ID: 1087276629

View in Genome Browser
Species Human (GRCh38)
Location 11:96167380-96167402
Sequence CCACTTTATGCCTTCCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 143}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087276621_1087276629 29 Left 1087276621 11:96167328-96167350 CCTTCAATCTTCCTAGCTGGCCT 0: 1
1: 0
2: 1
3: 10
4: 144
Right 1087276629 11:96167380-96167402 CCACTTTATGCCTTCCACACTGG 0: 1
1: 0
2: 4
3: 11
4: 143
1087276623_1087276629 9 Left 1087276623 11:96167348-96167370 CCTTCCTCCTGCCAGACTTCCTT 0: 1
1: 0
2: 2
3: 74
4: 887
Right 1087276629 11:96167380-96167402 CCACTTTATGCCTTCCACACTGG 0: 1
1: 0
2: 4
3: 11
4: 143
1087276622_1087276629 18 Left 1087276622 11:96167339-96167361 CCTAGCTGGCCTTCCTCCTGCCA 0: 1
1: 0
2: 3
3: 59
4: 553
Right 1087276629 11:96167380-96167402 CCACTTTATGCCTTCCACACTGG 0: 1
1: 0
2: 4
3: 11
4: 143
1087276624_1087276629 5 Left 1087276624 11:96167352-96167374 CCTCCTGCCAGACTTCCTTCACA 0: 1
1: 0
2: 0
3: 31
4: 327
Right 1087276629 11:96167380-96167402 CCACTTTATGCCTTCCACACTGG 0: 1
1: 0
2: 4
3: 11
4: 143
1087276627_1087276629 -10 Left 1087276627 11:96167367-96167389 CCTTCACACTAATCCACTTTATG 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1087276629 11:96167380-96167402 CCACTTTATGCCTTCCACACTGG 0: 1
1: 0
2: 4
3: 11
4: 143
1087276625_1087276629 2 Left 1087276625 11:96167355-96167377 CCTGCCAGACTTCCTTCACACTA 0: 1
1: 0
2: 0
3: 18
4: 149
Right 1087276629 11:96167380-96167402 CCACTTTATGCCTTCCACACTGG 0: 1
1: 0
2: 4
3: 11
4: 143
1087276626_1087276629 -2 Left 1087276626 11:96167359-96167381 CCAGACTTCCTTCACACTAATCC 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1087276629 11:96167380-96167402 CCACTTTATGCCTTCCACACTGG 0: 1
1: 0
2: 4
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087276629 Original CRISPR CCACTTTATGCCTTCCACAC TGG Intronic