785628 CAGCATGTGCACTAGGAGGATGG + Intergenic
1118804555 14:69224194-69224216 CAGCCTGGGCAACATGGGGATGG - Intronic
1118878156 14:69802397-69802419 CAGCCTGGGCAACATAGTGAGGG + Intergenic
1119981563 14:79087343-79087365 CAGCATGTTCAAGAGGCTGAAGG - Intronic
1120164821 14:81186393-81186415 CAGCATGTTTAGCATGATGATGG + Intronic
1120169426 14:81234143-81234165 CAGCCTGACCAACATGATGATGG - Intergenic
1120543501 14:85781092-85781114 TATCATGTACAACATGAGGATGG + Intergenic
1120831482 14:89001138-89001160 CAGCATGTGTAAAAGTATGATGG + Intergenic
1122155637 14:99748572-99748594 CAGCCTGTGCAACAAGTTCAAGG + Intronic
1123457695 15:20440886-20440908 CAGCCTGGGCAACATAGTGAGGG - Intergenic
1124376090 15:29129736-29129758 CAGAATGGGCAAAATGAAGATGG - Intronic
1125677290 15:41509228-41509250 CAGCATTTGCATCATGATGCTGG - Intronic
1126004166 15:44240778-44240800 CAGCCTGGGCAACATATTGAGGG - Intergenic
1128506960 15:68279171-68279193 CAGCAGCTGCAGCATCATGAGGG + Intronic
1129065211 15:72897328-72897350 TAGAATGTGCAACATCAAGAAGG - Intergenic
1129979956 15:79859621-79859643 CAGCTTGGCCAACATGGTGAAGG + Intronic
1131203341 15:90420114-90420136 CAGCATGTGACTCATCATGAGGG + Intronic
1132006285 15:98230380-98230402 CAGCATGGGCAGCATGAGGAGGG + Intergenic
1132020719 15:98359655-98359677 CAGCCTATTCAACATGAAGATGG - Intergenic
1133520388 16:6550369-6550391 CAGCCTGGTCAACATGGTGAAGG - Intronic
1135130332 16:19848596-19848618 CAGTATGTGGCACATGAAGAAGG - Intronic
1135340196 16:21638778-21638800 CAGCATGTGCAAAAGCATGAAGG + Intronic
1135639160 16:24105249-24105271 CAGCCTGGCCAACATGGTGAAGG - Intronic
1136517085 16:30774741-30774763 CAGCACCTGCAAGATGAGGAAGG - Exonic
1138985819 16:62327515-62327537 CATCCTGGGCAACATGGTGAAGG - Intergenic
1139850222 16:69947480-69947502 CAGCCTGGGCAACATGGGGAAGG + Intergenic
1139879207 16:70170393-70170415 CAGCCTGGGCAACATGGGGAAGG + Intergenic
1140381941 16:74497082-74497104 CAGCCTGGCCAACATGGTGAAGG + Intronic
1140531733 16:75672677-75672699 CAGCCTGGTCAACATGGTGAAGG - Intronic
1140628290 16:76821314-76821336 CAGCTTGGGCAACATAGTGAAGG - Intergenic
1140863583 16:79040468-79040490 CAGCCTGGGCAACATAGTGAAGG - Intronic
1141282824 16:82644454-82644476 CAGCATTTTCAACATGACAAAGG - Intronic
1141302339 16:82828591-82828613 CAGCCTGGGCAACAGAATGAGGG + Intronic
1142454569 16:90211349-90211371 CAACAACAGCAACATGATGATGG - Intergenic
1143316011 17:6033996-6034018 CAGCAAGTACAACATGAAGGAGG + Intronic
1144389948 17:14784294-14784316 CACCATGGACAACATGTTGATGG + Intergenic
1146615137 17:34350498-34350520 TAGCATGTGCTACCTGATTATGG - Intergenic
1147417006 17:40299348-40299370 CAGCCTGTGCAACAAGGCGATGG - Intronic
1148799472 17:50214273-50214295 CAGCTTGACCAACATGGTGAAGG - Intergenic
1151390739 17:73785220-73785242 CAGCATCTGCAACATGGTAGGGG + Intergenic
1152826220 17:82466885-82466907 CAGCCTGGCCAACATGGTGAAGG - Intronic
1153354575 18:4121310-4121332 CAGGATGGGCAAGAGGATGAAGG + Intronic
1155784862 18:29883723-29883745 CAGGATGTCCAACAAGATGGAGG + Intergenic
1156633244 18:38995633-38995655 CAGCCTACTCAACATGATGAAGG + Intergenic
1157257847 18:46154293-46154315 CAGCCTGGCCAACATGGTGATGG - Intergenic
1157477430 18:48032309-48032331 CAGCCTGACCAACATGGTGAAGG - Intronic
1157861698 18:51147025-51147047 CAGCCTGGGCAACATGGTGAAGG - Intergenic
1158243450 18:55404044-55404066 CATCATGATCAAGATGATGATGG + Intronic
1159106966 18:64013792-64013814 GAGCATGTGCAAAATCCTGATGG + Intergenic
1160421353 18:78748672-78748694 CAGCATGTCACAAATGATGATGG - Intergenic
1161149113 19:2697758-2697780 CAGCCTGGCCAACATGGTGAGGG + Intronic
1161867493 19:6844245-6844267 CAGCCTGGGCAACAAGAAGATGG - Intronic
1164188825 19:22896928-22896950 CAGCCTGAGCAACATGGGGAGGG - Intergenic
1164974956 19:32565916-32565938 CAGCCTGGGCAACATAGTGAGGG + Intergenic
1164990600 19:32679905-32679927 CAGCCTGGGCAACATAGTGAAGG - Intergenic
1165230760 19:34385143-34385165 CAGCCTGGCCAACATGGTGACGG + Intronic
1166578714 19:43871432-43871454 CAGCATGTGCAACACTATTTAGG + Intergenic
1166913320 19:46176785-46176807 CAGCATGGGCAACAGGCTGGGGG - Intergenic
1167084702 19:47301187-47301209 CAGCCTGGCCAACATGGTGAAGG - Intronic
1167727826 19:51230294-51230316 CAGCATGTGCAACATTCCCAAGG - Intronic
1167732653 19:51270121-51270143 CACCATGTGCCAGATAATGAGGG + Intergenic
1167975947 19:53226067-53226089 CAGCCTGACCAACATGGTGAAGG + Intergenic
1168072526 19:53960908-53960930 CTGCATGTGGAAGAAGATGAGGG + Intergenic
1168592358 19:57647833-57647855 TACCATGGCCAACATGATGACGG + Intergenic
1168669621 19:58230704-58230726 CAGGATGGGCAAGATGAGGAGGG + Intronic
926402636 2:12513762-12513784 CAGCCTGTGTAACCTCATGAGGG + Intergenic
927711631 2:25329810-25329832 CAGCGTGTGCAGCATGAGGGGGG - Intronic
928572356 2:32622352-32622374 CAGCTAGTGCAACCTGAAGAGGG - Intergenic
928854268 2:35785311-35785333 CTGCATGTTCAAAATGATAAAGG - Intergenic
930887901 2:56349123-56349145 CAGGTTGTGCAACATAATTAGGG - Intronic
931648720 2:64449709-64449731 CAGTATCTGCATCATGAAGAGGG - Intergenic
932134339 2:69215085-69215107 CAGCCTGTGCAGCAGGATGGAGG - Intronic
932251217 2:70245950-70245972 CAGCCTGTGCAACAGGAGGGAGG - Intronic
936525791 2:113240918-113240940 CAGCATGTGGGACATGCAGAAGG + Intronic
938988620 2:136605028-136605050 CAGCCTGGGCAACATAGTGAGGG - Intergenic
939923067 2:148140964-148140986 CAGCCTGGGCAACATGATGATGG - Intronic
941442512 2:165555805-165555827 GAGCATGTGCAATTTCATGAAGG + Intronic
942294220 2:174501944-174501966 CATCATGTCCACCATGATTATGG - Intergenic
944099228 2:196004753-196004775 CAGCCTGGACAACATGGTGAGGG + Intronic
945050045 2:205815156-205815178 CAACCGGTGCAACATGATGCAGG + Intergenic
946279587 2:218657181-218657203 CAGCAGGAGCCAGATGATGAAGG - Intronic
947624310 2:231610288-231610310 CAGCCTGGCCAACATGGTGAAGG - Intergenic
949086028 2:242156003-242156025 CAACAACAGCAACATGATGATGG - Intergenic
1169937550 20:10900570-10900592 AAGCAGGTGCTACATGACGAAGG + Intergenic
1170412631 20:16107573-16107595 CAGCATGTGGAAAAGGAAGAAGG + Intergenic
1170879691 20:20285721-20285743 CAGCCTGGGCAACATGGTGAAGG + Intronic
1171345496 20:24462828-24462850 CAGCATGTGAAACTGGAGGAAGG - Intergenic
1171373088 20:24674228-24674250 CAGCATTTGCAAAGTGTTGATGG - Intergenic
1174919461 20:54686193-54686215 CACTATGTGCCACATGCTGAGGG + Intergenic
1176060221 20:63169265-63169287 CAGGAGGTGCCACATGGTGAGGG - Intergenic
1176225589 20:63996730-63996752 CAGCCTGGGCAACATGGTGATGG + Intronic
1177235316 21:18382415-18382437 CAGCAGCTGCAACATGTTGCAGG + Intronic
1184011831 22:41754626-41754648 CAGCATGGCCAACATGGTGAAGG - Intronic
950221945 3:11202797-11202819 CAGAAAGTGCAACATCAAGAGGG - Intronic
951209681 3:19961599-19961621 TAGCGTGTGACACATGATGATGG - Intronic
952258432 3:31715399-31715421 CAGCATTGGCACCATGATGCTGG + Intronic
952385108 3:32835221-32835243 TTGCATGTGTAACATGATGGGGG + Intronic
954326733 3:49868144-49868166 AAGCAGGTCCAACATGTTGAAGG + Intronic
955295210 3:57728687-57728709 CAGCCTGGCCAACATGGTGAAGG + Intergenic
955306654 3:57839751-57839773 CAGCCTGCTCAACATGATGGTGG - Intronic
961829551 3:129616444-129616466 CTGCATGGGCAACAGGCTGATGG + Intergenic
963049579 3:141129482-141129504 AAGCAGGTGCAACAGGATGGTGG - Intronic
963064513 3:141252914-141252936 CAGCAGGGGCAACATATTGAAGG - Intronic
963383277 3:144558478-144558500 CAGCATTTGAAACATAAGGAAGG - Intergenic
963703741 3:148659513-148659535 CAGCATGTGCAAACACATGAAGG - Intergenic
964075239 3:152684742-152684764 CACCATGGACAACATGTTGATGG - Intergenic
964178207 3:153851655-153851677 CAGAATCTGCAACATGGTGGAGG + Intergenic
964671761 3:159233869-159233891 CATCATGTGTAAGATGATGATGG - Intronic
965150949 3:164974227-164974249 GAGCATGTGCATCATGTTTAGGG + Intergenic
966364454 3:179168866-179168888 CAGAATGTGTTACATGATAAAGG - Intronic
967844989 3:194036040-194036062 CAGCATGAGGAAGCTGATGAGGG + Intergenic
968323111 3:197788899-197788921 CAGCCTGAGCAACATAGTGAGGG - Intergenic
968677535 4:1892178-1892200 CAGACTGGGCAACATGGTGATGG - Intronic
969291188 4:6241195-6241217 CAGCATCAGCACCATGCTGAGGG - Intergenic
970482578 4:16492409-16492431 CAGCCTGGGCAACATAAGGAAGG - Intergenic
970606166 4:17683879-17683901 CAGCCTGGACAGCATGATGAAGG + Intronic
971140472 4:23919937-23919959 CAGCATATTCAACAAGATAATGG + Intergenic
971968142 4:33589895-33589917 CAGCATGAACAACAGCATGAAGG + Intergenic
972527074 4:39924613-39924635 GAACATGTGAAACATGAGGAGGG + Intronic
972647081 4:40979327-40979349 GAGCATGTGCATCAGGATGCAGG - Intronic
973098346 4:46229780-46229802 CAGCCTGGGCAAGATGGTGAGGG - Intergenic
974538380 4:63199046-63199068 CAGCCTGGCCAACATGGTGAAGG - Intergenic
974734192 4:65908118-65908140 CAACATATGCAACATAGTGATGG - Intergenic
975471351 4:74772689-74772711 CCGCATCTGCAACCTGAGGATGG + Intronic
976319652 4:83699336-83699358 CATTATGTGCTGCATGATGAAGG - Intergenic
976502138 4:85803496-85803518 CAAAATGAGCATCATGATGAAGG - Intronic
978410506 4:108419566-108419588 CTGCTTGTGCACCAGGATGATGG + Intergenic
979237736 4:118420902-118420924 CAACAACAGCAACATGATGATGG - Intergenic
979529388 4:121752829-121752851 CAGCTTATCCACCATGATGAAGG + Intergenic
981258192 4:142688372-142688394 TAACATGTGCAGAATGATGAAGG - Intronic
984080591 4:175245154-175245176 CAGGATGTGCAAAAGCATGACGG + Intergenic
985096490 4:186417359-186417381 GAGCATGGGCAGCATGATGTCGG - Intergenic
985096497 4:186417397-186417419 GAGCATGGGCAGCATGATGTCGG - Intergenic
986118501 5:4805150-4805172 CAGCTTGTGCTAAATGATAATGG + Intergenic
986519787 5:8602457-8602479 CAGGATGAGCAACATCATGGAGG + Intergenic
986545365 5:8891342-8891364 CCACATGTTCAAGATGATGAAGG + Intergenic
986564449 5:9097757-9097779 CAGCCTGTACAACAAGGTGATGG + Intronic
988296022 5:29363363-29363385 CAGCTTATGCAACATGAAAATGG - Intergenic
989700052 5:44252984-44253006 CAGCATGTGTATCTTGATGGTGG - Intergenic
990963666 5:61421413-61421435 TATCATGTGCAACAACATGAAGG - Intronic
991303379 5:65150405-65150427 CAGGATGTGAAACTTGAAGATGG + Exonic
994659364 5:102635212-102635234 CAGCCTGGGCAGCATGGTGAAGG + Intergenic
994860011 5:105180012-105180034 CAGCATGAGCAAAATAAAGATGG - Intergenic
994939340 5:106301461-106301483 CAAGATGTGCAAAATGATGATGG - Intergenic
995177028 5:109190208-109190230 CAGAATGTGCAAGTTGATGTAGG + Exonic
995918759 5:117284669-117284691 CAGCATCAGCAACATTCTGAAGG - Intergenic
995994118 5:118279014-118279036 CAGGATCTGAAACATGATGGAGG - Intergenic
996381414 5:122865991-122866013 CATCATATGCTACATGATAAGGG + Intronic
996711640 5:126548863-126548885 CAGCCTGGGCAACATAGTGAGGG + Intronic
996886017 5:128354360-128354382 CAGCAGGAGCAAGATCATGAGGG + Intronic
1001427603 5:171633937-171633959 CAGCATCTGAAACAGGAGGATGG - Intergenic
1001602293 5:172936801-172936823 CAGCCTGGGCAACATTGTGAAGG + Intronic
1002738164 5:181412867-181412889 CAACAACAGCAACATGATGATGG - Intergenic
1006498779 6:34443814-34443836 CAGCCTGTACAACATAGTGAGGG + Intergenic
1006753896 6:36397803-36397825 CAGCCTGGGCAACATAGTGAGGG + Intronic
1007227792 6:40327165-40327187 CAGGAAGTGAAACTTGATGAAGG + Intergenic
1007305499 6:40900859-40900881 CAGCACGAGCAACAGCATGAAGG + Intergenic
1010649789 6:78439777-78439799 CAGCATGTGAGAAATCATGAAGG - Intergenic
1013071137 6:106730371-106730393 CAGCCTGTGCAACAGAGTGAGGG + Intergenic
1013096023 6:106945481-106945503 CAGCCTGGCCAACATGGTGAAGG + Intergenic
1014047163 6:116903275-116903297 CAATATGTGCAACATCAAGAAGG - Intronic
1015964556 6:138684800-138684822 CGGCATGTGGAACAAGATGGCGG + Intronic
1015993167 6:138969665-138969687 CTGCATGTGCAACATGAGCTGGG - Intronic
1017151018 6:151280673-151280695 CAGCCTGGGCAACAAGAGGAAGG - Intronic
1019243263 6:170688426-170688448 CAACAACAGCAACATGATGATGG - Intergenic
1019885363 7:3899713-3899735 CAGCATGGCCCACATGCTGATGG - Intronic
1020151043 7:5681865-5681887 AAGCAAGTTCAACATGAAGACGG + Intronic
1020389140 7:7640404-7640426 CATCATGTCCACCATGATTATGG + Exonic
1020519012 7:9163145-9163167 CAGCATGTGGAACATTCTCAAGG - Intergenic
1021654030 7:22857295-22857317 GACCATGTGAACCATGATGAAGG - Intergenic
1022098950 7:27157841-27157863 CAGCTGGTGCAACATGGTGCAGG - Intronic
1023107697 7:36778896-36778918 CAGCATGTGCATAAACATGAAGG + Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1024137742 7:46428269-46428291 CAGAGTGTGCACTATGATGATGG + Intergenic
1025029186 7:55542593-55542615 CAGCCTGGCCAACATGGTGAAGG + Intronic
1025779635 7:64588953-64588975 GAGTATGTGCCACATGGTGATGG + Intergenic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1026465437 7:70649722-70649744 CAGCCTGGCCAACATGGTGAAGG - Intronic
1026993222 7:74599715-74599737 CAGCCTGGGCAACATGGTGAAGG - Intronic
1028921953 7:96319351-96319373 CAGCCTGGCCAACATGATGTTGG + Intronic
1029311302 7:99667478-99667500 CAGCATGGGCAACTTGAAAAAGG + Intronic
1029889102 7:103907387-103907409 CAGCCTGGGCAACAAGATCAAGG + Intronic
1032198094 7:129800815-129800837 CAGCATCTGCAGCATGAGGCAGG + Intergenic
1034863506 7:154620707-154620729 AAGCATGTGCTACTTGCTGACGG - Intronic
1035504858 8:119737-119759 CAACAACAGCAACATGATGATGG + Intergenic
1036404523 8:8442773-8442795 CAGCCTGGGCAACATAGTGAGGG + Intergenic
1036806118 8:11835093-11835115 CAGCCTGGGCAACAGGGTGAAGG + Intronic
1037034438 8:14147768-14147790 CAGCATGTGGATCATTATCAGGG + Intronic
1037104592 8:15091213-15091235 CAGCCTGGGCAACATAATGAGGG - Intronic
1037283936 8:17275553-17275575 CAGCAGGTGTCACATTATGATGG + Intronic
1038523783 8:28256322-28256344 CAGCCTGGGCAACAGAATGAGGG + Intergenic
1039246551 8:35615013-35615035 CAGCCTGGGCAACATAGTGAGGG + Intronic
1041101207 8:54397890-54397912 CAGCACGTGCAACAGAAAGAGGG - Intergenic
1041884460 8:62792496-62792518 CAGCATGTTCAACATTATTTGGG + Intronic
1043106818 8:76124313-76124335 CAGCATATGCAACATCATGAAGG + Intergenic
1044687911 8:94845489-94845511 CAGCCTGGGCAACAGAATGAGGG - Intronic
1048176178 8:132154608-132154630 CAGCCTGTGCAATGGGATGATGG + Intronic
1048590229 8:135814497-135814519 CTGCATCTGTAAAATGATGATGG - Intergenic
1048748649 8:137645537-137645559 CAGCGAGAGCAACATGTTGACGG - Intergenic
1048797249 8:138162404-138162426 TAGAATGTGCAACATAAAGAAGG + Intronic
1051656362 9:19385680-19385702 CAGCCTGGCCAACATGGTGAAGG - Intergenic
1055492046 9:76815244-76815266 CAGAATGTGTAACTTCATGATGG + Intronic
1055999132 9:82195077-82195099 CAGGACGTGCAACATGGTTATGG - Intergenic
1059237712 9:112776532-112776554 CAGCATGTGCATCACCAAGAAGG - Intronic
1059529423 9:115022310-115022332 CAGCATGTGCACCAAGCTGTTGG - Intronic
1060084898 9:120689281-120689303 CAGCATGTGTAACAACATCAAGG + Intronic
1060254317 9:122013792-122013814 CAGCATTAGCAAGATGATGATGG + Intronic
1060558434 9:124522476-124522498 AAGCATGTGCATCATGTTGAAGG + Exonic
1203603452 Un_KI270748v1:37650-37672 CAACAACAGCAACATGATGATGG - Intergenic
1186843191 X:13505681-13505703 CTGCATGTGCAACATTATGACGG + Intergenic
1187942425 X:24394924-24394946 CAGCCTGGGCAACATGGTCAGGG - Intergenic
1188689161 X:33107680-33107702 CAGAATGTGTAATATGTTGAAGG + Intronic
1189153006 X:38726718-38726740 CAGGATGTGAAACAAGATGGAGG - Intergenic
1189634754 X:42994825-42994847 CAGCTTGTACAACATAGTGAGGG + Intergenic
1191093087 X:56644980-56645002 CAGTATGTGCCATGTGATGATGG + Intergenic
1191716545 X:64197524-64197546 CAGCATGGCCAACTTGAAGAGGG + Intronic
1193970125 X:88040002-88040024 TAGCATGTGTAGCATGAAGATGG - Intergenic
1194718809 X:97316689-97316711 CAGCATAAGCAATTTGATGATGG + Intronic
1195415538 X:104616263-104616285 CTGCCTTTGCAACATTATGATGG + Intronic
1197061882 X:122190840-122190862 CAGAATGTAAAACAAGATGAAGG - Intergenic
1197426439 X:126302741-126302763 TAGCATGTGCAAAAGCATGACGG + Intergenic
1197690936 X:129500564-129500586 CATCATGTGCCACTTAATGATGG + Intronic
1198303161 X:135350930-135350952 CAACATGTGCAACGTTCTGAAGG + Intronic
1202385516 Y:24322704-24322726 CAACAACAGCAACATGATGATGG - Intergenic
1202485270 Y:25347424-25347446 CAACAACAGCAACATGATGATGG + Intergenic