ID: 1087252974

View in Genome Browser
Species Human (GRCh38)
Location 11:95924113-95924135
Sequence GCCTGTAGGCTGCTGGGCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 465}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087252965_1087252974 1 Left 1087252965 11:95924089-95924111 CCATGTTCCCCCAGAGTGCACCG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1087252974 11:95924113-95924135 GCCTGTAGGCTGCTGGGCAGCGG 0: 1
1: 0
2: 3
3: 39
4: 465
1087252961_1087252974 24 Left 1087252961 11:95924066-95924088 CCCGGGAGGGAGACCGGAAGCGG 0: 1
1: 1
2: 0
3: 14
4: 231
Right 1087252974 11:95924113-95924135 GCCTGTAGGCTGCTGGGCAGCGG 0: 1
1: 0
2: 3
3: 39
4: 465
1087252967_1087252974 -7 Left 1087252967 11:95924097-95924119 CCCCAGAGTGCACCGCGCCTGTA 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1087252974 11:95924113-95924135 GCCTGTAGGCTGCTGGGCAGCGG 0: 1
1: 0
2: 3
3: 39
4: 465
1087252966_1087252974 -6 Left 1087252966 11:95924096-95924118 CCCCCAGAGTGCACCGCGCCTGT 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1087252974 11:95924113-95924135 GCCTGTAGGCTGCTGGGCAGCGG 0: 1
1: 0
2: 3
3: 39
4: 465
1087252964_1087252974 11 Left 1087252964 11:95924079-95924101 CCGGAAGCGGCCATGTTCCCCCA 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1087252974 11:95924113-95924135 GCCTGTAGGCTGCTGGGCAGCGG 0: 1
1: 0
2: 3
3: 39
4: 465
1087252963_1087252974 23 Left 1087252963 11:95924067-95924089 CCGGGAGGGAGACCGGAAGCGGC 0: 1
1: 1
2: 0
3: 19
4: 160
Right 1087252974 11:95924113-95924135 GCCTGTAGGCTGCTGGGCAGCGG 0: 1
1: 0
2: 3
3: 39
4: 465
1087252969_1087252974 -9 Left 1087252969 11:95924099-95924121 CCAGAGTGCACCGCGCCTGTAGG 0: 1
1: 0
2: 0
3: 4
4: 27
Right 1087252974 11:95924113-95924135 GCCTGTAGGCTGCTGGGCAGCGG 0: 1
1: 0
2: 3
3: 39
4: 465
1087252968_1087252974 -8 Left 1087252968 11:95924098-95924120 CCCAGAGTGCACCGCGCCTGTAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1087252974 11:95924113-95924135 GCCTGTAGGCTGCTGGGCAGCGG 0: 1
1: 0
2: 3
3: 39
4: 465
1087252960_1087252974 28 Left 1087252960 11:95924062-95924084 CCGGCCCGGGAGGGAGACCGGAA 0: 1
1: 1
2: 0
3: 13
4: 156
Right 1087252974 11:95924113-95924135 GCCTGTAGGCTGCTGGGCAGCGG 0: 1
1: 0
2: 3
3: 39
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087252974 Original CRISPR GCCTGTAGGCTGCTGGGCAG CGG Exonic
900297678 1:1960149-1960171 GGGTGAAGGCGGCTGGGCAGGGG - Intronic
900375724 1:2353749-2353771 GACAGCAGGGTGCTGGGCAGAGG - Intronic
900589165 1:3452135-3452157 GCCCGTAGGCAGCTGGGAAAGGG - Intergenic
901003698 1:6161434-6161456 GCAGGGAGGCTGGTGGGCAGGGG - Intronic
901813136 1:11778969-11778991 TTCTGTGGGCAGCTGGGCAGCGG + Exonic
901831523 1:11895197-11895219 GCCTTCAGTGTGCTGGGCAGAGG - Intergenic
901844759 1:11974853-11974875 TCCCAGAGGCTGCTGGGCAGTGG - Exonic
902259706 1:15215380-15215402 GCCTGTCGGGTGCTGGACATGGG - Exonic
902516515 1:16992449-16992471 GCCTGTTGGGTGCAGGGCAGAGG - Intronic
902812566 1:18896944-18896966 GCCTGATGTTTGCTGGGCAGTGG - Intronic
902837538 1:19056890-19056912 GCCCGTAGGCTGGAGTGCAGTGG - Intergenic
903168636 1:21538516-21538538 ACTTGTAGCTTGCTGGGCAGCGG - Intronic
903291378 1:22316289-22316311 TCCTGCAGGATGCTGGACAGTGG + Intergenic
904887931 1:33755682-33755704 GTCTCTAGGCTGCAGTGCAGTGG + Intronic
905321615 1:37121217-37121239 GCCTCCAGGCTGGAGGGCAGTGG - Intergenic
905366683 1:37455399-37455421 CCCTGCAGGCGGCTGGGCAGAGG - Intergenic
905873079 1:41416106-41416128 GCCTGTAGGATGCCCAGCAGGGG + Intergenic
906433181 1:45772737-45772759 ACGTGGAGGCTCCTGGGCAGTGG + Intergenic
906522340 1:46474915-46474937 GCCTGGGGGCTGCTGGGGTGGGG + Intergenic
907328086 1:53653844-53653866 GCCTGTAGGGTGGGGGCCAGAGG - Intronic
907401799 1:54229002-54229024 CCCTCTAAGCTGCAGGGCAGAGG + Intronic
910751151 1:90632571-90632593 TCCTGGAGGCTGGAGGGCAGTGG - Intergenic
912696212 1:111844006-111844028 GCCTGTACGCAGCAGAGCAGGGG + Intronic
915221721 1:154380021-154380043 GACAGTTGGCGGCTGGGCAGAGG + Intergenic
915221731 1:154380060-154380082 GACTGTGGGGAGCTGGGCAGAGG + Intergenic
915520394 1:156439167-156439189 GCCTGGAGGCGCCTGGGCTGTGG + Intergenic
915636124 1:157188130-157188152 GGGTGTAGGCTCCTGGGCATGGG - Intergenic
915652860 1:157331735-157331757 GCCTGGAAGCCCCTGGGCAGGGG + Intergenic
915992718 1:160532573-160532595 GACAATAGGCAGCTGGGCAGAGG - Intergenic
917925546 1:179786505-179786527 CCCTCTTCGCTGCTGGGCAGAGG - Intronic
918332129 1:183471467-183471489 GCCTGGAGGCTGGCGGGCGGCGG - Intergenic
920098960 1:203504907-203504929 GCCTTTTGGATCCTGGGCAGGGG + Intronic
920178354 1:204117247-204117269 GCCTGGAGGGTGCTGGGGACAGG + Intronic
920249977 1:204617095-204617117 GCCTGGAGGGTGATGGGCATGGG - Intergenic
921603508 1:217132651-217132673 GCCTGTATGCAGATGGGCACAGG + Intronic
922566313 1:226604050-226604072 GGCTGTGGGCTGGTGGGCATGGG - Exonic
922712888 1:227846252-227846274 GTCTGGAGGCAGCTGGGCTGGGG - Exonic
922858135 1:228792679-228792701 GCTTGCAAGTTGCTGGGCAGGGG + Intergenic
923144258 1:231186846-231186868 GCCTCTGGGGTGCTGGGCTGGGG - Intronic
1062922587 10:1291393-1291415 GCCTGCAGGATGCTCAGCAGCGG - Intronic
1065974884 10:30833550-30833572 GCTTGCAGGCTGCTGGGGGGAGG + Intronic
1066048899 10:31617848-31617870 GGCTCTGGGGTGCTGGGCAGGGG + Intergenic
1066463954 10:35637562-35637584 GCCTGCAGGCAGCTAGGCATGGG - Intergenic
1066466326 10:35653566-35653588 GCCAGGAGACTGCTGGGAAGAGG - Intergenic
1067471625 10:46542163-46542185 GGCAGAAGGCTGCAGGGCAGGGG + Intergenic
1068615209 10:59106877-59106899 GGTTGTAGGCTGCTGGACTGGGG - Intergenic
1069456444 10:68557843-68557865 GGCTGTAGGCTGGAGTGCAGTGG + Intergenic
1069544877 10:69320672-69320694 GACAGTGGGCTGCTGGGCTGGGG + Intronic
1069865875 10:71502545-71502567 GCCTCTTGCCTGCTGTGCAGAGG + Intronic
1069921459 10:71818164-71818186 GCCCTAGGGCTGCTGGGCAGGGG + Intronic
1070806130 10:79271809-79271831 GCCTGGAGCCTGCTGGGCAGAGG + Intronic
1071528205 10:86370428-86370450 GTCTGTAGGCATCTGGGAAGGGG + Intergenic
1071529439 10:86377513-86377535 GCCTGCACGCTGATGGGCGGTGG + Intergenic
1071781787 10:88854462-88854484 GACAGTTGGCTGCTGGTCAGTGG - Intergenic
1071831672 10:89378362-89378384 GCTTGTTGGTTGCAGGGCAGCGG + Intronic
1072329342 10:94331378-94331400 GCCTGTGGGTCTCTGGGCAGAGG - Exonic
1072923848 10:99598925-99598947 GGCTGGAGGCGGCTGGGCAGTGG + Intergenic
1074327593 10:112467549-112467571 GCCTGCAGCCTGCTGGCCATGGG + Intronic
1074548006 10:114416846-114416868 GCCTGTAGGGTGATGGCCATTGG - Intergenic
1075454514 10:122576530-122576552 GTCTGTAGGCAGCTGGGTTGTGG + Exonic
1075455067 10:122579709-122579731 GTCTGCAGGCAGCTGGGCTGTGG + Exonic
1075456131 10:122586191-122586213 GTCTGCAGGCAGCTGGGCTGTGG + Exonic
1075456622 10:122589075-122589097 GTCTGCAGGCAGCTGGGCTGTGG + Exonic
1075457182 10:122592403-122592425 GTCTGCAGGCAGCTGGGCTGTGG + Exonic
1075461302 10:122618148-122618170 GTCTGCAGGCAGCTGGGCTGTGG + Exonic
1075461767 10:122621188-122621210 GTCTGCAGGCAGCTGGGCTGTGG + Exonic
1075462251 10:122624656-122624678 GTCTGCAGGCAGCTGGGCCGTGG + Intronic
1075483085 10:122798927-122798949 GTCTGCAGGCAGCTGGGCTGTGG + Intergenic
1076433174 10:130421903-130421925 GTCTGGAGCCTGGTGGGCAGTGG + Intergenic
1076697891 10:132255911-132255933 GGCTGCAGGCTGCTGGTCATGGG - Intronic
1076724035 10:132405098-132405120 GCCCGCAGGAGGCTGGGCAGCGG + Exonic
1076922227 10:133459978-133460000 GTCTGCAGGCAGCTGGGCTGTGG + Intergenic
1077015881 11:398986-399008 GCCTGAAGGCTGCGGGCCTGCGG - Exonic
1077192006 11:1259504-1259526 ACCTGCAGGCTGCTGGGGACAGG + Intronic
1077237175 11:1487329-1487351 GCCTGGACGGTGCTGGGCTGAGG + Intronic
1077337978 11:2013917-2013939 GCCTGTGGGCTGATGGGGATGGG + Intergenic
1078726952 11:13940338-13940360 ACCTCCAGGCTGCTGGGAAGGGG - Intergenic
1081145955 11:39562811-39562833 GCTTGTTGCCTTCTGGGCAGGGG - Intergenic
1081834861 11:46144937-46144959 GCCTGTTGCATGCTGGGCACAGG + Intergenic
1081870601 11:46381195-46381217 CCCTGCTGGCTGCTGGGGAGGGG - Intronic
1082992353 11:59218356-59218378 GCCTGAAGGCAGATGGGCAGTGG - Intergenic
1083935077 11:65865797-65865819 GCCAGGAGGCTGGGGGGCAGGGG - Exonic
1084096126 11:66912796-66912818 GGCTGGGGGCAGCTGGGCAGAGG - Intronic
1085450089 11:76626647-76626669 GCCTGTGGACAGCTGTGCAGTGG - Intergenic
1085507715 11:77069649-77069671 CCCAGGAGGCTGCTGGGGAGGGG - Intronic
1087252974 11:95924113-95924135 GCCTGTAGGCTGCTGGGCAGCGG + Exonic
1088364083 11:109020591-109020613 ACCTCAAGGCTGCTGGTCAGTGG - Intergenic
1089097023 11:115927646-115927668 GGCTGGAGGCTGCATGGCAGTGG + Intergenic
1089313204 11:117573626-117573648 GACAGGAGGCTGCAGGGCAGAGG - Intronic
1089966355 11:122656956-122656978 CCCTGGAGCCTGCTGGGGAGAGG + Intronic
1090334009 11:125950847-125950869 GCCTGGGGGCTGCAGGGCACTGG + Intergenic
1090478645 11:127047981-127048003 GCCTGTTGGCACCTGGGCACGGG + Intergenic
1091078759 11:132645983-132646005 GAATGCAGGATGCTGGGCAGCGG + Intronic
1091295946 11:134474131-134474153 GCCTGGACTCTGCTGGGCAGTGG + Intergenic
1202820962 11_KI270721v1_random:69099-69121 GCCTGTGGGCTGATGGGGATGGG + Intergenic
1091388719 12:112052-112074 GCCTGTTCATTGCTGGGCAGGGG + Intronic
1091459148 12:630824-630846 GCCGGAAGCCTGCTGGGGAGGGG - Intronic
1092065285 12:5585074-5585096 TGCTGTAGAGTGCTGGGCAGAGG + Intronic
1092106718 12:5926531-5926553 GCATGTAGGATGCTGGGCTGGGG - Intronic
1092165730 12:6341338-6341360 GCCTGGAGGGTGTTGGGCCGTGG - Intronic
1094221621 12:28000050-28000072 GCCTGCATGCAGCTGGTCAGAGG - Intergenic
1094319695 12:29171517-29171539 GACAGTGGGCAGCTGGGCAGAGG - Intronic
1094319745 12:29171753-29171775 GACAGTGGGCAGCTGGGCAGAGG - Intronic
1094488296 12:30942058-30942080 GCCGGTGGGCTGAGGGGCAGGGG + Intronic
1094813931 12:34166081-34166103 CCCTGTAGGCAGCTGAGCTGGGG - Intergenic
1096233273 12:49909451-49909473 TCCTGTAGGCAGTTGGCCAGAGG + Intergenic
1096542790 12:52317606-52317628 GCCTGTGGGTGTCTGGGCAGAGG + Intronic
1096840504 12:54376873-54376895 GCCTCTAGGCAGCTAGGGAGAGG + Intronic
1097943750 12:65343429-65343451 GCCTCTAGGCTTCTGGGAATAGG - Intronic
1098138387 12:67427180-67427202 TCCTCCAGCCTGCTGGGCAGAGG - Intergenic
1101864233 12:108508282-108508304 GTCTGGGGGCTGCTGGGCAGAGG - Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1102492169 12:113296024-113296046 GCCTGGGGGCTGCTGGGCGGCGG - Exonic
1104301343 12:127567875-127567897 ACCACTAGGCTGCTGGACAGAGG + Intergenic
1104312254 12:127663917-127663939 GCCTGGAGGATGCCAGGCAGAGG - Intergenic
1104427305 12:128688166-128688188 TCCTGTGGGCAGGTGGGCAGGGG - Intronic
1106289139 13:28344312-28344334 GCATTTAGGAGGCTGGGCAGGGG - Intronic
1108662537 13:52600073-52600095 GACAGTGGGCGGCTGGGCAGGGG - Intergenic
1109266382 13:60205551-60205573 GACAGTGGGCAGCTGGGCAGAGG - Intergenic
1109266389 13:60205590-60205612 GACAGTGGGCAGCTGGGCAGAGG - Intergenic
1112007724 13:95268421-95268443 CCCTTTAGGGTGTTGGGCAGGGG - Intronic
1112476584 13:99736771-99736793 GCCTGAAGCCTGGTGGGGAGGGG - Intronic
1116916825 14:50532878-50532900 GCCTGTAGGGTGACGGGTAGAGG + Intronic
1117296207 14:54381729-54381751 GCATCTAGGCTGGAGGGCAGTGG - Intergenic
1117728427 14:58696717-58696739 GGCTGCAGGCTGGTGGCCAGAGG + Intergenic
1118017730 14:61676765-61676787 CTCTGTAGGCTACTGGGCTGTGG - Intergenic
1118755944 14:68843757-68843779 GCCTGTGGGCTTCTGGGCTTAGG - Intergenic
1119173496 14:72552377-72552399 GCCTGTAAGGTGCTGGGAGGTGG + Intronic
1119434829 14:74591471-74591493 CCATGTAGGATGCTGTGCAGAGG + Intronic
1120284198 14:82476898-82476920 GGCTGGAGGCTGCAGTGCAGTGG + Intergenic
1120945198 14:89988180-89988202 ACCTGCGGGCTGCTGGACAGTGG - Intronic
1121252707 14:92511733-92511755 ACCTGTAGGAATCTGGGCAGAGG + Intergenic
1122117426 14:99534897-99534919 GCCTGTATGGTGGTGGGGAGTGG + Intronic
1122329831 14:100904676-100904698 GGCTGGGGGCTGCTGGGCGGGGG + Intergenic
1122603560 14:102932953-102932975 CCCTGTGGCCTGCTGGGCTGAGG - Exonic
1122754710 14:103969306-103969328 GCCAGTGGGTTGCGGGGCAGAGG + Intronic
1122811522 14:104291729-104291751 GCCTGGAGGGTGCTGGGCCAAGG - Intergenic
1122863018 14:104591079-104591101 GCCTGCAGTGTGCTGGGCAGGGG - Intronic
1122924949 14:104895168-104895190 GCCTGTAGGGGGCGAGGCAGGGG - Exonic
1122943716 14:104995315-104995337 TCCTTGAGGCTGCTGGGCAGGGG - Exonic
1123048111 14:105528147-105528169 GCGTGGGGGCTGCCGGGCAGGGG + Intronic
1123219036 14:106839728-106839750 GCCTGTAGGCTGCAGAGCTCAGG - Intergenic
1124363134 15:29053566-29053588 GCCGGTAGGTTCCTGGGGAGAGG + Intronic
1125381633 15:39092570-39092592 GCCTGAGGGCAGCTTGGCAGTGG - Intergenic
1125507642 15:40276228-40276250 CCCAGTAGGCTGAAGGGCAGAGG - Exonic
1125698843 15:41661799-41661821 GCGTGACGGCTGCTGGGAAGGGG + Intronic
1126494586 15:49277011-49277033 GCCTGCAGGCTGGAGTGCAGTGG + Intronic
1127588164 15:60397700-60397722 GCCGGGAGGGTGCAGGGCAGAGG - Intronic
1127689361 15:61379571-61379593 GCGTCTAGGCTGGAGGGCAGTGG + Intergenic
1128233067 15:66048845-66048867 GCCTGTGGAGTGCTGAGCAGAGG - Intronic
1128334461 15:66777284-66777306 GCAGGTAGGCTGCTGGGCTCAGG - Intronic
1128984006 15:72206256-72206278 GTCTGCAGGATGCGGGGCAGAGG + Intronic
1129504023 15:76065969-76065991 GCTTGGTGGCTCCTGGGCAGGGG - Intronic
1129638777 15:77352162-77352184 GGCTGGAGGCTGCAGTGCAGTGG - Intronic
1129709180 15:77811542-77811564 GCCTGCGGCTTGCTGGGCAGGGG + Intronic
1130093367 15:80839167-80839189 GCTTTCAGGCCGCTGGGCAGGGG - Intronic
1130693923 15:86111097-86111119 GCCTGGAGGCAGCTGGGCTCAGG + Intergenic
1131151442 15:90049745-90049767 GCCTGTTGGCTGCAGGGTAGAGG - Intronic
1131173155 15:90192381-90192403 GCCTGCATGCAGCTGGGCAGAGG + Intronic
1132584926 16:701953-701975 GCCTGGGAGCTGCTGGGGAGAGG + Intronic
1132715420 16:1287790-1287812 GCCTGTTGGGAGGTGGGCAGGGG + Intergenic
1132727807 16:1346281-1346303 GCCTGTGTGCAGCTGAGCAGAGG - Exonic
1132830772 16:1926987-1927009 GCCAGGAGGCGGCTGGGGAGGGG - Intergenic
1132891664 16:2207780-2207802 GCCCGTAGGCTGCTGTGGCGTGG + Intronic
1134207161 16:12247707-12247729 GTCTGGAGGCCGCTGGGAAGTGG - Intronic
1135247418 16:20869000-20869022 GTCTGGAGGCTGATGTGCAGAGG - Intronic
1135498710 16:22975258-22975280 GAGTGGAGGCTGCTGGCCAGAGG - Intergenic
1135683899 16:24482293-24482315 GCCTCCAGGCTGCAGTGCAGTGG + Intergenic
1135691258 16:24539695-24539717 GCCCGCAAGCTGCTGGGCAGCGG - Intronic
1135904847 16:26502162-26502184 GCCAGTAGGCCTCTGGGCACAGG + Intergenic
1136372997 16:29847840-29847862 GCCTTTGGGCTGCTGGGGATGGG + Exonic
1136412048 16:30083275-30083297 GCCAGGAGTGTGCTGGGCAGTGG + Intronic
1136996569 16:35194918-35194940 GCCTGTAGCCTGCCTGCCAGTGG - Intergenic
1137591932 16:49699099-49699121 GCCTGTCGGCTCCTTGGCAGAGG - Intronic
1137603986 16:49775061-49775083 GCCTGGAGGGAGCTGGGCGGAGG - Intronic
1137605889 16:49786553-49786575 GCCTGGTGGCTGCAGGGCATAGG - Intronic
1137773531 16:51037227-51037249 GCCTCTCTGCTGATGGGCAGTGG - Intergenic
1139593635 16:67946405-67946427 GCCTGGGGCCTGGTGGGCAGGGG - Intronic
1141443273 16:84042842-84042864 GCCTGCAGGGGGCTGGGGAGAGG - Intergenic
1141634582 16:85307248-85307270 GCCTGGAGGCTCCTTGTCAGTGG + Intergenic
1141836717 16:86545506-86545528 GCCTCAAGGCTGCTGAGAAGGGG + Intronic
1142078097 16:88132002-88132024 GCCCGTGGGAAGCTGGGCAGCGG + Intergenic
1142371394 16:89684900-89684922 GGCTGTGGGCTGTTGGGAAGAGG + Intronic
1142810898 17:2395100-2395122 ACCTGCGGCCTGCTGGGCAGGGG + Exonic
1142956121 17:3523992-3524014 GCTTGTGGGGTGCTGGGGAGGGG - Intronic
1143114964 17:4577045-4577067 TCCTGAAGGCTGCTGAGCCGGGG + Intergenic
1143116920 17:4586172-4586194 GCCCCTAGTGTGCTGGGCAGAGG + Intronic
1143777245 17:9207634-9207656 GGCTGCAGGATGCTGGGAAGTGG - Intronic
1144732666 17:17537494-17537516 CCCTGCAGGCTGCTGGGCACGGG - Intronic
1145862342 17:28221523-28221545 GCCTGCAGGCGGAAGGGCAGTGG + Intergenic
1145929768 17:28676885-28676907 GCTTCTAGGCTGCAGTGCAGTGG - Intronic
1146645048 17:34571680-34571702 GCCGTTTGGCTGCTGGGCTGTGG + Intergenic
1147247642 17:39132687-39132709 GAATGGAGGCAGCTGGGCAGAGG + Intronic
1147334781 17:39720687-39720709 GCCTGCAGGCTGGAGTGCAGTGG + Intronic
1148084848 17:44987882-44987904 GCCTGGATGCTGGGGGGCAGAGG + Intergenic
1148167753 17:45495196-45495218 TCATGTAGGCTGCAGTGCAGTGG - Intergenic
1148339216 17:46863421-46863443 TCCTGTAAGCTCCTTGGCAGAGG - Intronic
1148683349 17:49486999-49487021 GCCTGGAGGCTGGTGGGCACTGG - Intergenic
1148950330 17:51305347-51305369 GGCTGCAGGCTGGTGGGGAGAGG + Intergenic
1150143316 17:62748355-62748377 GCCTGGAGGCTGGAGTGCAGTGG - Intronic
1150398930 17:64841611-64841633 TCATGTAGGCTGCAGTGCAGTGG - Intergenic
1151470029 17:74312227-74312249 GCCTGTAGGGGCCTGGACAGGGG + Exonic
1151765608 17:76131916-76131938 GCCTGTGGGTGGCTGGGCAAGGG + Intergenic
1151786018 17:76275477-76275499 GCATGGTGGCTGCTGGGCACAGG - Intronic
1152749648 17:82056769-82056791 GGCTGTGGGCTGCGGGGCGGTGG + Intronic
1152808163 17:82367959-82367981 GCCTATTGGTTGTTGGGCAGGGG + Intergenic
1152808184 17:82368054-82368076 GCCTATTGGTTGTTGGGCAGGGG + Intergenic
1152827777 17:82478579-82478601 GCCTGGAGGCTACTGGGAAATGG - Intronic
1153219513 18:2848918-2848940 GCCTGTAGTCTTATGGGAAGTGG + Intronic
1153242335 18:3042397-3042419 ACCTGTGGGCTCCTGGGCTGTGG + Intergenic
1153703717 18:7723616-7723638 GCCTACAAGCTGGTGGGCAGAGG - Intronic
1153979304 18:10295692-10295714 GGCAGTAGGATGCTGGGAAGAGG + Intergenic
1154355838 18:13622649-13622671 GCCTGTAGATTGTTGGACAGAGG + Intronic
1157325832 18:46668366-46668388 TCATGCAGGCTCCTGGGCAGGGG + Intronic
1157479520 18:48044506-48044528 GCCTTTGGGCAGCTGGGCTGGGG + Intronic
1157492737 18:48135947-48135969 GCCGGCAGGCGGGTGGGCAGCGG - Intronic
1160018291 18:75160639-75160661 GCCTGTCTGCGGCTGGCCAGGGG + Intergenic
1160400510 18:78607557-78607579 GCATGTAAGCGGCTGGGCTGTGG - Intergenic
1160814821 19:1030161-1030183 GGCTGTGTGCTCCTGGGCAGTGG - Intronic
1161112731 19:2479099-2479121 GCTTGGGGGCTGCAGGGCAGAGG - Intergenic
1161300994 19:3543262-3543284 GCCTGATGGCTGGTGGCCAGCGG - Exonic
1161482971 19:4519875-4519897 CCATGGAGGGTGCTGGGCAGAGG - Intergenic
1161767370 19:6215043-6215065 ACCTGTGGGATGCGGGGCAGAGG - Intronic
1161945917 19:7436684-7436706 GCCAGGATGCTGCTGGGCAAAGG + Intronic
1161964594 19:7541127-7541149 GCCTGCTGGCTGCTGGGCCTCGG - Intronic
1162392900 19:10400169-10400191 GGCTGTAGCAGGCTGGGCAGGGG + Intronic
1163124776 19:15238969-15238991 TCCTCTCGGCTCCTGGGCAGAGG + Exonic
1163128958 19:15260066-15260088 GTCTGTGGGATGCCGGGCAGGGG - Intronic
1163441656 19:17325000-17325022 GCCTGTGGGTGACTGGGCAGGGG + Exonic
1163562342 19:18027111-18027133 CCCTGGAGCCTGCTTGGCAGGGG + Intergenic
1164017318 19:21264629-21264651 GACAGTGGGCAGCTGGGCAGAGG - Intronic
1164017360 19:21264828-21264850 GGCTGTGGGCAGCTGGGCAGAGG - Intronic
1164017369 19:21264867-21264889 GATGGTGGGCTGCTGGGCAGAGG - Intronic
1164017379 19:21264906-21264928 GGCTGTAGGCAGCTGGGCAGAGG - Intronic
1164017387 19:21264945-21264967 GATGGTGGGCTGCTGGGCAGAGG - Intronic
1164432062 19:28197341-28197363 GCCTGAGGGCTGCTGGGGAGGGG - Intergenic
1164640805 19:29824178-29824200 GCCCATAGCCAGCTGGGCAGGGG + Exonic
1164816121 19:31204811-31204833 GCTTGTGGCTTGCTGGGCAGAGG - Intergenic
1164944942 19:32285632-32285654 GCTTGCAGGCTGCGGGGCTGGGG + Intergenic
1165349748 19:35269207-35269229 GCCTGCAGGCCGCGGGGCCGGGG - Intronic
1165373497 19:35425241-35425263 TCCTGTAGTCTCCTGGGCTGTGG - Intergenic
1165422611 19:35729820-35729842 GCCTGGATGCGGCTGGGGAGAGG + Intronic
1166062868 19:40337755-40337777 GCCTGTGGCTGGCTGGGCAGGGG - Intronic
1166092587 19:40519846-40519868 TCTTCTAGGCTGTTGGGCAGGGG - Exonic
1167791751 19:51687891-51687913 GGCTGGAGACTGCTGGGCACTGG - Intergenic
1168083136 19:54024956-54024978 GCCTCTAGGCTGGAGTGCAGTGG + Intergenic
1168225899 19:54994993-54995015 GAATGTGGGGTGCTGGGCAGTGG - Intronic
1168317188 19:55489470-55489492 GCCTGCCGGCAGCTGGGCTGCGG + Exonic
1168710614 19:58498008-58498030 GCCTGGAGGTTGCTGGACTGAGG - Intronic
925142982 2:1562642-1562664 GGCTGGAGGGTGCTGGGCTGAGG - Intergenic
925405731 2:3604485-3604507 GACTCTGGGCTGCTGGGCAGTGG + Intronic
925605779 2:5658380-5658402 GCCTGAAGGGTGCAGGGCTGAGG - Intergenic
926111313 2:10185939-10185961 AGCAGTAGGCTGCTGGACAGAGG + Intronic
926706293 2:15840127-15840149 GCCTGCAGGGTGCTGGGCCCGGG - Intergenic
926965949 2:18411101-18411123 TCCTCTAGGGTGCTGGGCAAAGG - Intergenic
927727587 2:25438502-25438524 CACTGTAGGATTCTGGGCAGGGG + Intronic
927851691 2:26503684-26503706 GCCTTTTGGCAGCCGGGCAGGGG + Intronic
927917801 2:26947873-26947895 GCCTGCAGTCTTCTGGGCTGCGG + Exonic
929174305 2:38960828-38960850 AGCTGTAGGCTGCTGGGCCCTGG + Intronic
931259061 2:60600747-60600769 GTCTGCAGGCTGCTGAGCAGAGG - Intergenic
931868436 2:66435039-66435061 GCAAGTAGGCTCCTCGGCAGGGG - Intronic
932340232 2:70958878-70958900 ACCTGTGGGCTGCCGGGGAGGGG + Intronic
932413685 2:71561416-71561438 GCCTGTAGTCAGTGGGGCAGAGG + Intronic
932961374 2:76415886-76415908 CCCTCTAGACTGCTGGGCGGGGG - Intergenic
933084439 2:78038075-78038097 GCCTTTAGACTCCAGGGCAGAGG - Intergenic
934907786 2:98220963-98220985 GCCTGTCGGGGGCGGGGCAGAGG + Intronic
935124958 2:100214918-100214940 GCCTGGGGGCTGCTGTGCAAGGG + Intergenic
935570473 2:104654979-104655001 ATCTGTAGGATGCTGGGGAGGGG + Intergenic
937263622 2:120602009-120602031 GCAGGGAGGCTGCTGGGCAGGGG - Intergenic
937910768 2:127074459-127074481 GCCAGGTGGCTGCTGGGCTGTGG - Intronic
938055035 2:128208403-128208425 GACAGTGGGCAGCTGGGCAGAGG - Intergenic
938055092 2:128208678-128208700 GACGGTTGGCAGCTGGGCAGAGG - Intergenic
938055162 2:128208993-128209015 GACAGTGGGCAGCTGGGCAGAGG - Intergenic
938386594 2:130871118-130871140 GCCTGTGGGTTGCTGAGCTGGGG + Intronic
938557333 2:132437539-132437561 GCCTGTGGGTTGGCGGGCAGAGG + Intronic
938940792 2:136168005-136168027 GCCTGAAAGATGCTGGGCAGAGG + Intergenic
940005135 2:149003304-149003326 GCATGGAGCCTGCTGGCCAGGGG + Intronic
940554877 2:155211954-155211976 GCCTGGAGGCTGGAGTGCAGTGG + Intergenic
942331624 2:174830712-174830734 TCCTGTCTGCTGCTGGCCAGTGG - Intronic
942954595 2:181759340-181759362 GCATGTGGGCTGGTGGGCAAGGG + Intergenic
944350998 2:198726338-198726360 ACCTGTTGGTTGCTGGGCAATGG - Intergenic
946348983 2:219135567-219135589 TCCTGTAGGCTGGAGTGCAGTGG - Intronic
946616519 2:221516392-221516414 TCCTGTAGGCTGGAGTGCAGAGG + Intronic
947839428 2:233198202-233198224 GGCTGTGGGCTGCTGGTCAGGGG - Exonic
948124526 2:235555112-235555134 GCCTGGATGCTCCTAGGCAGAGG + Intronic
948163746 2:235845260-235845282 GCCTCTAGACTCCTGTGCAGGGG - Intronic
948566446 2:238890203-238890225 GCCAGGAGCCTGCTGGGCTGGGG + Intronic
948658181 2:239489805-239489827 GCCTGGAGGGGGCTGAGCAGGGG + Intergenic
948748568 2:240113406-240113428 GCCCGGAGGCTGCTGGGCAAGGG + Intergenic
948830443 2:240596028-240596050 ACCTGGGGGCTGCTGGACAGTGG - Intronic
948834823 2:240620787-240620809 GCCTGTCAGCTGTGGGGCAGAGG - Intronic
1168809455 20:694703-694725 ACCAGTGGGCTGCTGGGCATAGG + Intergenic
1169128286 20:3147000-3147022 GCATGCAGGCTGCGGGGCACAGG + Exonic
1170403499 20:16012116-16012138 GCCTATTGGCAGCTGGGGAGGGG + Intronic
1171175539 20:23048976-23048998 GCCTGCAGGTGGCTGGGAAGTGG + Exonic
1171322228 20:24256349-24256371 GCCTGTAGGGAGCTGTGCGGCGG + Intergenic
1172570832 20:35968963-35968985 GCTGGTAGGCTACAGGGCAGGGG - Intronic
1173249786 20:41358383-41358405 GCCTGCAGGCAGCTGGGGAGAGG - Intronic
1174200789 20:48805121-48805143 GCCAGGAGGCTGGTGGGCACTGG - Intronic
1174395903 20:50246790-50246812 ACCTGTCTGCTGCTTGGCAGGGG + Intergenic
1174549691 20:51353184-51353206 GTCTCTAGGCTGGAGGGCAGTGG + Intergenic
1174674590 20:52341174-52341196 GCCTGCAGGCTGCAGGGTTGGGG + Intergenic
1174979949 20:55382284-55382306 ACCTGTAGACTGATGGGCATAGG + Intergenic
1175260119 20:57668917-57668939 TCCTGGAGGCTGGAGGGCAGAGG - Intronic
1175482044 20:59318621-59318643 GCCTCAAGGCTGTAGGGCAGGGG + Intronic
1175493370 20:59394271-59394293 GTCTGTAGACTGCAGGACAGAGG + Intergenic
1175980264 20:62735229-62735251 GCCTGCAGGGTCCTTGGCAGAGG + Intronic
1176135789 20:63521447-63521469 GCCTGAAGGCCGGTGGGCTGGGG + Intronic
1178468233 21:32868834-32868856 GCCTGCAGGCAGCTGGTCAGTGG + Intergenic
1179584219 21:42364836-42364858 CCATGGAAGCTGCTGGGCAGCGG - Intronic
1179607298 21:42525071-42525093 GCTTGCAGGCTGCTGAGCACGGG + Intronic
1180000227 21:44992274-44992296 GCCCTTAGCCTGCTGTGCAGGGG + Intergenic
1180676493 22:17590056-17590078 GCCAGTGAGCTGATGGGCAGGGG - Intronic
1181456918 22:23065018-23065040 GGCAGTGGGCTGCAGGGCAGTGG - Intronic
1181871447 22:25902563-25902585 CCCCGTAGGCAGGTGGGCAGGGG - Intronic
1181941364 22:26480209-26480231 CCCTGTAGGCTGGAGTGCAGTGG + Intronic
1182422618 22:30255996-30256018 GCCTGCTGCCCGCTGGGCAGTGG - Intergenic
1182511215 22:30821920-30821942 GCCTGTGGGCAGCTGGACAGTGG + Intronic
1183044529 22:35209114-35209136 GCCTCTAGGCTGGAGTGCAGTGG - Intergenic
1183509079 22:38224694-38224716 ACCTGTAGGATGCTGGGAGGTGG + Intronic
1183786041 22:40029764-40029786 GACTGTCGGTGGCTGGGCAGGGG + Exonic
1184057378 22:42061433-42061455 GCCTGGAGGGTGCTGTCCAGTGG + Intronic
1184248311 22:43246685-43246707 GCCTGGAGGCTGCTCAACAGAGG + Intronic
1184718879 22:46297427-46297449 GCCTTCAGCCTGCCGGGCAGGGG + Exonic
1184775826 22:46622220-46622242 GCCTGCAGGGCTCTGGGCAGAGG - Intronic
1185191274 22:49438082-49438104 GCCCGCAGGCTCCTGGTCAGAGG + Intronic
1185209944 22:49565134-49565156 GCCTGGATGCTGCTGGGCTATGG - Intronic
1185316512 22:50181515-50181537 CCCTGGTGGGTGCTGGGCAGGGG + Intergenic
954545584 3:51431929-51431951 GGCTGTAGGCTGTAGTGCAGTGG - Intronic
956520272 3:70096162-70096184 TCCTGCTGGCTGCTGGACAGAGG + Intergenic
956688461 3:71854439-71854461 GCCCATGGGCTGCTGGGCATTGG + Intergenic
959391038 3:105773920-105773942 GCCTCTTGGCTGCTGGGCTTGGG + Intronic
960467850 3:118019457-118019479 GCTTCTATGGTGCTGGGCAGTGG - Intergenic
960964081 3:123092463-123092485 CCATGGTGGCTGCTGGGCAGAGG + Intronic
961465142 3:127076846-127076868 GCCTGGAGGCTGCTGGAGAATGG - Intergenic
961649943 3:128412339-128412361 ACATGGAGGCTGCTCGGCAGAGG - Intergenic
962525505 3:136234274-136234296 TCCTTTTTGCTGCTGGGCAGTGG - Intergenic
962740908 3:138362046-138362068 GGTTGTTGGTTGCTGGGCAGGGG + Intronic
963907300 3:150783217-150783239 GCCTATAGTCTGATGGGCAAGGG + Intergenic
963939817 3:151086740-151086762 GCGTGTCTGCTGCCGGGCAGCGG + Intronic
964475287 3:157092375-157092397 GCCTGTAGCCAGCTTGCCAGAGG + Intergenic
964744121 3:159996573-159996595 GTCTGTGGCCTGTTGGGCAGTGG + Intergenic
968298087 3:197592726-197592748 GCTTGTGTGCTTCTGGGCAGCGG - Intergenic
968461078 4:725390-725412 GTGTGTAGGCTGCTGGGAGGAGG + Intronic
968528490 4:1077186-1077208 GCCTATAGGCTGGAGTGCAGTGG - Intronic
968577365 4:1374183-1374205 CCCTGTGGGCTGCCGGCCAGGGG - Intronic
968762501 4:2449876-2449898 GCCTGGAGGACACTGGGCAGAGG + Intronic
969119406 4:4896886-4896908 CCTTGTAGGCTGCTGGACTGAGG + Intergenic
969249110 4:5955531-5955553 GCCTGAAGGGGTCTGGGCAGAGG + Intronic
969291548 4:6243236-6243258 TGCTGTGGGCTGTTGGGCAGTGG + Intergenic
969585689 4:8090129-8090151 CCGTGCAGGCTCCTGGGCAGTGG - Intronic
969696546 4:8738246-8738268 GCCTCCCGGCTGCTGGGTAGAGG - Intergenic
969878621 4:10155039-10155061 CCCTGCAGGCTTCTGAGCAGAGG + Intergenic
969967740 4:11014423-11014445 GGCCTTAGGCTTCTGGGCAGAGG - Intergenic
970261301 4:14227585-14227607 GAGTGTAGCATGCTGGGCAGAGG + Intergenic
971068295 4:23060138-23060160 GCCTTTGGGATGCTGGGTAGGGG - Intergenic
972022109 4:34327814-34327836 GCCTGTAGGTGGGTGGGAAGTGG + Intergenic
974648475 4:64724878-64724900 GCCTCTAGCCTGATTGGCAGTGG + Intergenic
975124389 4:70765800-70765822 GGCTGTAGGCTGTAGTGCAGTGG + Intronic
975787632 4:77908864-77908886 TCCTGTAGGCTGCTGGACACAGG + Intronic
977666237 4:99649937-99649959 CCCTGTAGGGTGAAGGGCAGCGG + Exonic
981777267 4:148383906-148383928 CCCTGTAGGCTGGAGTGCAGTGG - Intronic
984075854 4:175178850-175178872 GCCTGTTGGGTGGTGGGGAGTGG - Intergenic
984679994 4:182596368-182596390 GCCCGTAGGGAGCTGAGCAGGGG + Intronic
985574254 5:666210-666232 GCCTGTGGGCTGCTGGGCCATGG - Intronic
986058264 5:4161357-4161379 GACTGGAGGCTGCTGGCCTGGGG - Intergenic
986706431 5:10457960-10457982 CCCTGCAGGCTGCTGGGGTGGGG - Intronic
988506282 5:31826205-31826227 GGCTGTGGGCTGCTAGGGAGTGG + Intronic
988734639 5:34008064-34008086 TCTTGCAGGCTGCTGGGCTGGGG - Intronic
989994686 5:50814710-50814732 GCCTTTTGTCTGCTGTGCAGAGG + Intronic
991650733 5:68850078-68850100 GTCTGCTGGCTGCTGGGGAGGGG + Intergenic
993093241 5:83452379-83452401 CCCTGTAACCTGCTTGGCAGAGG + Intergenic
996604354 5:125303595-125303617 TCATGTAGGCTGGAGGGCAGTGG - Intergenic
996716181 5:126589867-126589889 GACAGTGGGCAGCTGGGCAGAGG - Intronic
996716205 5:126589985-126590007 GACAGTGGGCAGCTGGGCAGAGG - Intronic
996786661 5:127244323-127244345 GGCTGGAGGCTGCAGTGCAGTGG - Intergenic
996789549 5:127277977-127277999 TCCAGGAGGCAGCTGGGCAGAGG + Intergenic
998041237 5:138952113-138952135 GCCCCTTGGCTGCTGGGGAGTGG - Intronic
998370358 5:141656683-141656705 ACCTGGGGGATGCTGGGCAGAGG + Intronic
998508863 5:142694831-142694853 TCCTGTAGGCTCTGGGGCAGGGG + Intronic
999298017 5:150472693-150472715 GCCTGTAGCCTGTAGGACAGTGG - Intergenic
999874732 5:155791189-155791211 GAATGTAGACAGCTGGGCAGAGG + Intergenic
999900588 5:156082253-156082275 GTGTGTAGGCTGGTGGGCGGGGG + Intronic
1001481767 5:172093636-172093658 ATCTGTTGGCTGCTGGGCTGAGG + Exonic
1001704281 5:173730624-173730646 CCCCGTAGGCTCCTGAGCAGAGG + Intergenic
1002671874 5:180873969-180873991 GTTTGAAGGCTGCTAGGCAGGGG - Intergenic
1003524346 6:6885698-6885720 ACCCGCAGGCTCCTGGGCAGAGG + Intergenic
1003865060 6:10355388-10355410 CTCGGCAGGCTGCTGGGCAGGGG - Intergenic
1004044658 6:12012330-12012352 GCGTGGCGGCTGCTGGGCGGCGG + Exonic
1005778051 6:29159776-29159798 ACCTGGAGCCTGCAGGGCAGAGG - Intergenic
1005778810 6:29166103-29166125 ACCTGGAGCCTGCAGGGCAGAGG + Intergenic
1006498980 6:34445288-34445310 GCCTGTAAGTTCCTGAGCAGAGG - Intergenic
1007636004 6:43300072-43300094 GACTGCAGGCAGCTGGGGAGCGG + Intronic
1009431595 6:63572382-63572404 GCCTGTCGGCTCCTGGCCCGCGG + Exonic
1011079412 6:83473128-83473150 GTCTGAAGGTTGCTGTGCAGAGG + Intergenic
1011852421 6:91646725-91646747 CCTTGCAGGCTGCTGGCCAGAGG - Intergenic
1016322695 6:142864243-142864265 TCCTGTAGGCTGCTGGTGATGGG - Intronic
1016877656 6:148879992-148880014 GGCTGGAGGCTGGTGTGCAGTGG + Intronic
1017326437 6:153146135-153146157 GACTGTTGGCTGCATGGCAGCGG - Intergenic
1018224356 6:161613892-161613914 GCCTTTGGGATTCTGGGCAGAGG - Intronic
1018247932 6:161840172-161840194 ACCCGTAGGCTCGTGGGCAGGGG + Intronic
1018248553 6:161845241-161845263 GCCTAGAGGCTACTGGCCAGGGG - Intronic
1018743655 6:166748475-166748497 GGCTGGAGGATGCTGGGCAGAGG + Intronic
1019196993 6:170288887-170288909 GCCTGAAGGCTGCAGGTCTGGGG + Intronic
1019217641 6:170453935-170453957 ACCAGAAGGCTGCTGGGGAGGGG + Intergenic
1019360208 7:601017-601039 CCCTGGACGCTGCTGGTCAGAGG + Intronic
1019522307 7:1466459-1466481 GCCTGTAGGAAGCTGAGCATGGG - Intergenic
1019907234 7:4074000-4074022 GCCTATTGGTTGTTGGGCAGGGG + Intronic
1021623386 7:22569785-22569807 CCCTGCAGCCTGATGGGCAGAGG - Intronic
1022840364 7:34158446-34158468 GACTGTAGGCTGATGGATAGAGG + Intergenic
1023114091 7:36843636-36843658 TCCTGTAGTCTCATGGGCAGTGG - Intergenic
1023542926 7:41285451-41285473 GTCTCCAGGCTGCAGGGCAGTGG - Intergenic
1023813021 7:43926809-43926831 ACCTGCAGGCTTCTGGACAGCGG + Intronic
1023842400 7:44104687-44104709 GCCAGGAGGCAGCTGAGCAGGGG - Exonic
1023845265 7:44116767-44116789 GCTTGCAGGCTCCTGGGCTGGGG + Intronic
1024216611 7:47254242-47254264 GCCGGTAGCCCGCAGGGCAGCGG + Intergenic
1024582379 7:50810366-50810388 GCGTGGATGCTGCTGGGCTGAGG - Intergenic
1026163177 7:67888551-67888573 GACAGTTGGCAGCTGGGCAGAGG - Intergenic
1026163246 7:67888905-67888927 GACAGTGGGCCGCTGGGCAGAGG - Intergenic
1026163332 7:67889334-67889356 GATGGTTGGCTGCTGGGCAGAGG - Intergenic
1026163363 7:67889491-67889513 GACTGTGGGCAGCTGGGCAGAGG - Intergenic
1026163379 7:67889569-67889591 GACTGTGGGCAGCTGGGCAGAGG - Intergenic
1026163387 7:67889608-67889630 GACTGTTGGCAGCTGGGCAGAGG - Intergenic
1026163408 7:67889725-67889747 GACTTTGGGCAGCTGGGCAGAGG - Intergenic
1026163447 7:67889916-67889938 GACTGTGGGCAGCTGGGCAGAGG - Intergenic
1026163464 7:67889994-67890016 GACTTTGGGCAGCTGGGCAGAGG - Intergenic
1026163480 7:67890072-67890094 GACTGTGGGCAGCTGGGCAGAGG - Intergenic
1026163514 7:67890267-67890289 GACTTTGGGCAGCTGGGCAGAGG - Intergenic
1026163522 7:67890306-67890328 GACTTTGGGCAGCTGGGCAGAGG - Intergenic
1026163529 7:67890345-67890367 GACTGTTGGCAGCTGTGCAGAGG - Intergenic
1026163602 7:67890667-67890689 GACGGTTGGCAGCTGGGCAGAGG - Intergenic
1026197737 7:68187415-68187437 GGCTGGAGGCTGGAGGGCAGTGG - Intergenic
1026853795 7:73740038-73740060 TCCGGTAGGCTGGTGTGCAGTGG - Intergenic
1027352088 7:77322302-77322324 GACTAGTGGCTGCTGGGCAGGGG + Intronic
1028444416 7:90904034-90904056 GCCAGCAGGCTGCAGGGCTGTGG - Intronic
1031560328 7:123230693-123230715 GGCTGTGGCCTTCTGGGCAGTGG + Intergenic
1032418352 7:131756221-131756243 GACAGTGGGCAGCTGGGCAGAGG + Intergenic
1032427422 7:131832950-131832972 GCCTGTGGGTAGCAGGGCAGTGG - Intergenic
1033444047 7:141404908-141404930 GGCTGTTGGGTGCTGGTCAGAGG - Intronic
1034339041 7:150340732-150340754 GCCTGTAGAACGCTGGGCACAGG + Exonic
1034684173 7:152955104-152955126 GCCTGTAGACTGAGGGGCACTGG - Intergenic
1034992283 7:155555392-155555414 GGCAGGAGGGTGCTGGGCAGGGG + Intergenic
1035245792 7:157561303-157561325 GCCTGGAGTCTGCAGGGAAGTGG - Intronic
1035780224 8:2222288-2222310 ACCTGTTGGTTGCTGGGCAGGGG - Intergenic
1035780267 8:2222478-2222500 GCCTGTTGGTTGTTGGGTAGGGG - Intergenic
1035780333 8:2222763-2222785 GCCTGTTGGTTGTTGGGTAGGGG - Intergenic
1036610196 8:10343183-10343205 GCCTGAAGGTTGCTGGGAAAAGG - Intronic
1036756201 8:11472866-11472888 GACTCTATCCTGCTGGGCAGAGG + Intronic
1037700839 8:21272526-21272548 GGCTGTAGCCTCCTGGGCTGTGG - Intergenic
1037770978 8:21799672-21799694 GGCTGGAGGGTGGTGGGCAGGGG - Intronic
1038168989 8:25111460-25111482 CCCAGTAGGCAGCTGGGCACGGG - Intergenic
1039188043 8:34939336-34939358 AGCTGTGGGCTGCTGGGCAAAGG + Intergenic
1040041338 8:42919185-42919207 GACGGGCGGCTGCTGGGCAGAGG + Intronic
1040626248 8:49152547-49152569 TCTTGTAGCCTGCTGGGGAGAGG - Intergenic
1043515732 8:80993196-80993218 GCGGGGAGCCTGCTGGGCAGCGG - Exonic
1044424134 8:92031755-92031777 AACTTTAGGCTGCTGGGCACTGG - Intronic
1044947926 8:97408214-97408236 GACTGGAGGCTGCTTGGGAGTGG - Intergenic
1045373574 8:101549493-101549515 GCCTGGAGGCTGGTGTCCAGGGG + Intronic
1046522361 8:115341919-115341941 GGCTGGAGGCTGGAGGGCAGTGG + Intergenic
1046736067 8:117777822-117777844 GCCGGGCGGCTGCGGGGCAGAGG - Intergenic
1048377197 8:133833322-133833344 GCTGATAGGGTGCTGGGCAGAGG - Intergenic
1048531146 8:135251592-135251614 GACTGTAGGCTGCATGGGAGAGG - Intergenic
1048949890 8:139487639-139487661 GTCTGAAGTCTGCAGGGCAGGGG + Intergenic
1049089999 8:140507445-140507467 GCCTGCTGGCTGCAGGGTAGAGG - Intergenic
1049213989 8:141399368-141399390 GCCTCTGGGCAGCTGGCCAGAGG - Intronic
1049989022 9:975513-975535 GCTTGTTTGCTGATGGGCAGTGG + Intergenic
1050457392 9:5847037-5847059 GCCTATGGGCTGCTGAGCATTGG - Intergenic
1052413582 9:28149733-28149755 GACGGTGGGCAGCTGGGCAGAGG - Intronic
1053156615 9:35785303-35785325 GTTTGAAGGCTGCTGCGCAGAGG + Intergenic
1055231659 9:74074092-74074114 GACAGTGGGCAGCTGGGCAGAGG + Intergenic
1056464368 9:86839312-86839334 GCCTGGAGGCTGATGCCCAGGGG + Intergenic
1057151080 9:92796608-92796630 ACCTGGAGGCTGCTCTGCAGGGG - Intergenic
1058368180 9:104234889-104234911 GACTATGGGCGGCTGGGCAGAGG + Intergenic
1058662406 9:107278673-107278695 TCATGTAGGCTGGAGGGCAGTGG - Intergenic
1059343251 9:113611605-113611627 CCCAGCAGGCTGCTGGGCAGAGG + Intergenic
1059430306 9:114245974-114245996 GCATGGAGGGTGCTGGGCAAAGG - Intronic
1060591588 9:124820469-124820491 GCCAGGAGGGTGATGGGCAGGGG - Intergenic
1061841225 9:133359562-133359584 GACTTCAGGCTGCTGGGGAGAGG + Intronic
1061872545 9:133528527-133528549 GCCTGCCATCTGCTGGGCAGAGG - Intronic
1062000066 9:134211461-134211483 CCTTGGAGGCCGCTGGGCAGCGG - Intergenic
1062040118 9:134400669-134400691 GCCTCCAGGGTGCGGGGCAGGGG + Intronic
1062179633 9:135184336-135184358 GCCCGGAGGCTGCTGGGCAGTGG - Intergenic
1062194625 9:135266044-135266066 GCCAGGAGGCTGCTGGTGAGGGG + Intergenic
1062199741 9:135296026-135296048 GCCTGTTGGTTGTTGGGCAGGGG - Intergenic
1062210803 9:135362741-135362763 GCCTGTGGGATCCTGGGAAGGGG - Intergenic
1062368091 9:136221488-136221510 GCATGAGGGCTGCTGGGCCGGGG - Intronic
1062385408 9:136309045-136309067 ACCTGTACGGAGCTGGGCAGAGG - Intergenic
1062576731 9:137212324-137212346 GCCTGCAGGATGATGGGCACCGG - Intronic
1185432994 X:20030-20052 GCCTGTAGGGGGCTGCGCGGCGG + Intergenic
1185705724 X:2264926-2264948 CCCTGGAGTCTGCTGGGCATGGG - Intronic
1185893886 X:3842370-3842392 GCCTGAAGGCTCCTGGGCTATGG + Intronic
1185899001 X:3880794-3880816 GCCTGAAGGCTCCTGGGCTATGG + Intergenic
1185904118 X:3919223-3919245 GCCTGAAGGCTCCTGGGCTATGG + Intergenic
1187268827 X:17761557-17761579 ACCTGAAGGATGATGGGCAGGGG + Intergenic
1187320649 X:18234769-18234791 ACCTGAAGGATGATGGGCAGGGG - Intergenic
1188216094 X:27479186-27479208 TCTTGTTGGCTGCTGGCCAGAGG - Intergenic
1189577905 X:42375136-42375158 GCCTGTGGGCCGCCTGGCAGGGG + Intergenic
1189882069 X:45503896-45503918 ACCAGGTGGCTGCTGGGCAGGGG + Intergenic
1190153136 X:47965505-47965527 GACGGTAGGCAGCTGGGCAGAGG - Intronic
1190153201 X:47965777-47965799 GACAGTGGGCAGCTGGGCAGAGG - Intronic
1192448980 X:71231013-71231035 GCCTGTGGGATTCAGGGCAGCGG + Intergenic
1195141471 X:101964865-101964887 GCTTGTTCGCTGGTGGGCAGGGG + Intergenic
1195332333 X:103813500-103813522 GTCTCTAGGCTGGAGGGCAGTGG + Intergenic
1195978881 X:110558024-110558046 GACAGTGGGCAGCTGGGCAGAGG + Intergenic
1198487138 X:137098803-137098825 GCCAGGAGGCTGCAGTGCAGTGG + Intergenic
1198664711 X:139007985-139008007 GACTGCAGGCTGCAAGGCAGCGG + Intronic
1200116391 X:153771526-153771548 TCCTGTTGGCCGCTTGGCAGTGG - Exonic
1200267963 X:154655978-154656000 GCCTCTCGGCTGCTGGGGTGGGG + Intergenic