ID: 1087276627 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:96167367-96167389 |
Sequence | CATAAAGTGGATTAGTGTGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 151 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 144} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1087276627_1087276631 | 0 | Left | 1087276627 | 11:96167367-96167389 | CCTTCACACTAATCCACTTTATG | 0: 1 1: 0 2: 0 3: 6 4: 144 |
||
Right | 1087276631 | 11:96167390-96167412 | CCTTCCACACTGGCCCCCAGAGG | 0: 1 1: 0 2: 2 3: 38 4: 291 |
||||
1087276627_1087276629 | -10 | Left | 1087276627 | 11:96167367-96167389 | CCTTCACACTAATCCACTTTATG | 0: 1 1: 0 2: 0 3: 6 4: 144 |
||
Right | 1087276629 | 11:96167380-96167402 | CCACTTTATGCCTTCCACACTGG | 0: 1 1: 0 2: 4 3: 11 4: 143 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1087276627 | Original CRISPR | CATAAAGTGGATTAGTGTGA AGG (reversed) | Intronic | ||