ID: 1087259453

View in Genome Browser
Species Human (GRCh38)
Location 11:95994264-95994286
Sequence CAAAGGATGTACCTCAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087259453 Original CRISPR CAAAGGATGTACCTCAGAGA TGG (reversed) Intronic
900670487 1:3850765-3850787 CAGAGGATGTACCCAAGAAAAGG - Intronic
902375914 1:16029887-16029909 CTAAGGATGGTCCTCAGGGATGG + Intronic
903550062 1:24151718-24151740 CAAAGGAGGGACCTCTGAGAAGG + Intergenic
903972735 1:27129635-27129657 CAAAGGATGAAGCCCAGAGAGGG + Intronic
904236024 1:29117811-29117833 CAAGGAATGTGGCTCAGAGAAGG + Exonic
904361927 1:29981526-29981548 TAAAAGATGTACAACAGAGAGGG - Intergenic
905003468 1:34692153-34692175 CAAAGGGAGTAGCCCAGAGATGG + Intergenic
906458519 1:46019457-46019479 CAAAGCAAGGAACTCAGAGAAGG - Intronic
906718140 1:47985570-47985592 CCTAGGTTGTCCCTCAGAGATGG + Intronic
911792231 1:102031997-102032019 CAAGGGAGGGACCTCAGAGGAGG - Intergenic
912051342 1:105532331-105532353 CAAATGATGTAACTCAGAAATGG - Intergenic
918048916 1:180957496-180957518 CCACAGATGCACCTCAGAGAGGG - Intergenic
918539080 1:185607629-185607651 TGAAGAATGTACCTGAGAGATGG - Intergenic
918782006 1:188711486-188711508 GAAAGGAAGCACATCAGAGAAGG + Intergenic
920251821 1:204627167-204627189 AAAAGTATGTCCCTCACAGAAGG - Intronic
920353493 1:205353121-205353143 CACAGGTTGTACCTCAGTGCAGG + Intronic
920673506 1:208023077-208023099 CAAAGCATGTTCCTGAGACAAGG + Exonic
924851810 1:247838564-247838586 CACAGGAAGTACCTCATGGATGG - Intergenic
1064831751 10:19476394-19476416 GGAAGGGTGTAGCTCAGAGAGGG - Intronic
1065303251 10:24344451-24344473 AAGAAGATTTACCTCAGAGAAGG - Intronic
1067259883 10:44680195-44680217 TAAAGGATGTTCCTCAAGGAGGG + Intergenic
1067668229 10:48296662-48296684 CAAAGGAATTACCTCAAGGATGG - Intergenic
1071435689 10:85646690-85646712 GAAGAGTTGTACCTCAGAGATGG - Intronic
1071922112 10:90362092-90362114 CAAAGGATGTGGCTCAAGGATGG + Intergenic
1073344187 10:102769778-102769800 CAAATCATGTATTTCAGAGAGGG - Intronic
1074219175 10:111419642-111419664 CCCAGGATGTACCTCATAAAAGG + Intergenic
1077947490 11:6917415-6917437 CTAAGGTGATACCTCAGAGAGGG - Intergenic
1079298640 11:19257509-19257531 CAGAGGATGTATCTGACAGAGGG - Intergenic
1081217512 11:40419751-40419773 AAAAGGCTGTACCTAATAGAAGG + Intronic
1082957573 11:58886491-58886513 CAGATGATGAAACTCAGAGAAGG - Intronic
1082967378 11:58980388-58980410 CACATGATGAAACTCAGAGAAGG - Intronic
1085543977 11:77299834-77299856 CAAAGAATGTAACTAAGGGAAGG + Intronic
1087259453 11:95994264-95994286 CAAAGGATGTACCTCAGAGATGG - Intronic
1090627892 11:128621875-128621897 CCAAGGGTGTTGCTCAGAGAGGG + Intergenic
1091081658 11:132674813-132674835 CAGTGGATGTGCCTTAGAGAGGG - Intronic
1094078256 12:26502671-26502693 CAAAGTATGTAACTCAGTAATGG + Intronic
1096351107 12:50902165-50902187 CTCAGGATGTACCTCGCAGAGGG - Intergenic
1097988777 12:65812581-65812603 GAAAGGAAGCACATCAGAGAAGG + Intergenic
1100043331 12:90346840-90346862 CAAAGTATGAAACTCAAAGAAGG + Intergenic
1102567802 12:113808514-113808536 CAAAGCATGTTCCTGAGAGTGGG - Intergenic
1105046920 12:133012266-133012288 CACAGGAAGCACCCCAGAGAGGG - Exonic
1105287313 13:19015151-19015173 TAAAGCATGTAGCTCAGAGGAGG + Intergenic
1110446205 13:75584311-75584333 CAGAGGCTATGCCTCAGAGAAGG - Intronic
1110784799 13:79511134-79511156 CAACGGAAGGCCCTCAGAGAAGG + Intronic
1111534526 13:89585582-89585604 GAAAGGATGTGCCTCAGTGTTGG - Intergenic
1115228093 14:31126234-31126256 CAAATGATGTACATCAAAGCTGG + Intronic
1116554618 14:46287499-46287521 CAAAGGAGATAACTAAGAGAGGG + Intergenic
1120005374 14:79350731-79350753 CTAACCATGTAGCTCAGAGATGG - Intronic
1122293163 14:100690340-100690362 CAAAGGATGCACCTCGGAGATGG + Intergenic
1122324554 14:100874748-100874770 CCAAGGAGGGGCCTCAGAGATGG - Intergenic
1124704833 15:31954884-31954906 CATAAAATGTACCTCAAAGATGG + Intergenic
1125302223 15:38268313-38268335 CTAAGGATGTACCTCCGTGTTGG - Intronic
1126949623 15:53867039-53867061 CTGAGGATGTTCCTCAGAAATGG - Intergenic
1127471731 15:59296329-59296351 AAAAGAATGTACCCCAGTGAAGG - Intronic
1130151011 15:81311635-81311657 CAGAGTATGGAGCTCAGAGAGGG + Exonic
1131097381 15:89665086-89665108 CAGAGGATGTTCATCAGAGGGGG + Exonic
1135660616 16:24293335-24293357 CAGAGGATGAACATCAGAGTTGG - Intronic
1135826453 16:25733049-25733071 CATTAGATGGACCTCAGAGATGG - Intronic
1138022719 16:53499200-53499222 CCAAGGAAGTACCTATGAGATGG - Intronic
1138605100 16:58083582-58083604 CACTGAATGTACATCAGAGATGG - Intergenic
1143098673 17:4492578-4492600 GAGAGGCTGCACCTCAGAGATGG - Intergenic
1143178315 17:4968995-4969017 CAAAAGATGGACCTCACAGAAGG + Intronic
1143857663 17:9864207-9864229 CAAAGGATGGTCCTCAGACCGGG + Intronic
1146517123 17:33497977-33497999 CAAGGGAAGTTCCTCAGAGGAGG + Intronic
1146835337 17:36106181-36106203 AAAAGGCTGAAGCTCAGAGAGGG - Intergenic
1147315834 17:39619755-39619777 CAAAGGATGTGGTTCAGAGCAGG - Intergenic
1147661033 17:42117270-42117292 CAAAGGATGAACCTCAGAAGTGG + Intronic
1148687052 17:49506869-49506891 CAAAGAAGGTAACACAGAGAGGG - Intronic
1149039861 17:52175142-52175164 CAAAGGAGGAACTTCAGAAAAGG + Intergenic
1149069506 17:52522696-52522718 TAAATGAAGTAACTCAGAGACGG + Intergenic
1150205512 17:63402624-63402646 GACAGGATGTAGCTCAGAGTTGG - Intronic
1153037897 18:781551-781573 CAAAGTTTGTAGCTCAGAGAAGG - Intronic
1153130262 18:1847787-1847809 GAAAGGATGTACTACAGAGAAGG - Intergenic
1157177414 18:45464275-45464297 CAAACCATTTATCTCAGAGATGG - Intronic
1158847849 18:61463555-61463577 CAAAGGGTGTGTTTCAGAGAAGG - Intronic
1159443255 18:68508536-68508558 CCAGGGATGTACATCAGAAATGG + Intergenic
1160379499 18:78440908-78440930 CAAAGGATTTATCATAGAGAAGG + Intergenic
1161980955 19:7630084-7630106 CCGAGGAAGGACCTCAGAGAGGG + Intronic
1166575836 19:43836961-43836983 CAAAGGATGAACTACAAAGAGGG - Intronic
1167226235 19:48242706-48242728 CTAAGTATGTACCCAAGAGAAGG - Intronic
1167704760 19:51074612-51074634 CAAATGATGTATCTGATAGAGGG + Intergenic
926907301 2:17817330-17817352 CAAAGGATGAGCCTCCCAGATGG - Intergenic
931822864 2:65969845-65969867 CAAAGGATGCAGCCAAGAGAAGG + Intergenic
933167212 2:79089551-79089573 GAAAGGATGCCCCTCACAGATGG + Intergenic
933287904 2:80404411-80404433 CAAAGAATGTCCCCCAGTGAGGG + Intronic
935981221 2:108629828-108629850 CAAAGGAAGGACCTCAGGAAAGG - Intronic
939164992 2:138630525-138630547 TAAAGGAAGTTCCCCAGAGATGG - Intergenic
939189760 2:138902361-138902383 CAGATGATGTACCTCAAGGACGG - Intergenic
939408700 2:141795949-141795971 CAAAGGATGCAACTCACAGTGGG + Intronic
943166000 2:184327095-184327117 TAAAGGATGTTCTTCAGTGAAGG + Intergenic
943738610 2:191386135-191386157 AGGAGGCTGTACCTCAGAGATGG + Intronic
948798459 2:240419198-240419220 CAAAGGAAGAACCACAGAGGTGG - Intergenic
948901681 2:240959542-240959564 GAGAGGCTGTACCACAGAGAAGG + Intronic
1168980436 20:1998935-1998957 AAAAGTGTGTTCCTCAGAGAAGG - Intergenic
1169054000 20:2604880-2604902 CAAAGGATATAACTCAGGAATGG - Intronic
1170246219 20:14224292-14224314 CAAAGGATGGAACTAAGTGATGG - Intronic
1171329442 20:24324656-24324678 CAGAGGTTATTCCTCAGAGATGG - Intergenic
1175674116 20:60932287-60932309 CAATGTATGAACCTCAGAGCTGG - Intergenic
1179148799 21:38793128-38793150 GAAGGGGTGTACCTCAGAGATGG + Intergenic
1179895921 21:44363454-44363476 CAAAGGATGGACCTAACAGCAGG - Intronic
1180246058 21:46548106-46548128 CAGAGGATGGACAACAGAGAAGG + Intronic
1180558357 22:16595667-16595689 GAAAGCCTGTACCTCAGAGTAGG + Intergenic
1183908093 22:41058043-41058065 CAAAGGAAGAACCTCCCAGAAGG + Intergenic
1184372854 22:44093575-44093597 CAAAGCATGGACCACAGCGATGG - Intronic
1184434041 22:44459273-44459295 CACAGGGTGTAGCTCAGAGGCGG - Intergenic
949436992 3:4040260-4040282 CAAATTATGTACCTCAGAATGGG + Intronic
950309626 3:11945750-11945772 CAATGGATGAAACTCAAAGAGGG - Intergenic
950936358 3:16843273-16843295 GAAAGGATATTCCTAAGAGAAGG + Intronic
950966975 3:17153327-17153349 CAAAGGATCCACTTCCGAGATGG + Intergenic
951505619 3:23441594-23441616 CAAAGTCTGTGCTTCAGAGATGG - Intronic
951711146 3:25585800-25585822 CACAGGAGGAAGCTCAGAGAGGG + Intronic
951976050 3:28510246-28510268 CAAAGGGTGTAGCTAAAAGAAGG - Intronic
952464506 3:33567455-33567477 CAAAGCATGCACCACAGTGAAGG + Intronic
953005946 3:38979477-38979499 CAAAGGATGGACCATGGAGATGG - Intergenic
954155654 3:48683640-48683662 CAAAGGATAAACATGAGAGAGGG + Intronic
956153822 3:66272600-66272622 CACAGGAGGTCCCTCAGAGAAGG - Intronic
956287858 3:67629442-67629464 TAAAGGATAAACCTCAGAAATGG + Intronic
958533080 3:95359869-95359891 CATAGTAGGTACCTCAGAAATGG - Intergenic
958877333 3:99631289-99631311 CATAGAATCTACCTCAGTGAAGG + Intergenic
962337596 3:134550182-134550204 CAAAGGTTCTTCCTCAGACATGG + Exonic
965810509 3:172587327-172587349 CAATGGATGAAACACAGAGAAGG - Intergenic
966434760 3:179870705-179870727 CAAAGTATGAAACTCAGGGAAGG - Intronic
968002211 3:195213868-195213890 CAAAGAATGCTGCTCAGAGAAGG + Intronic
970518024 4:16853222-16853244 CAAAGCATGTATCTCATAAAGGG + Intronic
973090361 4:46128149-46128171 CATAGAATGTAGCTCTGAGAAGG + Intergenic
973250942 4:48059277-48059299 CCAAGGATGGACCTAAGATAAGG - Intergenic
973576030 4:52290279-52290301 CAATGGATGAACCCCAGACATGG - Intergenic
973650969 4:52996833-52996855 CAAAGGATCAACCCAAGAGAAGG + Intronic
973909365 4:55563949-55563971 CAAGGGAAGGCCCTCAGAGAAGG + Intronic
975107338 4:70582493-70582515 CAAAGGAGGAAGCACAGAGATGG - Intergenic
975664083 4:76716910-76716932 AAAAGGAAGTGCATCAGAGAAGG - Intronic
979597564 4:122551104-122551126 CTAAGAATGTTCCTTAGAGAAGG - Intergenic
984016750 4:174435770-174435792 CAAAGGCTGTAGGTCAGAGAAGG - Intergenic
986329524 5:6707301-6707323 TAAAAGATGTACCCCAAAGAGGG - Intergenic
987029326 5:13961327-13961349 CAAATGAGGAAACTCAGAGATGG + Intergenic
987556574 5:19458628-19458650 CAAAGGATGGCTTTCAGAGAGGG + Intergenic
989767104 5:45100469-45100491 CAAAGGATGTACTTGAGAGAGGG + Intergenic
990747927 5:58980259-58980281 AAGAAAATGTACCTCAGAGAAGG + Intronic
990855412 5:60261416-60261438 AAAAGGAAGTACTTCTGAGAAGG + Intronic
991563514 5:67981042-67981064 CAGAAGATGTATCTCAGACAAGG + Intergenic
992612556 5:78519920-78519942 GAAAGGATGTAACACAGAGCTGG + Intronic
993363000 5:87001408-87001430 CCAAGGATGCACCTTACAGAAGG - Intergenic
994858106 5:105151804-105151826 GAAAAGATGAACATCAGAGAAGG - Intergenic
995949048 5:117687355-117687377 CAAAGTATGTATCAGAGAGAAGG + Intergenic
997701155 5:135900530-135900552 CAAAGGATGAAACAGAGAGAAGG + Intergenic
1001756519 5:174174537-174174559 CAAAGGACGTGTCTCAGACAGGG - Intronic
1001967237 5:175919605-175919627 CAAAAGATGTTGCTAAGAGAAGG + Intronic
1004127703 6:12889661-12889683 CAAATGATGTAACTGAAAGATGG + Intronic
1008687222 6:53938901-53938923 CAAAGGCTGCACCTCATTGAAGG + Intronic
1009646326 6:66407410-66407432 CAAAAGTTGTACGTGAGAGAAGG + Intergenic
1011149176 6:84250283-84250305 CATAGGATATACATCAAAGATGG + Intergenic
1011292938 6:85795372-85795394 CAAAGGAGGCACTTCAGAGATGG + Intergenic
1013534955 6:111055452-111055474 CACAGGATGTAGCACAGAGTAGG - Intergenic
1015278914 6:131411187-131411209 AACAGGATGTACCTCAGATTGGG + Intergenic
1017960776 6:159218761-159218783 CAAAGGAGGCCCCACAGAGAAGG + Intronic
1018153286 6:160960903-160960925 CAAAGGTTAGTCCTCAGAGATGG + Intergenic
1018567265 6:165168028-165168050 GCAATGCTGTACCTCAGAGATGG - Intergenic
1018747333 6:166772691-166772713 CAAAGGAAGTGCCCCACAGATGG + Intronic
1020356399 7:7280366-7280388 CAAAGGATGTGACTCAGGGTAGG + Intergenic
1022792171 7:33699919-33699941 CAAGGGATGTACCTGAGACAAGG + Intergenic
1023145558 7:37147301-37147323 AAGAGGATGTCCATCAGAGAGGG - Intronic
1024419316 7:49143557-49143579 CAAAGGTTGAACCACAAAGATGG - Intergenic
1026071720 7:67127639-67127661 GAAAGGAAGAACATCAGAGAAGG - Intronic
1026705180 7:72684627-72684649 GAAAGGAAGAACATCAGAGAAGG + Intronic
1027830862 7:83175764-83175786 CAAAGGATATGGCTCTGAGAAGG - Intergenic
1027990369 7:85352011-85352033 CAAATTAGGTACCTCAGAAAAGG + Intergenic
1029040328 7:97566428-97566450 CAAAGGATCTAATTCAAAGAAGG + Intergenic
1030438000 7:109550569-109550591 CAAAGGTTTTACAGCAGAGAAGG - Intergenic
1032146587 7:129387974-129387996 CAAAGGGTCTACCTCTGCGAGGG - Intronic
1032566803 7:132954946-132954968 CATACCATGTACCGCAGAGATGG + Intronic
1033945539 7:146713036-146713058 CAAATGAAGTAATTCAGAGAGGG - Intronic
1034336528 7:150327304-150327326 CAATAGATGCACCCCAGAGATGG + Intronic
1034412327 7:150947889-150947911 CAGAGAATGGGCCTCAGAGAGGG + Intronic
1034618959 7:152442342-152442364 GAAAGCCTGTACCTCAGAGTAGG - Intergenic
1036202432 8:6780517-6780539 CAGAGGATGGACCTGAGAGATGG - Intergenic
1036434535 8:8721212-8721234 CAAGGTGTGTACCTCAGACATGG + Intergenic
1037638454 8:20721364-20721386 CAAATGATGTAGGTCAGACATGG - Intergenic
1037795404 8:21989349-21989371 CAGAGTATGTACCTATGAGATGG - Intronic
1040367989 8:46739498-46739520 CCTATAATGTACCTCAGAGAAGG + Intergenic
1040811421 8:51458204-51458226 CAAATGGTGCACCTCAGAGAAGG - Intronic
1041430287 8:57773815-57773837 CACTGGAAGTATCTCAGAGATGG - Intergenic
1044375211 8:91462228-91462250 CAAATGATGTCCCTGAGTGATGG - Intergenic
1044795201 8:95889906-95889928 AAAAGATTGTACCTCATAGATGG - Intergenic
1045482922 8:102607216-102607238 CAAAGGGTATATCTGAGAGAGGG + Intergenic
1052750744 9:32487270-32487292 CAATGGATGAACCTCAGAAGTGG - Intronic
1053471387 9:38348129-38348151 CACAGGATGTACCCCATAGAAGG + Intergenic
1053616736 9:39775093-39775115 CAAAAGATATTCCTCAGAGAAGG + Intergenic
1053874903 9:42534410-42534432 CAAAAGATATTCCTCAGAGAAGG + Intergenic
1053897714 9:42760180-42760202 CAAAAGATATTCCTCAGAGAAGG - Intergenic
1054236781 9:62567290-62567312 CAAAAGATATTCCTCAGAGAAGG - Intergenic
1054267432 9:62932345-62932367 CAAAAGATATTCCTCAGAGAAGG - Intergenic
1054550918 9:66601798-66601820 CAAAAGATATTCCTCAGAGAAGG - Intergenic
1056295794 9:85191843-85191865 CAAAGGAGGTAGCAGAGAGAGGG + Intergenic
1056413965 9:86358670-86358692 CAAAGTATGAAACTCAAAGAAGG + Intergenic
1059532883 9:115053574-115053596 CAAAGGATATTCCTCAGATAGGG - Intronic
1060760231 9:126240875-126240897 GAGAGGGGGTACCTCAGAGATGG - Intergenic
1185936686 X:4264393-4264415 CAAAAGATGAACCACAGAGGTGG + Intergenic
1187743444 X:22382429-22382451 GAAAGGATCTACGTCAGAGAAGG - Intergenic
1188019769 X:25144437-25144459 CGAAGGATGGTTCTCAGAGAAGG + Intergenic
1188698721 X:33232253-33232275 GAAAGGAAGTACATTAGAGAAGG + Intronic
1189162387 X:38822939-38822961 TAAGGGATGTATCTCACAGAGGG + Intergenic
1192791868 X:74390191-74390213 CAAAGGAAGAACATTAGAGAGGG + Intergenic
1193932325 X:87569062-87569084 CAAATCATGTACCTGATAGAGGG + Intronic
1196001435 X:110791294-110791316 GCAAGCATCTACCTCAGAGATGG + Intronic
1196465307 X:115966512-115966534 CAAATGATGTAACTCAGAAATGG + Intergenic