ID: 1087276627

View in Genome Browser
Species Human (GRCh38)
Location 11:96167367-96167389
Sequence CATAAAGTGGATTAGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087276627_1087276631 0 Left 1087276627 11:96167367-96167389 CCTTCACACTAATCCACTTTATG 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1087276631 11:96167390-96167412 CCTTCCACACTGGCCCCCAGAGG 0: 1
1: 0
2: 2
3: 38
4: 291
1087276627_1087276629 -10 Left 1087276627 11:96167367-96167389 CCTTCACACTAATCCACTTTATG 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1087276629 11:96167380-96167402 CCACTTTATGCCTTCCACACTGG 0: 1
1: 0
2: 4
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087276627 Original CRISPR CATAAAGTGGATTAGTGTGA AGG (reversed) Intronic