ID: 1087266148

View in Genome Browser
Species Human (GRCh38)
Location 11:96063379-96063401
Sequence CTGTGGGTACAGTGCTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087266148_1087266155 6 Left 1087266148 11:96063379-96063401 CCTTTTTAGCACTGTACCCACAG 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1087266155 11:96063408-96063430 GGGCATGTAGCTTGAATGCATGG 0: 1
1: 0
2: 0
3: 10
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087266148 Original CRISPR CTGTGGGTACAGTGCTAAAA AGG (reversed) Intronic
900691442 1:3982921-3982943 CTGTGGGTACAGGGAGAAGATGG + Intergenic
902460233 1:16569410-16569432 CTCTGGGGACAGAGCAAAAATGG + Intronic
912635140 1:111284909-111284931 CTGTGGCTCCAGGGCTATAATGG - Intergenic
913605184 1:120459171-120459193 CTCTGGGGACAGAGCAAAAATGG - Intergenic
913642050 1:120821908-120821930 CTCTGGGGACAGAGCAAAAATGG - Intronic
913989982 1:143602123-143602145 CTCTGGGGACAGAGCAAAAATGG + Intergenic
914189378 1:145395315-145395337 CTCTGGGGACAGAGCAAAAATGG + Intronic
914276430 1:146128456-146128478 CTCTGGGGACAGAGCAAAAATGG + Intronic
914366387 1:146982732-146982754 CTCTGGGGACAGAGCAAAAATGG - Intronic
914486060 1:148110715-148110737 CTCTGGGGACAGAGCAAAAATGG + Intronic
914537474 1:148579411-148579433 CTCTGGGGACAGAGCAAAAATGG + Intronic
914586392 1:149065863-149065885 CTCTGGGGACAGAGCAAAAATGG + Intronic
914628452 1:149485934-149485956 CTCTGGGGACAGAGCAAAAATGG - Intergenic
916531801 1:165663655-165663677 GTGAGGTTACTGTGCTAAAAGGG + Intronic
916870413 1:168907957-168907979 CTGTGGTTTCAGCTCTAAAAGGG + Intergenic
917340504 1:173972560-173972582 CTGTGCGTACAGTGGTACATGGG - Exonic
917425990 1:174914555-174914577 CTGTAGGAACAGTCCTACAAAGG + Intronic
922358513 1:224799109-224799131 AGGTGGGCACAGTGCTAAAGGGG + Intergenic
923041458 1:230322861-230322883 CTGGGTGTACAGTGGTGAAATGG - Intronic
1063212032 10:3889319-3889341 CTCTGGGTACAGAAGTAAAAAGG - Intergenic
1065324175 10:24536063-24536085 CTGTGTCTACAGGGCTAAAAAGG - Intronic
1065426880 10:25615380-25615402 CAGTGGGTAGAGTGCTAAACAGG - Intergenic
1066135607 10:32442787-32442809 CAGTGAGTAAAGTGCTCAAAAGG - Intergenic
1071232366 10:83603321-83603343 CTGTGAGAACAGTGATGAAAAGG + Intergenic
1071679171 10:87687184-87687206 CTGTGGGGATAGTGGTGAAAGGG - Intronic
1071710100 10:88041627-88041649 CTGTAGGTACAGTGGTGAACAGG - Intergenic
1072187297 10:93052168-93052190 CTGTGGGTTCACTTTTAAAAAGG + Intronic
1075909032 10:126107629-126107651 CTGTGGGGACAGTGTGAGAAGGG - Intronic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1077620629 11:3719411-3719433 CTGTGGGTGAAGGGCTAAATAGG - Exonic
1077900386 11:6482551-6482573 CTGTGTGTACAATTTTAAAACGG + Exonic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079814885 11:25043041-25043063 CTGTGGGAATAGTTCTAAGATGG + Intronic
1080077819 11:28172560-28172582 CAGTTAGTAGAGTGCTAAAACGG - Intronic
1080132174 11:28809307-28809329 CTTTGTGTAAAGTGCTAGAATGG - Intergenic
1087266148 11:96063379-96063401 CTGTGGGTACAGTGCTAAAAAGG - Intronic
1087454041 11:98361065-98361087 GTGTGGGTACAGGAATAAAAGGG + Intergenic
1093738278 12:22650301-22650323 CTTTCAGTACAGTGTTAAAAAGG + Intronic
1098362103 12:69664986-69665008 CTGTGAGTCCTCTGCTAAAAGGG + Intronic
1100799306 12:98214618-98214640 CTTTGGAGACAGTTCTAAAATGG - Intergenic
1102612966 12:114128800-114128822 CTGTGGTCATAGTGCTAGAATGG - Intergenic
1103182353 12:118924696-118924718 CTGTGGATACAGTGGTGCAAAGG + Intergenic
1105511056 13:21051988-21052010 CTGGGTGTGCAGTGCTAAAGTGG + Intronic
1109756477 13:66767538-66767560 CTGTAGGTACACTGCTATTAAGG - Intronic
1110282011 13:73704807-73704829 CTGGGGATACAGTGGTAAGAAGG - Intronic
1111733366 13:92104641-92104663 TGATGGGTAGAGTGCTAAAAGGG + Intronic
1112144761 13:96686357-96686379 CTGTGTAAACAGTGCTGAAATGG + Intronic
1112849789 13:103691418-103691440 CTTGGGGTAAACTGCTAAAATGG - Intergenic
1114033541 14:18597938-18597960 CTGTGGGGTCAGTGGTAATATGG - Intergenic
1114078329 14:19177134-19177156 CTGTGGGGTCAGTGGTAATATGG - Intergenic
1114125160 14:19717413-19717435 CTGTGGGGTCAGTGGTAATATGG + Intergenic
1114187174 14:20411596-20411618 TTGTGGGAACAAGGCTAAAAGGG - Intronic
1114440172 14:22739926-22739948 CTTTGGGTACACATCTAAAAAGG - Intergenic
1114619153 14:24084633-24084655 CTGTGGGCACAGAGCCCAAAGGG + Intronic
1115201435 14:30858538-30858560 CTGTTGGTGCATTGCTATAACGG + Intergenic
1116732600 14:48643465-48643487 ATGCTGGTACAGTGATAAAATGG + Intergenic
1121638139 14:95467479-95467501 CTCTGGCTACAGTGCTAGCAGGG + Intronic
1121781397 14:96624626-96624648 CTGTGGGGCCAGTGCAGAAACGG + Intergenic
1124048683 15:26175300-26175322 CTGTGGGGATAGTTCCAAAAAGG + Intergenic
1129944181 15:79524766-79524788 CTGTGAGTACAGTTCTCAGATGG - Intergenic
1131273207 15:90959408-90959430 CTGTGGGTGCAGTTGAAAAAGGG + Intronic
1133329353 16:4962361-4962383 CTGTGGGTAGAGTGAAAAAAAGG + Intronic
1135001831 16:18782917-18782939 CTGTGGCTACACTGCTGTAAAGG + Exonic
1135626420 16:23999002-23999024 CTCTGGATACAGTTCCAAAAAGG + Intronic
1147928756 17:43962908-43962930 CTGTGGGTTCAGTACCATAAGGG - Intronic
1154080801 18:11254467-11254489 CTTAAGGGACAGTGCTAAAAAGG - Intergenic
1156228982 18:35135825-35135847 CTGTGTGTACAGAGCTGAGATGG + Intronic
1159196948 18:65128345-65128367 CTGCTGGTAAAGTGCTAAAATGG - Intergenic
1160393839 18:78557993-78558015 CTGTGTGTCCAGTCCTAAACAGG - Intergenic
1163587524 19:18172255-18172277 CTGAGGGTTCAATGATAAAATGG + Intronic
1164650443 19:29887382-29887404 CTGTGGGTCCATTGCTAATGTGG - Intergenic
1168330101 19:55563204-55563226 CTGTGGGCACAATTCTAAGAGGG - Intergenic
1202676665 1_KI270711v1_random:13138-13160 CTCTGGGGACAGAGCAAAAATGG + Intergenic
926103777 2:10137580-10137602 CTCTGGGTACTATGCTAGAAAGG + Intergenic
926839379 2:17061768-17061790 CATTGGGTAGAGTGCTGAAAAGG + Intergenic
927828655 2:26328753-26328775 CTGTGGATAAAATACTAAAAAGG - Intronic
927862371 2:26568191-26568213 CTGTGGGGACAGGGCCAAGAGGG - Intronic
930659818 2:54042330-54042352 CTGGGGGTACAGTTCTTATATGG - Intronic
931086745 2:58840042-58840064 CTGTGGCTGCATTGCTTAAAAGG + Intergenic
931321872 2:61180086-61180108 CTGTGGGTTCAGTTCTCCAATGG + Intronic
931579240 2:63754941-63754963 TTGTGGGTACAGTCATAAGAAGG + Intronic
933706485 2:85294730-85294752 CTGTATGTACAGTTGTAAAAGGG - Intronic
937758226 2:125566650-125566672 CTGAGAGTTCAGTGCTATAAAGG - Intergenic
938635066 2:133215112-133215134 CTGTGAGTACACTTCTAAGAAGG + Intronic
945261686 2:207849545-207849567 CTGTGGTTACTCTTCTAAAAAGG - Intronic
1169159608 20:3365690-3365712 CTGTGGGTAAAATGCTATCACGG - Intronic
1173041206 20:39464728-39464750 CTGTGGGTAGAGGGGAAAAAAGG - Intergenic
1180457655 22:15524997-15525019 CTGTGGGGTCAGTGGTAATATGG - Intergenic
1181344305 22:22206956-22206978 CTGTGGGTTCAGAGCCCAAAGGG - Intergenic
1181809600 22:25395359-25395381 CTGTGTCTACAGTGCTGAGAAGG + Intronic
1182771504 22:32800051-32800073 CTATGGCTAAAGTGCTCAAAGGG + Intronic
1183126489 22:35786863-35786885 GGATGGGTACAGTGCTAGAAAGG - Intronic
1185352986 22:50347691-50347713 CAGTGGGTACAGTGACAAAGAGG - Intronic
952057084 3:29460776-29460798 ATGTGGGAACAGTGCTAGAGAGG + Intronic
952552670 3:34496748-34496770 ATGTGGGCACAGTGCTTGAAGGG + Intergenic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
955788480 3:62564524-62564546 CAGTTTGTACAGTGCTAAAATGG + Intronic
956878732 3:73489376-73489398 CTAAGGATACAGTGCTAAACAGG - Intronic
958757277 3:98264641-98264663 CTGTGGTTACAGTGGTTACAAGG - Exonic
961197213 3:125012812-125012834 ATGTGGGTACACTGGTCAAAGGG + Exonic
961973293 3:130993348-130993370 CAGTGTGAACAGTGCTTAAAAGG + Intronic
964416127 3:156450102-156450124 CTTTGGGCACAAAGCTAAAATGG - Intronic
965326329 3:167309158-167309180 CTCTGGGTACAGTGCTTATGGGG + Intronic
965854995 3:173076785-173076807 TTTAGGGTACAGTGATAAAAGGG - Intronic
966461013 3:180176276-180176298 CTTTAGGTAGAGTGCTAATAAGG + Intergenic
967469323 3:189843699-189843721 ATGTGGATACAGTCTTAAAATGG + Intronic
972388263 4:38588532-38588554 CTGGGGGTACAGCAATAAAAAGG + Intergenic
975784371 4:77872242-77872264 CAGTGGGTTCTGTTCTAAAAAGG - Intronic
976634334 4:87272754-87272776 CTGTGGATACAGTGGTAAATAGG + Intergenic
978267841 4:106848467-106848489 ATGAGGGTACATTACTAAAAAGG + Intergenic
979797713 4:124867711-124867733 GTGTGGATACAGTGGAAAAAGGG + Intergenic
981852583 4:149248635-149248657 CAGTTGGTACAGTGCTAATAAGG + Intergenic
982088066 4:151856240-151856262 CTGGGGATACAGTGATGAAAAGG + Intergenic
984914141 4:184705414-184705436 CTGTGGGTGTAGTTATAAAAGGG + Intronic
985294536 4:188421710-188421732 CTGCGTCTACAGTGCTCAAAGGG - Intergenic
987520676 5:18979411-18979433 AGGTGAGTACAGTGCAAAAAAGG - Intergenic
990259781 5:54009834-54009856 CTGTTGGAATATTGCTAAAATGG - Intronic
995269373 5:110204097-110204119 CTGTGTATTCAGTCCTAAAAGGG - Intergenic
995440913 5:112191317-112191339 CTTTGGGTCCAGAGCTAACAAGG - Intronic
1001713926 5:173799326-173799348 CTGGGGGTAGAGTGCAAAGAGGG - Intergenic
1003750742 6:9052416-9052438 CTGTGTGAGCAGGGCTAAAAGGG + Intergenic
1005984901 6:30865422-30865444 TGGTGAGTACAGTGCTAAAGGGG + Intergenic
1007107510 6:39293978-39294000 CTGTGGGGACAGTGGCAGAAGGG - Intergenic
1007160408 6:39787372-39787394 CAGTGAGTAGAGTGCCAAAATGG - Intergenic
1010269035 6:73900716-73900738 CTGTGGGTAGAGCTCTAAATTGG - Intergenic
1011154804 6:84318916-84318938 CAGTGGGTAGAGTACTAGAAAGG - Intergenic
1012309152 6:97699656-97699678 CTGTGCGTACTTTGCTAAAATGG + Intergenic
1014594922 6:123323511-123323533 CTGTAGGTGTAGTTCTAAAATGG + Intronic
1020028533 7:4916768-4916790 CTGTGGACAAAGTGCAAAAATGG + Intronic
1021304717 7:19018549-19018571 CTGTGAAAACAGTGCTAAGACGG + Intergenic
1022252284 7:28620374-28620396 CTCAGTGAACAGTGCTAAAAGGG + Intronic
1022563672 7:31375221-31375243 CTGTGGGTACAGAGGTAAATGGG - Intergenic
1029432921 7:100543423-100543445 CTGTGGCTACGGTGCTAATGTGG - Intronic
1031470580 7:122164517-122164539 ATGTGAGTACAGTGATGAAATGG + Intergenic
1033846963 7:145445001-145445023 CTGTAGGCAAAGTGCCAAAATGG + Intergenic
1034343339 7:150371534-150371556 CTGGCGGTGCAGTGCTAAGAAGG - Exonic
1038378703 8:27070936-27070958 CTGAGGCTACAGAGGTAAAATGG + Intergenic
1039901444 8:41755646-41755668 CTGGAGGTGCAGTGCTAAGAAGG + Intronic
1040010851 8:42659889-42659911 CTGGGGTGACAGTGCTAGAAGGG + Intergenic
1040010861 8:42659946-42659968 CTGGGGTGACAGTGCTAAATGGG + Intergenic
1041254831 8:55971219-55971241 CTTTGAGGACAGGGCTAAAAAGG - Intronic
1042661864 8:71163289-71163311 CTGCTGGTACAGTCCAAAAAAGG + Intergenic
1046042917 8:108928966-108928988 CTGTGGATTCATTGCTAAAGTGG - Intergenic
1048999064 8:139813304-139813326 GTGTGGGGACAGTGCAAGAAGGG + Intronic
1050313353 9:4375342-4375364 GTGTGGGTACAGAGAGAAAAGGG + Intergenic
1053166596 9:35848271-35848293 CTGTGGGGGCAGGCCTAAAAAGG - Intronic
1054698976 9:68392941-68392963 CTATTTGTACAGTGCTAATAAGG - Intronic
1057224145 9:93278469-93278491 TTTTGGGTACAGTACAAAAAAGG + Intronic
1058577616 9:106420716-106420738 CTGTGTGTACAGTGGTGATAGGG - Intergenic
1058920268 9:109607621-109607643 CTGTGGGTAAAATGCTATCAAGG + Intergenic
1191897962 X:66013655-66013677 CTGCGGGCACTTTGCTAAAATGG - Intergenic
1195613555 X:106895187-106895209 CTGTGGGCACAGGGCTACCAGGG - Intronic
1196009689 X:110873487-110873509 CTGTGGAAACACTGCTGAAAAGG - Intergenic
1196610323 X:117707240-117707262 CTGGGGGTACCCTGCTAAGAAGG + Intergenic
1196903094 X:120406011-120406033 CATTGGGTAGAGTACTAAAAAGG - Intergenic
1198631147 X:138640112-138640134 ATGTGAGTACATTGGTAAAAAGG - Intronic