ID: 1087268500

View in Genome Browser
Species Human (GRCh38)
Location 11:96086818-96086840
Sequence CTGTGGATTCAGATAAGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087268497_1087268500 7 Left 1087268497 11:96086788-96086810 CCTGGTAGGCATATCAGGAAACT 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1087268500 11:96086818-96086840 CTGTGGATTCAGATAAGGCAAGG 0: 1
1: 0
2: 0
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087268500 Original CRISPR CTGTGGATTCAGATAAGGCA AGG Intronic
903024651 1:20418663-20418685 CTTTGGAGTCAGAGAAGCCAAGG + Intergenic
903303264 1:22393872-22393894 CTGTGGATACAGGCCAGGCATGG + Intergenic
904046067 1:27609229-27609251 CTGAGGGTGCAGATGAGGCATGG - Intergenic
904793345 1:33040246-33040268 CTCTGAAGTCAGAAAAGGCAAGG + Intronic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905684400 1:39898508-39898530 CTGAAGATTCAGAGAAGGGAGGG + Intronic
906795297 1:48692005-48692027 GTGTGGATTCTGATATGACAAGG - Intronic
906950051 1:50327264-50327286 CTGTTCATTCAGGGAAGGCAGGG - Intergenic
908822625 1:68103755-68103777 CTGTGGATTAAGGAAAGGCTTGG - Intronic
908923927 1:69230380-69230402 CTGTGAACTCAGATGAGTCAAGG - Intergenic
909173266 1:72321961-72321983 CTTAGGTTTCAGAAAAGGCATGG - Intergenic
910814081 1:91271087-91271109 CTGTGGCCCCAGAGAAGGCAGGG - Intronic
912195508 1:107392557-107392579 CTGAGGAAACAAATAAGGCATGG + Intronic
912688929 1:111789093-111789115 CTGTGGATGAAAATAAAGCATGG + Intronic
913068324 1:115277691-115277713 CTCTGGATTCAGCACAGGCAGGG - Intergenic
914247407 1:145896428-145896450 ACGTGGATTCAGAGGAGGCAGGG + Intronic
916004992 1:160652073-160652095 CTCTGGAGTCAGATAATCCAGGG - Intergenic
916523704 1:165589492-165589514 CTGTGGTGTCAGAGAAGGCAAGG + Intergenic
917613262 1:176711426-176711448 CTGAGGATTCAGCTAAGCAAAGG - Intronic
920460854 1:206139085-206139107 GTGTGGATTCAGAGAAGAAAGGG - Intergenic
922163576 1:223096647-223096669 ATGTGGAATCAGGTAAGACAAGG - Intergenic
922553768 1:226517619-226517641 CTGTGGAGTCAGAGAAGCCGAGG + Intergenic
924203627 1:241687438-241687460 CTGGGGATTAAGAAAAGGCAGGG - Intronic
924472388 1:244353956-244353978 CTGAGGATGCAGAGAAGGCGTGG - Intronic
1062958937 10:1558430-1558452 ATGTGGATTTAGATGGGGCATGG - Intronic
1062959001 10:1558666-1558688 ATGTGGATTTAGATGGGGCATGG - Intronic
1063037792 10:2304234-2304256 CCGTGTATTCATATAAGGGATGG + Intergenic
1064936702 10:20686398-20686420 CTGTCAACTGAGATAAGGCAGGG + Intergenic
1066756878 10:38720599-38720621 CTGGCGATTCAGTCAAGGCAGGG + Intergenic
1068011289 10:51455084-51455106 CTGTGGATGCACAGAAGTCAAGG - Intronic
1069847150 10:71380201-71380223 CTGTGGGCCCAGAGAAGGCAGGG - Intergenic
1069933143 10:71897022-71897044 CTGTGGAGGCAGAGAAGACAAGG - Intergenic
1071903834 10:90150877-90150899 CTTTGGATACAGCTAAGACAGGG - Intergenic
1073509787 10:104035573-104035595 TGATGGATTCAGATCAGGCAGGG + Intronic
1075738451 10:124678717-124678739 CTGTGGATACAGATGAGGGCAGG + Intronic
1077094481 11:793473-793495 CTTTGGCTTCAGATAAAGGATGG - Intronic
1078404384 11:11056956-11056978 CTTTGGAGTCAGATAAACCAAGG - Intergenic
1078738240 11:14041767-14041789 TTGAGAATTCAGATAAGGGAGGG - Intronic
1083586882 11:63866391-63866413 CTGTGGTTTCAAGAAAGGCAGGG - Intronic
1085045598 11:73351176-73351198 CTGGGGATTCTGAAAAGGCCGGG - Intronic
1086171359 11:83840133-83840155 CTGGGGATTCAGAGAAGTGATGG - Intronic
1087268500 11:96086818-96086840 CTGTGGATTCAGATAAGGCAAGG + Intronic
1091231066 11:133988387-133988409 CTGTGCCTCCACATAAGGCAGGG + Intergenic
1091413771 12:262251-262273 CTGTAGAGTCAGATGAGGCCAGG + Intronic
1092057588 12:5520906-5520928 CTGTGTCTTCACATAAGTCATGG + Intronic
1092183287 12:6460917-6460939 CTGGGGCTTCAGAGACGGCAAGG + Exonic
1093123823 12:15304830-15304852 TTGTGGATGAAGTTAAGGCATGG - Intronic
1095687620 12:45052803-45052825 CTGTGAATTCCCATGAGGCAAGG - Intergenic
1100718925 12:97335773-97335795 CTGTGAATTAAAATAAAGCACGG - Intergenic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1102897381 12:116609554-116609576 CTGAGGCTTCAGAACAGGCAGGG + Intergenic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1105214594 13:18276973-18276995 CTGTGGATTGGGGTAGGGCAGGG - Intergenic
1105975141 13:25466893-25466915 CTGTGGAGGAAGACAAGGCAGGG + Intronic
1107961752 13:45565218-45565240 CTGTGGACTCAGTAGAGGCATGG - Intronic
1110741466 13:79002246-79002268 CTGGTGATTTAGACAAGGCAGGG + Intergenic
1111427148 13:88101255-88101277 CTGAGGATTTTGATAAGTCATGG + Intergenic
1112033035 13:95474631-95474653 CTGTGTATTCAGAAACAGCAGGG + Intronic
1112599538 13:100841342-100841364 CTGTGGGTCCAAATAAGACAGGG - Intergenic
1115992393 14:39163535-39163557 CTGTGGAGACAGATTAAGCAAGG - Intronic
1116542245 14:46112796-46112818 CTGTGGATGCATAGAAGTCAAGG + Intergenic
1117300833 14:54425467-54425489 CTGTGGGTTCAGCTGAGGCATGG - Exonic
1118753503 14:68822685-68822707 CTGTGGGGTCAGCTAGGGCAGGG - Intergenic
1119476591 14:74933942-74933964 CTGTGGTTTCAGATAATGAGTGG - Intergenic
1120048537 14:79837529-79837551 GTGTGTTTTCAGAGAAGGCAAGG - Intronic
1121312850 14:92944478-92944500 CTATGGGTGCAGATAAGGGATGG - Intronic
1122659428 14:103284779-103284801 GTCTGGGTTCAGATAAGGTATGG - Intergenic
1123124405 14:105935898-105935920 CTGGAGATCCAGATAGGGCATGG + Intergenic
1124797401 15:32795230-32795252 CTGGGGGTTCAGGTGAGGCAAGG + Intronic
1125085623 15:35725908-35725930 CTGTGGACTCAGAATAGGAAGGG - Intergenic
1125239335 15:37555597-37555619 CTCAGGATTAAGATGAGGCAAGG + Intergenic
1125602654 15:40923980-40924002 CTGGGGCTTCTGAGAAGGCAAGG + Intergenic
1128564550 15:68692008-68692030 CTGTGGAAGCAGATGATGCAGGG + Intronic
1128815977 15:70608566-70608588 CTTTGGATTCAGATAAATCTGGG + Intergenic
1129275394 15:74442114-74442136 CAGTGGATGCAGAGAGGGCAGGG - Intergenic
1130144534 15:81263814-81263836 CTGTGGATGGAGAGAATGCAGGG + Intronic
1130561263 15:84961157-84961179 CCTTGCATTCAGATAAGGCTAGG - Intergenic
1133279987 16:4659798-4659820 GTGTAGATTCAGAGAAGGCTGGG + Intronic
1133833303 16:9343891-9343913 CTCTGGAATCAGACAAGCCAAGG - Intergenic
1138785492 16:59840885-59840907 GTGTGGATGCAGACAAGGGAAGG + Intergenic
1140781382 16:78299913-78299935 CTGTGTATTGAGAGATGGCAGGG + Intronic
1144015939 17:11196369-11196391 CTGCCCATACAGATAAGGCATGG + Intergenic
1150814027 17:68378588-68378610 CTGTGGACTCAGAGACAGCAGGG - Intronic
1153387086 18:4510510-4510532 CTGAGGTTTCAGACAAGGCTCGG + Intergenic
1156300238 18:35830065-35830087 CTGTGTATTCAGGTAAGTAAAGG + Intergenic
1159623187 18:70662753-70662775 CTCTGGCTTCTGATAGGGCATGG + Intergenic
1159699806 18:71611407-71611429 GTGTGTATTCAGATAAGTAATGG - Intergenic
1159815200 18:73065285-73065307 CGGTGGAGTCAGAGAAGCCATGG + Intergenic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1166738651 19:45101129-45101151 CTGAGGACTCAGATTAGGGAGGG + Intronic
1167380814 19:49136943-49136965 CTGTGGAGTCAGCTCCGGCAGGG - Intronic
1167874631 19:52401480-52401502 CTGGGGAAGCAGATCAGGCAGGG - Intronic
927523807 2:23719751-23719773 CTGTGGGTTAAGATAAGGACAGG - Intergenic
928161411 2:28929285-28929307 ATGAAGATTCAGAAAAGGCAAGG - Intronic
929230935 2:39559349-39559371 CTGTGGACTGGGATAAGGAATGG - Intergenic
930685344 2:54301884-54301906 CTGAGGAGGCAGATCAGGCAGGG + Intronic
932195347 2:69778437-69778459 CTCTGGAGTCAGAAAAGGCCTGG + Intronic
932597998 2:73106276-73106298 GTGGGGATTCAGAGAAGGCTGGG + Intronic
935401127 2:102661578-102661600 CTGTGAAATCATATAAAGCAAGG - Intronic
936442646 2:112568308-112568330 CTGTGGAGTGAGATCAGACATGG - Intronic
939280780 2:140061979-140062001 CTGTGGATTTTGTTGAGGCATGG + Intergenic
939592310 2:144081241-144081263 CTGAGGGTTAAGATAAGGTAAGG + Intronic
939718863 2:145621794-145621816 CAGTGGATTCAGAGAAGACTGGG - Intergenic
939958368 2:148545547-148545569 CTGTGGAAGCAGACAAGGCCAGG - Intergenic
941723359 2:168835741-168835763 TTGTGGATTCTGATATGGCCTGG - Intronic
941807657 2:169725075-169725097 CTATGGATTAAAATAAAGCAGGG + Intronic
943313056 2:186351808-186351830 CTGTGGGATCAGCTAAGGCTAGG + Intergenic
944676725 2:202039206-202039228 CTTTGGAATCAGATTAGACAGGG + Intergenic
945119790 2:206444912-206444934 CTGTGGACTCAGAGAAGGGGTGG + Intronic
945819230 2:214643221-214643243 CTGTTGGTTCAGACAAGGAAAGG + Intergenic
947530664 2:230906935-230906957 CTGTGTATGCAGAGAAGCCAGGG + Intergenic
947948646 2:234128613-234128635 CAGTGAATTCAGCTAAGCCATGG - Intergenic
948951630 2:241256103-241256125 CTGGAGATTCAGTTAAGGCCTGG - Intronic
1170792103 20:19516865-19516887 CTGTGGAGTCAGAGAAGACATGG + Intronic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1172447272 20:34999768-34999790 CTGTGGATACAGAGCAGGCAGGG - Intronic
1172854002 20:37987230-37987252 CTCTGGTTTCAGCTAAGGCTGGG - Intronic
1173228840 20:41178544-41178566 CTGTGGATTTGGATAAGGGAGGG - Exonic
1173673516 20:44814170-44814192 ATGTGGATCCAGAGAAGGAAGGG + Intergenic
1174488644 20:50876866-50876888 CTGTGGTCTCACATGAGGCAGGG - Exonic
1174635118 20:51992778-51992800 CTCTGGATTCAGATGAGCCTGGG + Intergenic
1178124823 21:29505097-29505119 CTGTGCCTTCAGGTATGGCAGGG + Intronic
1178321130 21:31606708-31606730 GTGTAGATTCACATAAGGCATGG + Intergenic
1178641965 21:34352114-34352136 CTGAGTATTCAGAAAGGGCATGG - Intergenic
1179765925 21:43573144-43573166 CTCTGGAATCAGAAAAAGCAGGG + Intronic
1184791168 22:46701057-46701079 CTGTGACTTCAGGTGAGGCACGG + Intronic
1185200955 22:49504561-49504583 CTATGGATTCAGACAAGCCCAGG - Intronic
949819441 3:8100155-8100177 CTGTGGTTTCAGTTCATGCAGGG + Intergenic
950856334 3:16109167-16109189 ATGTGGATTCAAATAAGAAATGG - Intergenic
952239789 3:31519221-31519243 TTCTGGTTTCAGATAAGGCAAGG + Intergenic
955623961 3:60896436-60896458 CTGTGGATTGGGGAAAGGCAAGG - Intronic
958027644 3:88067602-88067624 CTGTGGTGTCACAAAAGGCAAGG + Intronic
962407856 3:135115649-135115671 CTGTGGAATCAGGTAAACCAGGG + Intronic
964993898 3:162850565-162850587 CTATGGATTCAGAGAAGACAAGG + Intergenic
966685050 3:182684315-182684337 CAGTGTATTCAGGCAAGGCAAGG + Intergenic
969327043 4:6450109-6450131 CTTTGGAGTCAGACAAGGCTGGG + Intronic
970130221 4:12861249-12861271 CAGGGGATTCAGATATGGGAAGG - Intergenic
970602374 4:17650518-17650540 CTGTGGAGTCAGAAAAGCCAGGG + Intronic
971301589 4:25446550-25446572 CTGAGGGTGCAGATGAGGCAGGG + Intergenic
972161706 4:36235547-36235569 CCGTGGAGACAGATAAAGCAAGG - Intronic
972184994 4:36517915-36517937 CTGTAAATTCAGATAAGCCTGGG + Intergenic
974303721 4:60104486-60104508 GTGGGGATTCAGAGAAGGAATGG - Intergenic
974904564 4:68038821-68038843 ATGTGGGTACAGATAAGGCCCGG + Intergenic
976782290 4:88774252-88774274 CTGTGGAGAGAAATAAGGCAGGG - Intronic
981500507 4:145446192-145446214 CTATGGATTCAGGGAAGCCAAGG + Intergenic
982654534 4:158130964-158130986 CTGTGGATTCAGACCTCGCAAGG - Exonic
982793498 4:159618994-159619016 CTGTAGATTCTGGTAGGGCATGG + Intergenic
982936575 4:161485292-161485314 ATGTGGCTTCAGAAAAGCCAAGG + Intronic
983098279 4:163592613-163592635 CTGTGAATTCAAATAAGACTTGG - Intronic
984815767 4:183834556-183834578 CTGTGCATTTATATAAGGGAAGG + Intergenic
986256855 5:6108066-6108088 CTGTGCATTCAGATGTGCCATGG + Intergenic
987212372 5:15695792-15695814 CTCTGGATTCAGACAGGCCAGGG - Intronic
987381457 5:17289584-17289606 CAGAGGCTTCAGTTAAGGCAAGG + Intergenic
988798358 5:34673660-34673682 ATGTGGGGTCACATAAGGCAAGG - Intronic
989098420 5:37802378-37802400 CTGTGGAAGTAGAAAAGGCAAGG - Intergenic
992872325 5:81019365-81019387 CTGTGCGTTGAGATAAGTCACGG + Intronic
995764374 5:115600175-115600197 CTGTTTATTGAGATAAGGGAGGG + Intronic
996569097 5:124912971-124912993 CTCTGTCTTCCGATAAGGCAGGG - Intergenic
996868062 5:128152733-128152755 CAGTGCATTCAGGTAAGTCAGGG - Exonic
998892600 5:146762803-146762825 CTGTGGATTCATAGAAGGCCTGG + Intronic
999254801 5:150204360-150204382 CTTGGGACTCAGATAAGACAAGG + Intronic
999880921 5:155863097-155863119 CTGTGGCTTCACTGAAGGCAGGG + Intergenic
1001463802 5:171943768-171943790 ATGTTGAGTCAGCTAAGGCATGG - Intronic
1001531474 5:172465258-172465280 GTGTGGTGTAAGATAAGGCAGGG + Intergenic
1002931484 6:1637919-1637941 CTTTGGAGTCAGATAAGCCTGGG - Intronic
1003439712 6:6128285-6128307 TTGGGGATCCAGATAAGGGAAGG - Intergenic
1004199715 6:13536342-13536364 CTGTGGATTCCAAGAAGGGAGGG - Intergenic
1008159223 6:48057096-48057118 ATGTGGCTTCAGCTAAGGAAAGG - Intronic
1010462888 6:76133409-76133431 CTTTGGATTCAGACAAGGTAGGG + Intergenic
1010726606 6:79342087-79342109 CTGTTGTTTCAGATAAGGAATGG - Intergenic
1010847829 6:80732599-80732621 GTGTGGATTGAGATAAGTGATGG + Intergenic
1011500439 6:87982432-87982454 GGCTGGATTCTGATAAGGCAGGG - Intergenic
1012176947 6:96098843-96098865 CAGGGGATTTAGATGAGGCATGG + Intronic
1013280246 6:108629390-108629412 CAGTGGATTCAAGTAAGGTAAGG + Intronic
1013470683 6:110461118-110461140 CTGGGCTTTCAGAAAAGGCAGGG + Intronic
1014601013 6:123412192-123412214 TTGTGGTTTTAGTTAAGGCAAGG - Intronic
1016507669 6:144801410-144801432 CTGTGGCTTCAGAGAATGAATGG + Intronic
1016508035 6:144806582-144806604 CTGTGGCTTCAGAGAATGAATGG - Intronic
1017642466 6:156507627-156507649 CTGAGGTTTCAGGTGAGGCAGGG - Intergenic
1022103500 7:27183029-27183051 CTGTGGAGGGAGAAAAGGCATGG + Intronic
1023320993 7:38997478-38997500 CTAAGGATTCAGATGAGGCCAGG - Intronic
1028131171 7:87175472-87175494 CTTTGGATTGTGTTAAGGCATGG + Intronic
1028682710 7:93555317-93555339 GTGTGGATACAGTTAATGCAGGG + Intronic
1031818174 7:126466563-126466585 CTGGGGAATCAGAAAAGCCAGGG + Intronic
1031867862 7:127059098-127059120 CTGAGGACTCAGAAAAGGAAAGG + Intronic
1032605466 7:133346160-133346182 CTGAGGATACAGATTTGGCAAGG + Intronic
1032734270 7:134676494-134676516 CTCTGGAAACAGATAAAGCATGG + Intronic
1033411588 7:141123210-141123232 TTTTGGAATCAGATAAGGCTGGG + Intronic
1034605723 7:152311798-152311820 CTGTAGAATCAAATAAGGCTTGG + Exonic
1035083554 7:156237062-156237084 CTGTGGATTCTGATGTGCCAGGG + Intergenic
1036596927 8:10221711-10221733 CTGTTGATTAAAATAAAGCAGGG + Intronic
1037806397 8:22059998-22060020 CTGGTGGCTCAGATAAGGCAGGG + Intronic
1037844879 8:22274477-22274499 GTGTGGATTAAAATAAGTCATGG + Intergenic
1038098347 8:24341870-24341892 CTGTGGGTTCTATTAAGGCATGG - Intronic
1040724300 8:50363269-50363291 ATGTAAATTCAGGTAAGGCAGGG - Intronic
1042043168 8:64617040-64617062 CTATGGATTGTGATACGGCAGGG + Intronic
1042786679 8:72555077-72555099 CTTTGGATTAAGATAATGCTGGG + Intronic
1044308855 8:90669284-90669306 CTGTTTATTCAAAAAAGGCATGG - Intronic
1045003289 8:97896589-97896611 CAGTGGGATCAGATAATGCAGGG + Intronic
1045271222 8:100663383-100663405 CTGTGCATTCAAAAAAGGCTTGG - Intronic
1046028352 8:108752079-108752101 CTGTGTTTTCATATAAGGTAAGG - Intronic
1046976907 8:120289279-120289301 ATGTGCATTCAGAAAAGGCATGG + Intronic
1048196511 8:132336139-132336161 CTGTGCATTCCCATAGGGCAGGG + Intronic
1049117660 8:140703340-140703362 CTGTAGAAGCTGATAAGGCAAGG + Intronic
1049364009 8:142227647-142227669 CTGTGTGTTCACATTAGGCAGGG - Intronic
1050081413 9:1919735-1919757 AGGTGGATTCAAATAAGGAAAGG + Intergenic
1053410625 9:37914148-37914170 CTGTGGACTCTGATGAGGAAGGG + Intronic
1055820422 9:80254986-80255008 CTCTGGAAGCAGAAAAGGCAAGG + Intergenic
1056294737 9:85181374-85181396 CTCTGTAATCAGATCAGGCAAGG + Intergenic
1057737397 9:97677012-97677034 CTCTGGTTTCAGATAATGTAAGG + Intronic
1058656436 9:107225912-107225934 ATGTGTATTCAGATAGGGCTTGG + Intergenic
1058748544 9:108016023-108016045 CTGTGGATAAAAATAAAGCAAGG - Intergenic
1061503391 9:131016516-131016538 CTGGGAATTCAAATAAGGGAAGG + Intronic
1062331229 9:136045826-136045848 CTGTGGATCCAGATGTGCCAAGG + Intronic
1187550642 X:20301360-20301382 CTGTGGGTTAAGTTAAGCCATGG - Intergenic
1188170917 X:26925039-26925061 CTGTGGAGACAGATAAGCAAAGG + Intergenic
1191708735 X:64123687-64123709 CTGAAGATCCAGATAAGACAAGG + Intergenic
1193802846 X:85957347-85957369 TACTGGATTCAGAAAAGGCATGG - Intronic
1195135493 X:101903355-101903377 CTGTGGATTGAGAGGAGGTAGGG - Intronic
1195870121 X:109476921-109476943 CTGTGATGTCAGACAAGGCAAGG + Intronic
1196205001 X:112929426-112929448 CTGTGGATTCAGTCAAGAGAAGG - Intergenic