ID: 1087276624

View in Genome Browser
Species Human (GRCh38)
Location 11:96167352-96167374
Sequence TGTGAAGGAAGTCTGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 327}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087276624_1087276631 15 Left 1087276624 11:96167352-96167374 CCTCCTGCCAGACTTCCTTCACA 0: 1
1: 0
2: 0
3: 31
4: 327
Right 1087276631 11:96167390-96167412 CCTTCCACACTGGCCCCCAGAGG 0: 1
1: 0
2: 2
3: 38
4: 291
1087276624_1087276629 5 Left 1087276624 11:96167352-96167374 CCTCCTGCCAGACTTCCTTCACA 0: 1
1: 0
2: 0
3: 31
4: 327
Right 1087276629 11:96167380-96167402 CCACTTTATGCCTTCCACACTGG 0: 1
1: 0
2: 4
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087276624 Original CRISPR TGTGAAGGAAGTCTGGCAGG AGG (reversed) Intronic