ID: 1087276623

View in Genome Browser
Species Human (GRCh38)
Location 11:96167348-96167370
Sequence AAGGAAGTCTGGCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 964
Summary {0: 1, 1: 0, 2: 2, 3: 74, 4: 887}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087276623_1087276629 9 Left 1087276623 11:96167348-96167370 CCTTCCTCCTGCCAGACTTCCTT 0: 1
1: 0
2: 2
3: 74
4: 887
Right 1087276629 11:96167380-96167402 CCACTTTATGCCTTCCACACTGG 0: 1
1: 0
2: 4
3: 11
4: 143
1087276623_1087276631 19 Left 1087276623 11:96167348-96167370 CCTTCCTCCTGCCAGACTTCCTT 0: 1
1: 0
2: 2
3: 74
4: 887
Right 1087276631 11:96167390-96167412 CCTTCCACACTGGCCCCCAGAGG 0: 1
1: 0
2: 2
3: 38
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087276623 Original CRISPR AAGGAAGTCTGGCAGGAGGA AGG (reversed) Intronic