ID: 1087266948

View in Genome Browser
Species Human (GRCh38)
Location 11:96071061-96071083
Sequence AGGGGCCTTCTGAGTGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 6, 3: 31, 4: 312}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087266942_1087266948 3 Left 1087266942 11:96071035-96071057 CCCTCTAGATATTTACATGAAAG 0: 1
1: 0
2: 0
3: 29
4: 314
Right 1087266948 11:96071061-96071083 AGGGGCCTTCTGAGTGGAGAAGG 0: 1
1: 0
2: 6
3: 31
4: 312
1087266939_1087266948 30 Left 1087266939 11:96071008-96071030 CCTGCCAGGTGGAAATAGATGAG 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1087266948 11:96071061-96071083 AGGGGCCTTCTGAGTGGAGAAGG 0: 1
1: 0
2: 6
3: 31
4: 312
1087266941_1087266948 7 Left 1087266941 11:96071031-96071053 CCTTCCCTCTAGATATTTACATG 0: 1
1: 0
2: 0
3: 15
4: 260
Right 1087266948 11:96071061-96071083 AGGGGCCTTCTGAGTGGAGAAGG 0: 1
1: 0
2: 6
3: 31
4: 312
1087266940_1087266948 26 Left 1087266940 11:96071012-96071034 CCAGGTGGAAATAGATGAGCCTT 0: 1
1: 0
2: 0
3: 5
4: 126
Right 1087266948 11:96071061-96071083 AGGGGCCTTCTGAGTGGAGAAGG 0: 1
1: 0
2: 6
3: 31
4: 312
1087266943_1087266948 2 Left 1087266943 11:96071036-96071058 CCTCTAGATATTTACATGAAAGC 0: 1
1: 0
2: 1
3: 15
4: 154
Right 1087266948 11:96071061-96071083 AGGGGCCTTCTGAGTGGAGAAGG 0: 1
1: 0
2: 6
3: 31
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087266948 Original CRISPR AGGGGCCTTCTGAGTGGAGA AGG Intronic
900157286 1:1208345-1208367 AGGGGCCTTCTGCGGCGAGAGGG - Intergenic
900622490 1:3593707-3593729 AGGGGTCTTTTTAGTGGGGAGGG - Intronic
900657486 1:3766761-3766783 AGGAGCCTTCTGTGTGGACGTGG - Intronic
900879618 1:5371317-5371339 AGGAAACTTCAGAGTGGAGAAGG - Intergenic
901161041 1:7177037-7177059 AGGGGCCTTGTGAGGGGAGGGGG - Intronic
901479012 1:9511385-9511407 AGGGGACTTCTGAGAGGAAAAGG - Intergenic
901590586 1:10338262-10338284 AGGCACATTCTGAGGGGAGAGGG - Intronic
901878735 1:12181668-12181690 AGGCGACTTCTGAGAGGAAAGGG - Intronic
902391388 1:16109176-16109198 AGGGGCCTTCTGGCTGGGAACGG - Intergenic
902451178 1:16498170-16498192 AGGGGCCACCTGGGTGGAAAGGG + Intergenic
902728497 1:18352901-18352923 GGGGCCGTTCTGAGTGGAGCGGG - Intronic
902744766 1:18466430-18466452 AGGGGCTGTCGGAGTGGAGCTGG - Intergenic
903932664 1:26872512-26872534 AGGGGGATTCTGAGAGGAGGGGG - Intergenic
903982450 1:27199175-27199197 AGGGGACTTCTGAGAGGAAAAGG + Intergenic
904170942 1:28592036-28592058 AAAGGGCTTCTGGGTGGAGAGGG + Intronic
904571053 1:31465495-31465517 GAGGGCCATCTGAGTGGAAAGGG - Intergenic
904706346 1:32394040-32394062 AGGGCCCTGCTGAGGGAAGAAGG + Intronic
905331016 1:37197287-37197309 AGGGGCCTTTTGTGTAGTGATGG + Intergenic
905824888 1:41020140-41020162 AGTGGCCTGCAGAGTGGGGATGG - Intronic
908033896 1:60031160-60031182 ACGGGACTTCAGAGTGGACAAGG - Intronic
910108237 1:83654242-83654264 ATTGGCCTGCTGGGTGGAGAGGG + Intergenic
910262308 1:85304296-85304318 GGGGCCCTTCTGAGGGGAGGGGG + Intergenic
910838922 1:91542550-91542572 AGCGGCCTTATTAGTGAAGAAGG - Intergenic
910908160 1:92204318-92204340 AGTGGCCCTCTGTCTGGAGAAGG - Intergenic
912464853 1:109864944-109864966 AGGAGCCTTCTGGGAGAAGACGG - Intergenic
915240131 1:154515387-154515409 TGGAGGCTTCTGAGTGGAGGGGG - Intronic
916066264 1:161138250-161138272 AGGGACCTCCTGTGTAGAGATGG + Intergenic
916826603 1:168447929-168447951 AGGGTCCTTAAGAGTGGAAAAGG - Intergenic
917095037 1:171391422-171391444 AGGAACGTTCTAAGTGGAGAGGG - Intergenic
917181300 1:172301039-172301061 ATGGGCCTTCTGAGTTTAGGTGG + Intronic
918293034 1:183127774-183127796 TGGAGCCTGCTGAGTGCAGAGGG + Intronic
920876679 1:209842700-209842722 AGGGGCCTGCTGGGAGGAGTGGG - Intronic
923148932 1:231217111-231217133 TCGGGCCTGCTGAGTGGAGGGGG - Intronic
924940496 1:248810138-248810160 AGGGGCCTGCGGGGTGGAGTGGG - Intergenic
1062921848 10:1286120-1286142 AGGGGGCTTGGGAGTGCAGATGG + Intronic
1063427171 10:5959621-5959643 GGAGGCCTTCTGAGTGTGGAAGG + Intronic
1065853242 10:29808729-29808751 TGGAGCCTACTGAGTTGAGATGG + Intergenic
1066444924 10:35473531-35473553 AGGGGCTTTGTGAGGGGTGAGGG + Intronic
1067246783 10:44554062-44554084 TGGGGCCTGCTGGGTAGAGATGG + Intergenic
1068258251 10:54542758-54542780 AGGGAAGTGCTGAGTGGAGAAGG + Intronic
1068603697 10:58981952-58981974 AGGACCCATCTGAGTAGAGAGGG - Intergenic
1069604366 10:69730458-69730480 AGGGGCCCTCTGCGTGGGAAGGG - Intergenic
1070424134 10:76268947-76268969 AGGTGACTTCTGACTGCAGAAGG + Intronic
1074371087 10:112901319-112901341 AGGGTCTTGCTGAGAGGAGAAGG - Intergenic
1075014732 10:118902335-118902357 AGGGGTGTTTTGAGGGGAGAGGG + Intergenic
1075122319 10:119673050-119673072 ATGGGCCTGCAGAGTGGAGTGGG - Intronic
1075584158 10:123645072-123645094 AGGAGCCTTCTCTGTGTAGAAGG + Intergenic
1075786493 10:125053533-125053555 AAGGGCCTTGGGAGTGGAGCAGG - Intronic
1076585962 10:131547820-131547842 AGGGGCCTTCTCAGAGGAAAGGG + Intergenic
1077466433 11:2735819-2735841 GGGGTCCTTATGAGAGGAGAAGG - Intronic
1077635673 11:3840345-3840367 CGGGTCCTCCTGAGTGCAGAGGG + Intronic
1079380717 11:19934769-19934791 TGGGGCTTTCTGAAGGGAGAGGG + Intronic
1081692337 11:45086892-45086914 AAGGCTTTTCTGAGTGGAGAAGG - Intergenic
1083281357 11:61629075-61629097 AGGGGCCTCCACAGTGGGGAAGG + Intergenic
1083628209 11:64082676-64082698 AGGGGCCTGCAGGGTGGAGCAGG - Intronic
1084191214 11:67499822-67499844 AGAAGCCTTCTGAGGGGACAGGG + Exonic
1084909091 11:72373115-72373137 AGGGCCCTTCTGGGGGTAGAGGG - Intronic
1086517115 11:87625359-87625381 ATTGGCCTTCAGGGTGGAGAAGG + Intergenic
1086892004 11:92269294-92269316 AGGGCACTTCTGAGTGGTCAGGG - Intergenic
1086973953 11:93112474-93112496 AGAATCCATCTGAGTGGAGATGG + Intergenic
1087143765 11:94791672-94791694 AGGGGCTTTCTGGGTGGTAATGG + Intronic
1087266948 11:96071061-96071083 AGGGGCCTTCTGAGTGGAGAAGG + Intronic
1089654971 11:119940690-119940712 AGGGGCCTCCTGAGAGGAGTAGG + Intergenic
1090850007 11:130563879-130563901 AGGGTCCTTGTGAGGGGAGCAGG + Intergenic
1095301759 12:40592541-40592563 AGGGTTCTTATGAGTGAAGATGG + Intergenic
1096186313 12:49583783-49583805 AGGGTGCTGGTGAGTGGAGAAGG + Intronic
1096531013 12:52242929-52242951 AGGGGCCTTGGGTGGGGAGAGGG + Intronic
1097033155 12:56104256-56104278 AGGGGCGGGCTGAGGGGAGAGGG - Intronic
1100714671 12:97293429-97293451 AGGGTCCTTATGAGTGAAGGAGG - Intergenic
1102111937 12:110371514-110371536 AGGGCCCTTCAGAGACGAGAGGG + Intergenic
1102237237 12:111301389-111301411 AGGGACCTTCTGAGAGAGGAAGG + Intronic
1104061703 12:125274010-125274032 AGGTTCTTTCTGAGGGGAGAGGG - Intronic
1104801863 12:131559837-131559859 AGGGGCCATGTGAGTGGGGTGGG - Intergenic
1104801933 12:131560091-131560113 AGGGGCCATGTGAGTGGGGTGGG - Intergenic
1105290602 13:19050780-19050802 TGGGGGCATCTGAGTGGATAGGG - Intergenic
1107132385 13:36910635-36910657 AGGGGCCTTCTGGGCAGGGAGGG - Intronic
1109181046 13:59214141-59214163 TGGGGCCTGCTGGGTGAAGAGGG + Intergenic
1110519512 13:76458336-76458358 AGGGGGCTTCCTATTGGAGAGGG - Intergenic
1111529431 13:89517870-89517892 AGGGGGCTACTGAGTGTGGAAGG + Intergenic
1111737964 13:92165627-92165649 AGGGGCCTCATGAGAGGTGACGG - Intronic
1112296138 13:98188737-98188759 AGGGTCCTTCAGAGTGCAGGGGG - Intronic
1112463353 13:99622139-99622161 AGGGTGCTTCTAAGTGGAAAAGG - Intronic
1112956000 13:105059367-105059389 AGGGAAATTCTGAGTAGAGAAGG + Intergenic
1113665205 13:112136475-112136497 AGGAGCATTCTGGGTAGAGAAGG - Intergenic
1113694690 13:112336072-112336094 AGGTGCCTTCTGAGTGCAGGGGG - Intergenic
1115099625 14:29683047-29683069 TGGAGGCTTCTGAGTAGAGATGG + Intronic
1117789942 14:59329936-59329958 AGTAGCCTTCTGAGGGGAGATGG + Intronic
1118347089 14:64948303-64948325 ACGGGCCTCCTGAGGGAAGAGGG + Exonic
1119180828 14:72604303-72604325 ATGGGCTTTCCAAGTGGAGAGGG - Intergenic
1121719131 14:96097116-96097138 TGGAGCCTTCTGAGTGGGAAAGG + Intergenic
1122306616 14:100770629-100770651 AGGGGGCTTCAGAGTGGATGTGG + Intergenic
1122369301 14:101220232-101220254 AGGGTCTTTCTGAATTGAGATGG - Intergenic
1122540096 14:102493322-102493344 CGCGGCCTTCCGAGTGGGGAAGG + Intronic
1122866010 14:104604277-104604299 AAGGGCGGTCTGAGTGGAGGGGG + Intronic
1123034930 14:105468080-105468102 AGGGGCCAGCTGGGTGAAGACGG + Intronic
1123886970 15:24735898-24735920 AGAGGCCTTCTCAGTGGGCAGGG - Intergenic
1125418038 15:39473959-39473981 AGTGGCCTTCTAAGAGGAAAGGG + Intergenic
1125620655 15:41058755-41058777 GGGGGCATCCTGAGTGTAGAGGG + Exonic
1125726646 15:41871641-41871663 TGGGGCCTCCTCAGTGGAGCGGG - Intronic
1126010528 15:44298200-44298222 AGGGGGCTTCATAGTGGACATGG - Intronic
1126252872 15:46588872-46588894 TTGGTCCTTCTGGGTGGAGAAGG + Intergenic
1126352226 15:47756244-47756266 AGGGGCATTCTTAGAGGATAAGG - Intronic
1126823530 15:52528495-52528517 AGCGGGCTTCGGAGTGGAAAGGG - Intronic
1127378530 15:58407446-58407468 ATGGGTCTTCTGAATGGAGGAGG - Intronic
1128616689 15:69115831-69115853 GGGGGCCTTCCCAGAGGAGATGG - Intergenic
1128693029 15:69739721-69739743 AGGAGTTTTCTGCGTGGAGAAGG + Intergenic
1128783533 15:70378592-70378614 AGGGGCCTGCCCAGAGGAGATGG - Intergenic
1128998906 15:72317251-72317273 AGGAGCATTCTGAGTGTAGGAGG + Intronic
1129714570 15:77839697-77839719 AGGGGCCATCTGTGTGGAGATGG - Intergenic
1130684799 15:86027599-86027621 AGGGGTTTTCTAGGTGGAGAAGG - Intergenic
1132390461 15:101434739-101434761 TGGGGGCTTCTCCGTGGAGACGG + Intronic
1132507425 16:318480-318502 AGGAGCCATCTGAGTGCTGAGGG - Intronic
1133699448 16:8295436-8295458 TGGGCTCTGCTGAGTGGAGAGGG - Intergenic
1134134863 16:11671419-11671441 AGGGGTCTTCCAAGTGCAGAGGG - Intronic
1135570298 16:23544258-23544280 AATAGCCTTCTGAGAGGAGATGG + Intronic
1136912245 16:34154049-34154071 AGGGGCCTCCAGAAGGGAGAGGG - Intergenic
1137744282 16:50809457-50809479 AGGAGCGTTCTGTGTGGTGAGGG + Intergenic
1138554800 16:57764972-57764994 AGGGGCCTTGGGAGTGGGCAGGG + Intronic
1138643665 16:58406859-58406881 GGGAGCCATCTGCGTGGAGATGG - Intergenic
1139268279 16:65659696-65659718 AAGGGCATTCTGGGGGGAGATGG - Intergenic
1139580830 16:67872866-67872888 TGGCGCCTTCTGAGTCGAGTAGG + Intergenic
1140093637 16:71856834-71856856 AGGGTCCTAAGGAGTGGAGAAGG + Exonic
1140945038 16:79760119-79760141 AGAGGCTTTCTGGGTGGAGCTGG - Intergenic
1142494042 17:296872-296894 AGAGGCCTCCTGAGCGGAGCTGG - Intronic
1142740082 17:1926823-1926845 AAGTGCCTCCTGTGTGGAGAAGG - Intergenic
1143513391 17:7407769-7407791 AGGCGTCTGCTGAGGGGAGAAGG + Intronic
1144431191 17:15193334-15193356 AGAAGCCTTTGGAGTGGAGAAGG + Intergenic
1144644710 17:16964275-16964297 AGGTTCATTCTGAGTGGAGGTGG - Intronic
1144763810 17:17722365-17722387 AGGGGGGTTCTGAGTGCAGCTGG - Intronic
1147167972 17:38603452-38603474 CGGGGAGTGCTGAGTGGAGAGGG - Intronic
1147952344 17:44114232-44114254 AGGGGGCATCTCAGTAGAGAAGG + Intronic
1148195888 17:45712413-45712435 AGGAGACTCCTGAGTGGAGTGGG - Intergenic
1148678492 17:49459070-49459092 AGGGGCCTTCCTAGAGGAGAAGG + Intronic
1149774538 17:59346827-59346849 AAGGGCCTTGTGAGGAGAGATGG + Intronic
1150228869 17:63539003-63539025 AGGGTCTTTCTGGGTGGAGGTGG + Intronic
1150512769 17:65774354-65774376 AGGGGTCCTCTGAGAGCAGAAGG + Intronic
1150697827 17:67421030-67421052 AGGGTCCTTCTGGGTGCAGAAGG + Intronic
1151676932 17:75603376-75603398 GGGGTCCTTCTGATTGGAGATGG + Intergenic
1151992126 17:77582124-77582146 AGGGGGCTTCTGGGTGGGGGTGG + Intergenic
1152280919 17:79384494-79384516 AGGGGCATTTTGAGGGCAGACGG - Intronic
1152300338 17:79491700-79491722 AGGGGCCTTCAGCTTGGTGATGG + Intronic
1152632840 17:81418244-81418266 AGAGGGCTTCAGATTGGAGAGGG + Intronic
1153327559 18:3836720-3836742 AGGTGGATTCTGAGGGGAGATGG - Intronic
1154305557 18:13228185-13228207 TGAGGCCTGCGGAGTGGAGATGG + Intronic
1156380799 18:36559384-36559406 AGCTTCCTTCTGAGTGGAGGAGG - Intronic
1157693262 18:49700811-49700833 AGGGGCCCTCGGAGGGGAAATGG + Intergenic
1157810800 18:50694360-50694382 AGGGGACTTCTGAGGTGAGGGGG - Intronic
1157979937 18:52368042-52368064 AGGATCTTTCTGAGTGGAAAAGG - Intronic
1158785657 18:60708990-60709012 AGCAGCCTTCTGATTGGAAATGG - Intergenic
1159957486 18:74530118-74530140 TGGGGGCTTCTGGGTGGGGATGG - Intergenic
1160848433 19:1177586-1177608 CGGGACCTTCTGAGTGCAGGCGG + Intronic
1161169132 19:2804316-2804338 AGGGGTTTTGTGGGTGGAGAAGG + Intronic
1161637893 19:5400688-5400710 AGGGGCCATCTGAGTTGAGAAGG + Intergenic
1161743571 19:6040817-6040839 AGGGAGCTCCTGTGTGGAGATGG + Intronic
1161810365 19:6467874-6467896 AGGGGCTCTGTGAGAGGAGAGGG + Exonic
1162986287 19:14272266-14272288 TGGGAGCTTCTGAGTGCAGAGGG - Intergenic
1163491304 19:17618518-17618540 AGGGGCCATGTGGGTGGAGTGGG + Intronic
1163506090 19:17707110-17707132 AGGGGCCATCTTAGCAGAGAAGG - Intergenic
1163699696 19:18781104-18781126 AGGGGCCCTCTGTGTGGGGGTGG + Exonic
1164506124 19:28862977-28862999 AGAAGCCTCATGAGTGGAGAGGG + Intergenic
1164796951 19:31041206-31041228 AGGGGGCGGCTGAGGGGAGATGG - Intergenic
1165858720 19:38895295-38895317 AAGGGCCTTTGAAGTGGAGAGGG - Intronic
1167215149 19:48159612-48159634 AGGGGCCTTCAAAGTGGAAGAGG + Intronic
1168199646 19:54805392-54805414 AGGGTCCATATGAGTGGAGAAGG + Intronic
1168642116 19:58037662-58037684 AGGGGCATCCTGAGTACAGAGGG + Intronic
1168679526 19:58304395-58304417 ACAGGCCTTCTGCGTGTAGATGG + Intronic
925622424 2:5807122-5807144 AAGGGGCTTTTGAATGGAGAAGG - Intergenic
925716110 2:6785781-6785803 AGGGGCCTTCTGAGCTCACATGG + Intergenic
925966153 2:9068294-9068316 AGGGGGATTCTAAGGGGAGAGGG - Intergenic
926049680 2:9736862-9736884 AGGGGGCTTCTGAAGGCAGAAGG - Intergenic
927612459 2:24555110-24555132 AGGGGACTTCCGAGAGGAAAAGG + Intronic
929149446 2:38734438-38734460 AGGGGACTTCCGAGAGGAAAAGG + Exonic
930378483 2:50597372-50597394 GGGGGCCTTATGGCTGGAGAGGG - Intronic
931767300 2:65468177-65468199 AAGGGGCATCGGAGTGGAGAAGG + Intergenic
931798114 2:65731508-65731530 AGGAGACTTCTGAGAGGAAAAGG + Intergenic
932073601 2:68643919-68643941 CGGCGGCTTCTGAGTGAAGAGGG + Intronic
932374361 2:71222413-71222435 AGGGGCCTTCTGTTTTTAGAAGG + Intronic
932430524 2:71671422-71671444 AGGGGGCCTGGGAGTGGAGAGGG + Intronic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
933159722 2:79010392-79010414 AGGTGACTTCTGGGTTGAGAAGG + Intergenic
933780834 2:85799766-85799788 TGGGACCATGTGAGTGGAGAGGG - Intergenic
934663531 2:96155397-96155419 AGGGGCCTGGTGGGTGGAGAAGG - Intergenic
936248464 2:110848846-110848868 AGGGGCCTTCTTAGTGGGAGGGG - Intronic
937057551 2:118952292-118952314 AGGGACCTTCAGAGAGGGGAAGG - Intronic
937237357 2:120438772-120438794 AGGGGCCTCCTGAGAGGTGTGGG - Intergenic
937239914 2:120453303-120453325 TGGGGCCTGCTGGGTGGACAGGG + Intergenic
937243559 2:120477797-120477819 GGGAGTCTTCGGAGTGGAGAGGG - Intergenic
938587451 2:132705382-132705404 AGGGGTAGTCTGATTGGAGAGGG - Intronic
940295564 2:152120465-152120487 ATGGTCCTTTTGAGTTGAGAGGG + Exonic
940926817 2:159372892-159372914 AGGGGCATTATGAGTGCAAAAGG + Intronic
941413827 2:165193969-165193991 AGGGGCCTGCTTAGTGGGGAAGG - Intronic
941697723 2:168571239-168571261 AGGTGCCTTCTGCTTGGAGCTGG + Intronic
944665645 2:201956731-201956753 AGGGGTCATCCGTGTGGAGAAGG - Intergenic
945292039 2:208136204-208136226 GTGGGCCTTCTGAGTGTAGGCGG - Intergenic
945702186 2:213185632-213185654 AGGGCCCATGTGAGTGCAGATGG - Intergenic
945879814 2:215313457-215313479 AGTGGCATTCTGGGAGGAGAGGG + Intronic
946056925 2:216910671-216910693 AGAGTCCTTCTTGGTGGAGAAGG - Intergenic
948830134 2:240594606-240594628 AGGGGAGTTCTGGGTGGAGGAGG + Exonic
1168961217 20:1871342-1871364 AGGAGTCTTCTGAGTGCAGGAGG + Intergenic
1169456470 20:5756887-5756909 AGGGACATTCAGATTGGAGAGGG - Intronic
1170352713 20:15459661-15459683 AGGGGTCTTCTGAGTTCAAAAGG + Intronic
1171361173 20:24587364-24587386 ATGGGAGTTCTGATTGGAGACGG - Intronic
1172600896 20:36182258-36182280 AGGGGCTACCTGAGAGGAGATGG - Exonic
1172843110 20:37913870-37913892 GGAAGCCTTCTGAGTGGGGAGGG + Intronic
1172927623 20:38553104-38553126 AGGGGGCTTATGATTGGAGAGGG + Intronic
1172993162 20:39050639-39050661 AGGGTCCTTCAGAGTGGAGTTGG + Intergenic
1174578828 20:51556590-51556612 AGGGGGCATCTAAGAGGAGATGG + Intronic
1179182018 21:39053661-39053683 GGGGGACTTCTAGGTGGAGAGGG - Intergenic
1179343896 21:40538193-40538215 ACGTGACCTCTGAGTGGAGAGGG - Intronic
1179987441 21:44929511-44929533 AGGGGCTTCCTGGGTGGAGGGGG - Intronic
1179987575 21:44930153-44930175 AGGGGCTTCCTGGGTGGAGGGGG - Intronic
1180976830 22:19853335-19853357 AGGTGACTGCTGCGTGGAGAAGG - Intronic
1181472555 22:23149858-23149880 TGGGGCCTTGTGAGTCCAGAGGG - Intronic
1182320649 22:29476777-29476799 AGAGGCCTTCAGAGAGGGGATGG - Intergenic
1183308389 22:37096199-37096221 AGGAGGCTTCTGCGTGAAGACGG - Intronic
1183481176 22:38066357-38066379 AGGGACCTGGCGAGTGGAGATGG - Intronic
1183482041 22:38070536-38070558 AGGGGCCATAGGAATGGAGATGG - Intronic
1183972929 22:41491929-41491951 AGGGGCCATATGAGGTGAGAGGG + Intronic
1184127778 22:42500317-42500339 CGGGGCCTTCTGAATGGGGGCGG + Intergenic
1184136652 22:42553853-42553875 CGGGGCCTTCTGAGTGGGGGCGG + Intronic
1184735523 22:46395506-46395528 AGGTGCCCTGGGAGTGGAGAGGG - Intronic
1185087191 22:48747162-48747184 AGGGGCCCTGGGACTGGAGAAGG + Intronic
949240003 3:1859558-1859580 AGGGGCCTGGTGAGAGGTGATGG + Intergenic
949945131 3:9184070-9184092 AGGGGACTCCTGAGAGCAGATGG - Intronic
950921319 3:16697640-16697662 AGGGGCTTTCTGAGTGGAGTTGG - Intergenic
951255772 3:20447701-20447723 ACAGGCCATCTGAGTGGACAAGG - Intergenic
953360840 3:42294900-42294922 GGGGTCTTTCTGGGTGGAGAAGG + Intergenic
953737717 3:45510568-45510590 AGATACCTTCTCAGTGGAGATGG + Intronic
954674626 3:52308965-52308987 AGGGGCCTTGGGAGTGGGGTTGG + Intergenic
956613613 3:71149137-71149159 TGGGGCATTCTGAGTGTAGTGGG + Intronic
961684548 3:128620635-128620657 TGGGGCCTGCTGAGTGGGGTGGG - Intronic
962235938 3:133707149-133707171 AGGTGCCATCTGAGTAGAGAGGG + Intergenic
963552816 3:146745707-146745729 TGGGGCCTGCCCAGTGGAGAGGG - Intergenic
966021118 3:175212204-175212226 ATGGGCCTTCTTAATGGACATGG - Intronic
966869033 3:184278087-184278109 AGAGGCCTTGAGAGAGGAGATGG + Intronic
967065462 3:185911325-185911347 AAGGGCATTCTCAGGGGAGAGGG - Intergenic
967074738 3:185991807-185991829 AAGGGCATTCTCAGGGGAGAGGG - Intergenic
967775473 3:193381777-193381799 AGGGGCCTTCAGAGACAAGAAGG + Intergenic
968445841 4:651633-651655 TGGCGCCTGCTGAATGGAGACGG - Intronic
968445854 4:651705-651727 CGGCGCCTGCTGAATGGAGACGG - Intronic
968912482 4:3483257-3483279 GGCAGCCTCCTGAGTGGAGATGG + Intronic
969228386 4:5813682-5813704 GGGAGCCTTCTCAGAGGAGAAGG - Exonic
970828405 4:20306208-20306230 AGGGGACTGGTCAGTGGAGAAGG + Intronic
971391796 4:26192933-26192955 AGGGTCCTTATGAGTGAAAAAGG + Intronic
974482573 4:62465390-62465412 AGGGTCCTTATGAGTGAAAAAGG - Intergenic
978352404 4:107833813-107833835 AAGGACCTTCTGAGTGGAAAAGG + Intronic
982205634 4:152995471-152995493 TGGGGCCATCTGAGTGGAGACGG + Intergenic
982243621 4:153326027-153326049 AGGAGACTTCCAAGTGGAGATGG + Intronic
983292794 4:165827122-165827144 AGGGCCCTTCTGAGTTCTGATGG - Intergenic
983736849 4:171072351-171072373 AGGGGACTTCTGAGAGGAAAAGG - Intergenic
985988904 5:3539004-3539026 ACGGGCCTTCTGCGTGTGGAAGG + Intergenic
986105783 5:4658140-4658162 AGGGTCTTTCTAAGTGGAAATGG - Intergenic
986185412 5:5431435-5431457 ATGGTCCTTCGGAATGGAGATGG - Intronic
986701412 5:10412938-10412960 AGGGGCCATGGGAGTGGTGAGGG + Intronic
987660209 5:20862878-20862900 AGGGGGCTTCTGAAAGGAGTTGG - Intergenic
988234755 5:28527891-28527913 AGGGGCCTTGTGGGAGGTGATGG + Intergenic
988722670 5:33893460-33893482 AGGGTCCTTATAAGTGGAAAAGG - Intergenic
988763438 5:34342790-34342812 AGGGGGCTTCTGAAAGGAGTTGG + Intergenic
988989414 5:36654887-36654909 AGGGGCCAGCTGAGTGGTGCAGG + Intronic
990600991 5:57358542-57358564 AGTGGCCTGCTGAGTGGGCAAGG + Intergenic
992071276 5:73151390-73151412 AGTGGGCATCTGAGTGGGGATGG + Intergenic
992173080 5:74123284-74123306 GAGGGCCTTCTCAGTGAAGAAGG + Intergenic
992876838 5:81064544-81064566 AGGGGCCTTTTGTGGTGAGAGGG + Intronic
993001404 5:82384940-82384962 AGGGGTTTTCTGAGTTGGGAGGG + Intronic
995859334 5:116625096-116625118 AGTGGCCCTCTGAATGGAGGTGG + Intergenic
996126436 5:119730477-119730499 ACCAGCCTTCTGTGTGGAGAGGG - Intergenic
996153371 5:120067083-120067105 GAGGGCCTTATGAATGGAGAGGG + Intergenic
996223477 5:120961155-120961177 AGCAGCCCTCTGAGTGGACATGG + Intergenic
996255625 5:121399372-121399394 TGGGGCCTTCTGAGGGTGGATGG + Intergenic
997249972 5:132380978-132381000 AGAGGCCACCTGAGTGGACATGG + Intronic
997935433 5:138106414-138106436 AGGTGCCTTCTGAGTGATAAGGG + Intergenic
998472772 5:142396229-142396251 CTGGGGCTGCTGAGTGGAGATGG + Intergenic
999262582 5:150246901-150246923 AGGGGCCCTCTGACTGGGGCTGG - Intronic
1001453796 5:171845799-171845821 AGGGGCCTGTGGGGTGGAGAAGG + Intergenic
1001475180 5:172045213-172045235 AGGGAGCTTCTGAGTGGCGGTGG - Intronic
1001598775 5:172915467-172915489 ATGGTCCTTCTGAGCGGACAAGG - Intronic
1004080793 6:12390709-12390731 AGGGGTCTTCTGCGGGCAGAGGG - Intergenic
1004320857 6:14630400-14630422 AGGGGCCACCTGAGGGGAGAGGG + Intergenic
1004734921 6:18395720-18395742 GGGGGGCTGCTGAGTGGGGAAGG + Intronic
1006677459 6:35774635-35774657 AGGTGGTTTGTGAGTGGAGAAGG + Intergenic
1006985386 6:38172482-38172504 AGGGGCCTTCTGACTGGGGCAGG - Exonic
1007379025 6:41474761-41474783 AGGAGCCTTCTGAGTGGGCAAGG - Intergenic
1007415600 6:41689494-41689516 ATGGGGCTTCAGAGGGGAGAAGG - Intronic
1008012054 6:46478530-46478552 ATGGGACTTATGAGTGAAGAAGG - Intronic
1008553265 6:52653551-52653573 AGGAGCCAGCTGACTGGAGAGGG - Intergenic
1008636356 6:53414731-53414753 ACAGGCCTTCTGAGTAGAGAAGG - Intergenic
1008927919 6:56906675-56906697 AGGGGACTTCTGAGAGGAAAAGG - Intronic
1009523309 6:64712082-64712104 AGGTGCCTTCAGCTTGGAGATGG + Intronic
1010573291 6:77504408-77504430 AGGGGTCTTCCAAGTGGAAAAGG + Intergenic
1013155470 6:107489040-107489062 AGGGGACTTGTGAGCGCAGAGGG + Intergenic
1014513516 6:122354329-122354351 AGTGTCCTTGTCAGTGGAGAAGG + Intergenic
1016469970 6:144364913-144364935 AGGGGCCTTCTAAGTGGAAAAGG - Intronic
1017505609 6:155066116-155066138 AGCGGCCGTCTCAGTGGAGAAGG - Intronic
1018745636 6:166759904-166759926 AGGGGATTTCTGAGTGTCGAAGG + Intronic
1018885770 6:167935164-167935186 AGGGGGTTTCAGAGTGGGGATGG - Intronic
1018889389 6:167972390-167972412 CGGGACCTTCTGTGTGGACAGGG + Intergenic
1019075362 6:169382926-169382948 AGGGGCCTTCTGGAGGAAGAGGG + Intergenic
1020330805 7:7015160-7015182 AGGGGACTTCTGAGAGGAAAAGG - Intergenic
1020649765 7:10860141-10860163 TGGGGACTTCTGAGCTGAGATGG + Intergenic
1020667881 7:11069899-11069921 ACTGGCCTTCTGAATGGAGTTGG + Intronic
1021702197 7:23330439-23330461 AAGGGACTTGTGAGAGGAGAGGG - Intronic
1022298732 7:29082656-29082678 CTGTGCCTTCTGAGTGGTGAAGG - Intronic
1022538646 7:31114831-31114853 GGGGGCCTTCTGAAAGGGGAAGG - Intergenic
1024066355 7:45739883-45739905 AGAGGGCATCTGAGGGGAGATGG - Intergenic
1024149182 7:46552091-46552113 AGGGGCCCACTGTGTTGAGATGG + Intergenic
1024656286 7:51453828-51453850 AGGGACCTTCTGAGGTGGGATGG + Intergenic
1025217492 7:57070942-57070964 AGAGGGCATCTGAGGGGAGACGG - Intergenic
1025628407 7:63244592-63244614 AGAGGGCATCTGAGGGGAGACGG - Intergenic
1025653859 7:63499523-63499545 AGAGGGCATCTGAGGGGAGACGG + Intergenic
1029619376 7:101680350-101680372 AGGGCCCTACTGAGAGGCGAAGG + Intergenic
1029709420 7:102291516-102291538 GGGGGCCTTCTGGCTGGCGATGG - Intronic
1032849990 7:135785986-135786008 AGGGGCCTCATGGGTTGAGAGGG + Intergenic
1033346891 7:140532669-140532691 AGGGTCCTGCAGACTGGAGAAGG + Intronic
1034130889 7:148716487-148716509 AGGGGGCTTCTCAATGTAGATGG - Intronic
1034263895 7:149772495-149772517 AGGGGTGTTCGGAGGGGAGACGG - Intronic
1036613247 8:10367954-10367976 AGGGGACTTGTGGGTGAAGATGG + Intronic
1037786268 8:21905195-21905217 AGGGGCCTACAGTGTGGAGTGGG - Intergenic
1038308317 8:26424559-26424581 CAAGGACTTCTGAGTGGAGAGGG - Intronic
1038323224 8:26548470-26548492 AGGGGACTTCTGAGAGGAAAAGG - Intronic
1038442987 8:27584650-27584672 TCAGGCCTTCTGAGTGGAGCTGG - Intergenic
1039760163 8:40565898-40565920 GGGGGCCTTCACAGTGGTGAAGG - Intronic
1040306580 8:46215053-46215075 TGGGGCCTTCTGGATAGAGAGGG - Intergenic
1044029456 8:87216437-87216459 AGGTGCTTTCTGAGGGGAGTGGG - Intronic
1044433081 8:92131940-92131962 AGGGGCCTGCTGGGAGGTGATGG - Intergenic
1048191979 8:132298361-132298383 ACGGGCCATCTAACTGGAGAAGG + Intronic
1049472764 8:142783671-142783693 ATGGGCCTTGGGTGTGGAGAAGG + Intergenic
1049702203 8:144020416-144020438 AAGAGCGTTCTGAGGGGAGAGGG - Intronic
1049703096 8:144023870-144023892 AAGAGCTTTCTGAGGGGAGAGGG - Intronic
1052337715 9:27337067-27337089 ATGTCCCATCTGAGTGGAGATGG - Intronic
1055666636 9:78559686-78559708 TGTGGCCTTCTGAAGGGAGAAGG + Intergenic
1055741395 9:79393500-79393522 AGGGTCCTACTGTGTGCAGAGGG - Intergenic
1056042467 9:82682562-82682584 GGCTGCCATCTGAGTGGAGAGGG - Intergenic
1058729220 9:107834034-107834056 AGGGGCATTCTGATGGAAGAGGG - Intergenic
1059362869 9:113759424-113759446 AGGTGCCTTCTGAGGGAAAAGGG - Intergenic
1059378448 9:113904854-113904876 AGGGTCCTTCTAAGTGGAAGAGG - Intronic
1059398930 9:114056668-114056690 AGGGCCCAGGTGAGTGGAGATGG + Intergenic
1060062703 9:120475448-120475470 AGAGGCCTTGTGGGTGGATATGG - Intronic
1060351227 9:122862421-122862443 AAGGGCCTTGTGGATGGAGAAGG - Intronic
1061020018 9:128008300-128008322 AGGGTCCTTCAGTGTGGAGGAGG + Intergenic
1061103325 9:128509559-128509581 AGGGGTCTTCTGAGAGGAAATGG - Intronic
1061390751 9:130315918-130315940 ATGGGGCTTCTGAGAGGTGATGG - Intronic
1061588412 9:131583225-131583247 AGGGGCCTTCTGAGTGGGGCAGG - Intronic
1062049159 9:134438247-134438269 AGGGGCTTCCTCAGTGGTGAGGG + Intronic
1062173988 9:135150873-135150895 AGGGTCCTTAAGAGTGGAGGAGG - Intergenic
1062228045 9:135464983-135465005 AGGGGCCTGCGGGGTGCAGAGGG - Intergenic
1191668938 X:63731209-63731231 GGGGGCCTTCTGAGAGGATACGG - Intronic
1192168089 X:68838508-68838530 CTGGGCCTACTGGGTGGAGATGG - Intronic
1198062581 X:133061957-133061979 TGGGACCTGCTGAGTGGGGAGGG - Intronic
1198255422 X:134920132-134920154 AGGGGCCTTATGAGAGGAGTGGG + Intergenic
1200473034 Y:3609505-3609527 GCGGGGATTCTGAGTGGAGATGG + Intergenic