ID: 1087264618

View in Genome Browser
Species Human (GRCh38)
Location 11:96046610-96046632
Sequence TGAACTCTGCTTACATCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087264616_1087264618 -6 Left 1087264616 11:96046593-96046615 CCCTGGATTTGAACAGGTGAACT 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1087264618 11:96046610-96046632 TGAACTCTGCTTACATCAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 174
1087264615_1087264618 -5 Left 1087264615 11:96046592-96046614 CCCCTGGATTTGAACAGGTGAAC 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1087264618 11:96046610-96046632 TGAACTCTGCTTACATCAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 174
1087264617_1087264618 -7 Left 1087264617 11:96046594-96046616 CCTGGATTTGAACAGGTGAACTC 0: 1
1: 0
2: 2
3: 15
4: 140
Right 1087264618 11:96046610-96046632 TGAACTCTGCTTACATCAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087264618 Original CRISPR TGAACTCTGCTTACATCAGA AGG Intronic
901708071 1:11091632-11091654 TTAACTCTGCTAACCTCAAAAGG - Intronic
906391893 1:45424737-45424759 TGAACTATCCTTACATCCCAGGG - Intronic
906872061 1:49493949-49493971 TGATCTTTGCTGCCATCAGAGGG - Intronic
908957571 1:69652121-69652143 TCAACTCTCCTTACATCTCAAGG + Intronic
910413496 1:86971494-86971516 TGTACTCAGCTTAGGTCAGATGG + Intronic
916269601 1:162926486-162926508 TGAGCTGTGCCCACATCAGAAGG - Intergenic
916399447 1:164430410-164430432 TGATATCTGCCTATATCAGATGG + Intergenic
917382126 1:174423074-174423096 TGAATACTGCTTATATCAGATGG - Intronic
918683268 1:187382456-187382478 TGAAGTCTGGATTCATCAGAAGG - Intergenic
919237518 1:194865646-194865668 TCACCTCTGCATAAATCAGAGGG - Intergenic
919503422 1:198367530-198367552 TGTACTCACCATACATCAGAGGG + Intergenic
922244184 1:223778742-223778764 TGAACTCTGCTAACCTGAGTGGG - Intergenic
923504812 1:234596056-234596078 TGAGCTATGCATACATCTGAGGG + Intergenic
923923668 1:238598844-238598866 TGAACTCTGCTTCCTGCACAGGG - Intergenic
924573957 1:245262224-245262246 TGAACTTTTCTTCCATCAGCCGG - Intronic
924752650 1:246909450-246909472 TGAAATCTGCTACCATCAAAGGG + Intronic
1064325069 10:14342263-14342285 TCAAATCTCCTTACAACAGATGG - Intronic
1067933843 10:50591173-50591195 TAAACCCTGCTTACCTCACAGGG - Intronic
1069127021 10:64648671-64648693 TGAAAACTGCTTAAATTAGATGG + Intergenic
1069462060 10:68604787-68604809 AGAACTGTGATTACATAAGATGG + Intronic
1071112788 10:82180561-82180583 TGAACTATCCTTTCATCATAGGG + Intronic
1071667543 10:87575695-87575717 TGAACTATCCTTACATCCCAGGG + Intergenic
1071979066 10:90985463-90985485 TCAGCTCTGCTTACCTCACATGG - Intergenic
1072474688 10:95749002-95749024 TGATGTGTGCTTCCATCAGAAGG + Intronic
1077767008 11:5169875-5169897 AGAACCCTGCTTACCTCTGATGG - Intronic
1078614866 11:12855637-12855659 TGAAGTCTGTTTTCATCAGCTGG - Intronic
1081457810 11:43242655-43242677 TGAACTCTGCTTAGTTCAGCTGG - Intergenic
1082971274 11:59024028-59024050 TGAACTATGCTTGCATCCCAAGG + Intronic
1086163004 11:83744349-83744371 TGCACTCTGATTAAATCATATGG + Intronic
1087020824 11:93601365-93601387 TGTACTCTGGTTATATAAGAGGG + Intergenic
1087264618 11:96046610-96046632 TGAACTCTGCTTACATCAGAAGG + Intronic
1087625475 11:100590975-100590997 TGAACTCAGCTCTCATCAGGCGG - Intergenic
1087916901 11:103821593-103821615 TGTTCTCTGCTTGCATCTGAAGG - Intergenic
1094095972 12:26705303-26705325 ACAAATCTGCTTACATCAGCTGG - Intronic
1094163236 12:27414328-27414350 TGTATTCTGCTGCCATCAGATGG - Intronic
1094687641 12:32734499-32734521 TCAACTCTGGTTAAAACAGATGG + Intronic
1095919862 12:47518264-47518286 TGATCTGTGATTACACCAGACGG - Intergenic
1097295285 12:57956427-57956449 TGACATCTGCTTATATCAGTGGG + Intronic
1098508844 12:71287471-71287493 TGAACTATCCTTACATCCCAGGG + Intronic
1099109148 12:78535447-78535469 TGAATGTTGTTTACATCAGAGGG - Intergenic
1100791201 12:98132120-98132142 TGAACTGTGCTCATATGAGATGG - Intergenic
1105116604 13:16707733-16707755 TGAACTCAGCTAACAGCAGGTGG + Intergenic
1111544626 13:89715720-89715742 TGAAGTCTGCTTTTATCAGCTGG + Intergenic
1111618787 13:90696559-90696581 TGTCTTCTGCTTACATCAAATGG + Intergenic
1113904299 13:113812117-113812139 TGGGCTCTGCTCACATCAAATGG + Exonic
1115076868 14:29403325-29403347 TGATCTCTACTGACATCATAGGG + Intergenic
1115272337 14:31567724-31567746 TGACCTCTGCTTACTTAGGATGG + Intronic
1115875227 14:37853909-37853931 TGAACCCTGCTCATCTCAGAGGG + Intronic
1117231720 14:53725669-53725691 TATACCCTGCTTCCATCAGAGGG + Intergenic
1120680866 14:87479136-87479158 TGAAGTCTTCTTACAGGAGACGG - Intergenic
1120994903 14:90409652-90409674 TGAACTCTGATTAAATCAAGTGG + Intergenic
1121438984 14:93936982-93937004 TCTACTCTGCACACATCAGAGGG + Intronic
1125328002 15:38556197-38556219 TGATCTCTGGTTAGAACAGAAGG + Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1134332308 16:13262437-13262459 TGCACTCTGTCTATATCAGAAGG + Intergenic
1138025616 16:53520215-53520237 GGCACGCTGCTTACCTCAGAAGG - Intergenic
1139079022 16:63491404-63491426 TGAACTCTTGTTATATCACATGG - Intergenic
1139269284 16:65666820-65666842 AGAATTCTGCTTACAGCTGAGGG - Intergenic
1140157081 16:72441726-72441748 TGAACTATGCTCATATAAGATGG - Intergenic
1140965167 16:79958931-79958953 TGTCATCTGCTTACATTAGATGG - Intergenic
1141666415 16:85467857-85467879 TGAAGTGTGCTTACAGCATAGGG + Intergenic
1145837493 17:27965561-27965583 TGAACTTTGCTTTCAACAGTCGG - Intergenic
1148980626 17:51571376-51571398 TGAACTCAGCTGACACCACATGG + Intergenic
1150501316 17:65653547-65653569 TGCACTCTTCTTACACCAGATGG - Intronic
1150647770 17:66990495-66990517 AGAACTCTGCCTACCACAGATGG + Intronic
1152194264 17:78907485-78907507 TGAACTGTGCCCACATGAGATGG - Intronic
1153021977 18:637450-637472 TGGACTCTGCTTTCAAAAGAAGG - Intronic
1153270903 18:3320182-3320204 TGCCCTCTGCTTACATCTGTTGG - Intergenic
1159710735 18:71755944-71755966 TGAACTTTCCTTGCATCACAGGG - Intronic
1160277711 18:77453169-77453191 TGAACATTGTTTACATCATAAGG + Intergenic
1160587848 18:79922722-79922744 TGACCTCTCCTTACAGCAGCAGG + Intronic
1163322010 19:16580340-16580362 TGAACTCTGCTAACACCTGAAGG - Intronic
1163322317 19:16581983-16582005 TGAACTCTGCCAACACCTGAAGG + Intronic
1164241594 19:23394391-23394413 TAAGCTCTGATTACATAAGAAGG + Intronic
1166642520 19:44506146-44506168 AGATCTCTGCTTCCATTAGACGG + Exonic
924986643 2:277077-277099 TGAACTGTACTTACATAATAGGG - Exonic
925715866 2:6783674-6783696 TGAACTCTTCATTCAACAGAGGG - Intergenic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
929010232 2:37434815-37434837 TGCAATCTGCTTCCTTCAGATGG + Intergenic
929049371 2:37822736-37822758 TGAACTCTAATTACATGACATGG - Intergenic
930945603 2:57070542-57070564 TTAAATCTGATTACATTAGATGG + Intergenic
931609189 2:64080534-64080556 TGACCTCTGCTTATTTCAGAGGG + Intergenic
931927463 2:67088824-67088846 TGAACTCTGATTTCAACAGGAGG + Intergenic
933001119 2:76924923-76924945 GGAACTGTGCTTAAGTCAGAAGG - Intronic
933626733 2:84609584-84609606 TGAACCATGCTTATATAAGATGG - Intronic
934092831 2:88568734-88568756 TAATCTATGCTTACATCAGCAGG - Intronic
939501064 2:142985128-142985150 TGAACTCTACTTACATGACTGGG + Exonic
939873304 2:147548675-147548697 CTAACTCAGCTTTCATCAGAGGG + Intergenic
943138594 2:183948980-183949002 TGACATCTGCTTACATCTGTTGG + Intergenic
943506851 2:188771246-188771268 TGAACTCTCCTTACATCACCCGG - Intronic
943678347 2:190740492-190740514 TGAACTTTACTTACATGAAAGGG - Intergenic
947457226 2:230265821-230265843 TGCAATCTGCTTCCTTCAGAGGG + Intronic
1169919937 20:10724415-10724437 TGAATTCAGTTTAAATCAGATGG - Intergenic
1170140513 20:13121404-13121426 TGACCCCTGCTTACTTCAAAGGG - Intronic
1170634608 20:18093522-18093544 TGATCTCTGCTTGCATAGGAGGG + Intergenic
1171096307 20:22335432-22335454 TGATGTCTGCTTACATCACATGG - Intergenic
1171165472 20:22966815-22966837 AGAAGTCTGCTTCCTTCAGAGGG - Intergenic
1173080097 20:39858371-39858393 TGAAATCTGCTTCCATCTCAAGG + Intergenic
1177395982 21:20536832-20536854 TGAACTCAGCTTTCATTTGAGGG - Intergenic
1177626062 21:23661229-23661251 TGAATTCTGCTTAAATCACCAGG + Intergenic
1178104239 21:29299932-29299954 TGAACACCCTTTACATCAGAGGG + Intronic
1181496530 22:23290390-23290412 TGAACTCTGCTTAAATCCAGTGG - Exonic
949711299 3:6873931-6873953 TGAAATATTCATACATCAGAAGG + Intronic
951922071 3:27866240-27866262 TGAACTATCCTTGCATCTGAGGG + Intergenic
954585121 3:51727936-51727958 TGAACTCTTCTCACATCCCAGGG + Intergenic
958866999 3:99512572-99512594 TGATCATTGCTTACATCATATGG - Intergenic
959039525 3:101405156-101405178 TGTACTCTGCTTCCTTCAGGAGG - Intronic
959437098 3:106329421-106329443 TAAACTCTCATTACATCAGGTGG - Intergenic
965266638 3:166552162-166552184 TGCCCTCTGCTGAAATCAGATGG - Intergenic
965854318 3:173069806-173069828 TGAACTATCCTTGCATCACAGGG - Intronic
967459817 3:189732624-189732646 TCAACTATGCTTCCCTCAGAAGG - Intronic
969560665 4:7945513-7945535 AAAACTCTCTTTACATCAGAAGG - Intergenic
969974974 4:11089446-11089468 TTAACTCAGCTGACATCAGAAGG + Intergenic
970714919 4:18910548-18910570 TGAACTATACTTACATCCCAGGG - Intergenic
971650161 4:29261312-29261334 TGTACTCTGCATATACCAGATGG - Intergenic
973883225 4:55294758-55294780 AGAACTCTGCTTTCTGCAGAAGG + Intergenic
974254708 4:59434182-59434204 TGAACTCTGTTTCCCTGAGATGG + Intergenic
977746658 4:100558008-100558030 AGAAGTCTGCTTCCTTCAGAGGG - Intronic
978276188 4:106953386-106953408 TGAACAGAGTTTACATCAGAAGG - Intronic
980153170 4:129073211-129073233 TGCAATCTGCTTCCTTCAGAGGG + Intronic
980817628 4:137968487-137968509 TGAACTGTGCTTTTATCAGGAGG + Intergenic
980907366 4:138961519-138961541 TGATATCTGCCAACATCAGATGG + Intergenic
983154768 4:164333533-164333555 TGAACTGTGCCCACATAAGATGG + Intronic
983174789 4:164575815-164575837 TGTACTCTACTGACATCTGAGGG - Intergenic
984069194 4:175091597-175091619 TGAATTCTGCTTAATTCAGGTGG + Intergenic
986906155 5:12494815-12494837 TGAACTATGCTTGCATCTCAGGG - Intergenic
986931480 5:12828295-12828317 TGAAATCTGATTATATCACATGG + Intergenic
987555546 5:19442186-19442208 TTAATTCTGCTTACAACAAAGGG + Intergenic
990712959 5:58605186-58605208 AGCAGTCTGCTTCCATCAGAGGG + Intronic
993362239 5:86991832-86991854 TGAACTCTGCTTAAATCCAGTGG + Intergenic
996307326 5:122062759-122062781 TGAAATCTGGTAACATGAGAGGG - Intronic
998387434 5:141765862-141765884 AGGACTCTGCCTACAGCAGAGGG - Intergenic
998828882 5:146136199-146136221 TTAACTATGCTGATATCAGAAGG + Intronic
998835282 5:146197323-146197345 TGGACTCTTCTAACATCAGAAGG + Intergenic
999489059 5:152030736-152030758 TCAACATTGTTTACATCAGAAGG + Intergenic
1001177269 5:169481632-169481654 TGCAATCTGCTTCCTTCAGAGGG + Intergenic
1003288224 6:4753618-4753640 TGAACTGTGCTTACATGAAGGGG + Intronic
1004145320 6:13060595-13060617 TGAACTCTACTGCAATCAGAGGG + Intronic
1005736357 6:28751410-28751432 TAGACTCTGCTGACATCAAAAGG + Intergenic
1005740317 6:28785149-28785171 TAGACTCTGCTGACATCAAAAGG + Intergenic
1006383337 6:33714274-33714296 TGAACTCTCCTTACCTCAGCGGG - Intergenic
1009688895 6:67000477-67000499 TGAACTATCCTTTCATCACAGGG - Intergenic
1009766161 6:68078788-68078810 TTAACTCTGCTTAAACAAGAAGG + Intergenic
1013543767 6:111135873-111135895 TCAGCTCTGCTCACAGCAGAGGG + Intronic
1013753444 6:113433924-113433946 TGAATTCTGTTTATAACAGAAGG - Intergenic
1014131773 6:117843104-117843126 TGAACCATACTTACATCACAAGG - Intergenic
1016199423 6:141389558-141389580 TGAACTGTGCTCATATAAGATGG - Intergenic
1018424733 6:163670134-163670156 TGAACTGTAATTTCATCAGATGG - Intergenic
1024169708 7:46771709-46771731 TGAAAGCTGCTTACATTAAAAGG + Intergenic
1030390460 7:108921056-108921078 AGCACTCTGCTTTCTTCAGAGGG + Intergenic
1032151877 7:129435647-129435669 TTAACACTGCCTACCTCAGAAGG + Intronic
1032418574 7:131758768-131758790 TGAACTCTACCTACATTATAGGG - Intergenic
1034705607 7:153140160-153140182 AGCAATCTGCTTCCATCAGAGGG + Intergenic
1037704098 8:21302338-21302360 TGAACTATGCTTACATCCCAGGG + Intergenic
1039266743 8:35832980-35833002 TGAACCATGCTAACATAAGATGG + Intergenic
1040996351 8:53406764-53406786 TGAGCTCTGTTTTCATCAGATGG + Intergenic
1041411773 8:57564124-57564146 CAAACTCATCTTACATCAGAAGG + Intergenic
1042618858 8:70681560-70681582 TGAACTCAGTTTTCATGAGAAGG + Intronic
1043715222 8:83475371-83475393 TGAACTGTGCTTACATCCCAGGG - Intergenic
1045196115 8:99932440-99932462 TGAACTATCCTTACATCCCAGGG + Intergenic
1046057972 8:109100970-109100992 TGATCTCTGCTTACCTCACTAGG - Intronic
1048303987 8:133270870-133270892 TGACCTCAGCTTACAACTGATGG - Intronic
1048523563 8:135179763-135179785 ACAATGCTGCTTACATCAGAAGG + Intergenic
1048541037 8:135342318-135342340 TGAACTCTGCCTACTGCAAAAGG + Intergenic
1049834790 8:144728276-144728298 TGAACTCTGCCTGTATGAGACGG - Intronic
1051084121 9:13328040-13328062 TGAACTCTCCTTTCATCCCAGGG - Intergenic
1052066487 9:24027770-24027792 TTACCCCTGCTTACCTCAGAGGG + Intergenic
1055303096 9:74902598-74902620 TGATCTGTTCTTTCATCAGATGG + Intergenic
1058515704 9:105772225-105772247 TAAACTCTGCATACATAAGAAGG - Intronic
1058589918 9:106553930-106553952 TGAACTGTCCTTGCATCACAGGG - Intergenic
1059914514 9:119084348-119084370 TGACCTCTGTTGACATCAGATGG - Intergenic
1188605107 X:32018533-32018555 TAAACTCTGCTTACAACCTAAGG + Intronic
1188911199 X:35849581-35849603 TGAACACTGCCTCCTTCAGAAGG - Intergenic
1189023157 X:37363716-37363738 TGAATTCTGCTTCCAAAAGAAGG + Intronic
1189300877 X:39951487-39951509 TGAACTCTGCCCACATCCCAAGG - Intergenic
1190895608 X:54614791-54614813 TGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1191790155 X:64962231-64962253 TGATCTCTCCTCACATCACAGGG - Intronic
1193265713 X:79466097-79466119 CGAAGTCTGCTGACATCTGATGG - Intergenic
1196322764 X:114361976-114361998 TGAGTTCTGCTGACAACAGAAGG - Intergenic
1196890960 X:120290674-120290696 TGATCTCAGCTAAAATCAGAAGG + Intronic
1198111791 X:133508698-133508720 AGAACTCAGGATACATCAGATGG + Intergenic
1198189877 X:134292039-134292061 TGTATTCTGCTGCCATCAGATGG + Intergenic
1199111770 X:143943940-143943962 TAAACCCTGCTTATATCTGAGGG - Intergenic
1201995588 Y:20084499-20084521 TTAACTCTGGACACATCAGAAGG - Intergenic
1201996917 Y:20102067-20102089 GAAACTCTGCGCACATCAGAAGG - Intergenic
1202003057 Y:20184220-20184242 GAAACTCTGCGCACATCAGAAGG - Intergenic
1202006411 Y:20278281-20278303 GAAACTCTGCACACATCAGAAGG - Intergenic
1202006489 Y:20279278-20279300 GAAACTCTGCTCACATCTGAAGG - Intergenic
1203336786 Y_KI270740v1_random:11086-11108 TTAACTCTGGACACATCAGAAGG - Intergenic