ID: 1087276626 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:96167359-96167381 |
| Sequence | GGATTAGTGTGAAGGAAGTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 207 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 18, 4: 188} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1087276626_1087276631 | 8 | Left | 1087276626 | 11:96167359-96167381 | CCAGACTTCCTTCACACTAATCC | 0: 1 1: 0 2: 0 3: 18 4: 188 |
||
| Right | 1087276631 | 11:96167390-96167412 | CCTTCCACACTGGCCCCCAGAGG | 0: 1 1: 0 2: 2 3: 38 4: 291 |
||||
| 1087276626_1087276629 | -2 | Left | 1087276626 | 11:96167359-96167381 | CCAGACTTCCTTCACACTAATCC | 0: 1 1: 0 2: 0 3: 18 4: 188 |
||
| Right | 1087276629 | 11:96167380-96167402 | CCACTTTATGCCTTCCACACTGG | 0: 1 1: 0 2: 4 3: 11 4: 143 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1087276626 | Original CRISPR | GGATTAGTGTGAAGGAAGTC TGG (reversed) | Intronic | ||