ID: 1087260050

View in Genome Browser
Species Human (GRCh38)
Location 11:96001261-96001283
Sequence CCTTCAGTGGGAGAGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087260044_1087260050 1 Left 1087260044 11:96001237-96001259 CCAGTTCCATGAGTGAGAAAGCA 0: 1
1: 0
2: 1
3: 14
4: 197
Right 1087260050 11:96001261-96001283 CCTTCAGTGGGAGAGTGGCCAGG 0: 1
1: 1
2: 1
3: 21
4: 228
1087260045_1087260050 -5 Left 1087260045 11:96001243-96001265 CCATGAGTGAGAAAGCAGCCTTC 0: 1
1: 0
2: 3
3: 23
4: 269
Right 1087260050 11:96001261-96001283 CCTTCAGTGGGAGAGTGGCCAGG 0: 1
1: 1
2: 1
3: 21
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087260050 Original CRISPR CCTTCAGTGGGAGAGTGGCC AGG Intronic