ID: 1087277137

View in Genome Browser
Species Human (GRCh38)
Location 11:96171849-96171871
Sequence CTGAGAATGGAGAAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 599
Summary {0: 1, 1: 0, 2: 2, 3: 69, 4: 527}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087277137_1087277144 15 Left 1087277137 11:96171849-96171871 CCTGCCACCTTCTCCATTCTCAG 0: 1
1: 0
2: 2
3: 69
4: 527
Right 1087277144 11:96171887-96171909 GAAGCACTGCTGGTGTCACAAGG 0: 1
1: 0
2: 0
3: 13
4: 160
1087277137_1087277141 5 Left 1087277137 11:96171849-96171871 CCTGCCACCTTCTCCATTCTCAG 0: 1
1: 0
2: 2
3: 69
4: 527
Right 1087277141 11:96171877-96171899 TCCCTCAGAAGAAGCACTGCTGG 0: 1
1: 0
2: 1
3: 15
4: 191
1087277137_1087277146 20 Left 1087277137 11:96171849-96171871 CCTGCCACCTTCTCCATTCTCAG 0: 1
1: 0
2: 2
3: 69
4: 527
Right 1087277146 11:96171892-96171914 ACTGCTGGTGTCACAAGGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 196
1087277137_1087277145 16 Left 1087277137 11:96171849-96171871 CCTGCCACCTTCTCCATTCTCAG 0: 1
1: 0
2: 2
3: 69
4: 527
Right 1087277145 11:96171888-96171910 AAGCACTGCTGGTGTCACAAGGG 0: 1
1: 0
2: 0
3: 15
4: 119
1087277137_1087277147 21 Left 1087277137 11:96171849-96171871 CCTGCCACCTTCTCCATTCTCAG 0: 1
1: 0
2: 2
3: 69
4: 527
Right 1087277147 11:96171893-96171915 CTGCTGGTGTCACAAGGGCTGGG 0: 1
1: 1
2: 3
3: 14
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087277137 Original CRISPR CTGAGAATGGAGAAGGTGGC AGG (reversed) Intronic
900625688 1:3607567-3607589 GTGAGGATGGAGAAGGTGGCAGG + Intronic
900641931 1:3691668-3691690 CTGCTAATTGAGAAGGTGGAAGG + Intronic
900690442 1:3977498-3977520 GTGACAAGGGAGAAGGTGGAAGG + Intergenic
900973358 1:6003437-6003459 CTAAGAGTGGAGAAGGTGGACGG - Intronic
901193311 1:7425430-7425452 CTGTGAATGGCGATGGGGGCAGG + Intronic
901301027 1:8200291-8200313 TTGGGAATGGAGAGGGTGTCTGG + Intergenic
901386126 1:8910474-8910496 TGGAGAATGAGGAAGGTGGCAGG + Intergenic
901971861 1:12914536-12914558 CTGTGAGTGGAGAAGGGGTCAGG + Intronic
902013307 1:13287204-13287226 CTGTGAGTGGAGAAGGGGTCAGG - Intergenic
902150091 1:14435830-14435852 CTTAGAATGGGGATGGTGACAGG + Intergenic
902150098 1:14435865-14435887 CTTAGAATGGGGATGGTGACAGG + Intergenic
902669313 1:17961643-17961665 CTGAGACTGGAGAGACTGGCAGG - Intergenic
902762015 1:18587428-18587450 CTGAGAATGGGGATGAGGGCAGG + Intergenic
903305172 1:22408196-22408218 CTGAGAATAGAGGGGGTGGAGGG + Intergenic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
903682281 1:25104976-25104998 ATAAGAATGGAGAGGCTGGCAGG - Intergenic
903811792 1:26038782-26038804 CTGAGAATGGGGCATGAGGCAGG + Exonic
903813777 1:26049767-26049789 CTGAGTCTGGAGATGGTGGGAGG - Intergenic
903828961 1:26163638-26163660 CCGAGAAGGAAGAAGGGGGCCGG - Intergenic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
903974134 1:27138184-27138206 GTGAGAATGGAGAAGAGGGCAGG - Intronic
903976496 1:27153833-27153855 CTGAGAAGGACCAAGGTGGCAGG + Intronic
904528578 1:31153644-31153666 GTGAGAATGGAAAATGGGGCTGG + Intergenic
904577478 1:31514278-31514300 CTGAGATGGGAGCAGGTGCCAGG + Intergenic
904985279 1:34542045-34542067 CTAAGACTGGAGTAGGAGGCAGG + Intergenic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905098703 1:35499005-35499027 CTGAGACTGGAGAATATGGCAGG + Intronic
905124154 1:35705568-35705590 CTGAGAATGGAGAAGTGGATGGG - Intergenic
905473494 1:38209814-38209836 CTGGGGATGCAGAAGCTGGCGGG + Intergenic
905906121 1:41619606-41619628 ATGAGGATGGTGATGGTGGCTGG + Intronic
905948370 1:41923473-41923495 CAGAGGCTGGAGGAGGTGGCGGG + Intronic
906101455 1:43266384-43266406 CTGAGAAGGGAGTGGGTGCCTGG + Intronic
906116741 1:43362091-43362113 CTGAGTCTGGAGCATGTGGCAGG + Intronic
906156562 1:43617419-43617441 CAGAGAATGGAGAAAGCGGGTGG - Intronic
906190718 1:43898045-43898067 CTGAGAAAGGAGGTGATGGCAGG - Intronic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
908733799 1:67254992-67255014 ATGCGGATGGAGAAGGAGGCTGG - Intronic
909551706 1:76905219-76905241 CTGAGAAAGGATGAGGTGGCGGG + Intronic
911210479 1:95133630-95133652 CTGAGAATGGGGTAGATGGATGG + Intronic
911621591 1:100071853-100071875 CTGAGAGTGCAGAATCTGGCAGG + Intronic
911625364 1:100117824-100117846 TTAAGAATTAAGAAGGTGGCAGG + Intronic
911710539 1:101066656-101066678 ATGAGAAGGGAGAGAGTGGCAGG + Intergenic
913125231 1:115780973-115780995 ATGAGATTGGAGAAGATGGCTGG - Intergenic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915301286 1:154953048-154953070 CTGAGGAGGGAGAAGGGGGTTGG - Intronic
915354690 1:155249010-155249032 CTGAGAAAGGAGACAGTGGCCGG - Intronic
915604281 1:156941002-156941024 ATGAGAATGGAAAACATGGCGGG - Intronic
915938477 1:160103066-160103088 CTGGGAATGGAGAAGTGGGATGG - Intergenic
916584407 1:166137955-166137977 CTCAGAACAGAGCAGGTGGCTGG + Intronic
916864000 1:168836850-168836872 CTGAGAAAGGAGAATCAGGCAGG - Intergenic
917404025 1:174684319-174684341 ATGAGATTGGAGAAGGTGAGAGG + Intronic
917412939 1:174778888-174778910 ATAAAAATGCAGAAGGTGGCCGG - Intronic
917707427 1:177648530-177648552 CTGAGAATGGAGAAGAGAGGAGG - Intergenic
919210359 1:194474942-194474964 ATGAAAATGCAGAAGGTGACTGG + Intergenic
919402528 1:197137640-197137662 CTGATAATGCAGAAGTTGGCTGG - Intronic
919422165 1:197383367-197383389 CAGAGAATGGAGAGCGTAGCGGG - Intronic
920212332 1:204337237-204337259 CTGGGAAGGGAGGAGCTGGCTGG - Intronic
920497325 1:206464572-206464594 GTGGGGAGGGAGAAGGTGGCTGG - Intergenic
920550623 1:206857670-206857692 TTGAGGATGGAGAATGTGGCAGG - Intergenic
921131225 1:212221695-212221717 AAGACAATGGAGAAGGTGGCTGG + Intergenic
921165911 1:212506999-212507021 CTGAGAGTGGGGAAGGTAGGAGG - Intergenic
921729679 1:218563419-218563441 ATGAAAATGAAGAAGGTAGCTGG - Intergenic
921841850 1:219836630-219836652 CTGAGATTGAAGAAAGAGGCTGG - Intronic
921929849 1:220746359-220746381 CTGTGCATGCAGCAGGTGGCGGG - Intergenic
922226848 1:223652871-223652893 CTGCCAATGGAGAAGGAGGCTGG - Intronic
922742078 1:228019708-228019730 TAGAGAATGGAGAGGGTGGTGGG - Intronic
924149179 1:241110524-241110546 CAGAGAATGCAGAAGATGCCTGG + Intronic
1063579528 10:7293195-7293217 CTGAGGCTGGAGATGGTGGTGGG - Intronic
1064155736 10:12901780-12901802 CTAAGACTGGAGATGTTGGCCGG - Intronic
1064331848 10:14401592-14401614 CTGAGCATGGAGAGGGAGGAGGG - Intronic
1065567699 10:27031518-27031540 CTAGGATTGGAGAAGGTGGAGGG + Intronic
1065771347 10:29081626-29081648 GTGAGAATGGAGGAGGTTGTTGG - Intergenic
1065828466 10:29593589-29593611 CCGAGATTTGAGAAGGAGGCCGG - Intronic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1065961136 10:30735203-30735225 GGGAGAATGGAGAAGAGGGCGGG - Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066298229 10:34074825-34074847 CTGAGAATGATGCTGGTGGCTGG - Intergenic
1067159842 10:43816501-43816523 CAGAGAATGGCGGATGTGGCTGG + Intergenic
1069532319 10:69228522-69228544 CTGAGAATGGAAGAGTTGGATGG - Intronic
1069565234 10:69459630-69459652 CTGTGGGTGGAGAGGGTGGCAGG + Intronic
1069744148 10:70704210-70704232 CTGACAGTGGAGCAGGGGGCTGG - Intronic
1069756338 10:70776290-70776312 CAGAGAATGGAGAAGGGCCCAGG - Intronic
1070170656 10:73930311-73930333 ATGAGAATGGAAACAGTGGCTGG + Intergenic
1070567590 10:77615424-77615446 CTGAGGCTGCAGAAGGTGGGTGG + Intronic
1070690202 10:78518656-78518678 CTGAGAATGTAGCATCTGGCAGG + Intergenic
1070754943 10:78986086-78986108 CTCAGAATGGTGAAGGTGGAGGG + Intergenic
1071658033 10:87470365-87470387 CTCAGCAAGGAGAATGTGGCAGG + Intergenic
1071754950 10:88527240-88527262 CTGGGGATGGGGAAGGTTGCTGG - Intronic
1072628054 10:97126969-97126991 CTGAGAATGGCGTAGATGGGAGG - Intronic
1072799397 10:98382699-98382721 CTGGAACTGGAGAAGCTGGCTGG + Intergenic
1073048154 10:100652080-100652102 GTGAGACTGGTGAAGGTGGTGGG - Intergenic
1073063765 10:100746617-100746639 CTGACTAGGGAGAGGGTGGCTGG - Intronic
1073930409 10:108567808-108567830 CTGAGAATGGAGGAGGTTGAGGG - Intergenic
1074080864 10:110167097-110167119 CTCAGGCTGGAGAAGGGGGCTGG - Intergenic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1076022968 10:127089470-127089492 CTGAGAGTGGAGATTGAGGCTGG - Intronic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076185906 10:128448567-128448589 CTGATAATGAAGATGGAGGCAGG + Intergenic
1076222500 10:128745763-128745785 CTGATAGGGGAGAAGGGGGCAGG + Intergenic
1076838411 10:133032723-133032745 ATGAGGAGGGAGAAGGGGGCAGG - Intergenic
1077817045 11:5696144-5696166 CTGAGAATGTTGAAGGGGACAGG - Intronic
1077892360 11:6428571-6428593 ATGAGACTGGAGAGGGAGGCAGG - Intergenic
1078273863 11:9823807-9823829 CAGAGAATGTTGAAGGTGTCAGG + Intronic
1079106403 11:17574976-17574998 CTGAGACTGGGGAACCTGGCTGG + Intronic
1081276872 11:41160648-41160670 TTGAGTATGGTGCAGGTGGCTGG + Intronic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1083272693 11:61580305-61580327 CTGTGAATTGAGAGGGTGCCAGG - Intronic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084152874 11:67299395-67299417 CCCAAAATGGAGGAGGTGGCAGG - Intronic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1084952521 11:72674443-72674465 CTGATAATGCAGAAGGGGGAGGG + Exonic
1085101578 11:73805204-73805226 CTGAGAATGGGGAAGGAGCAAGG - Intronic
1086073820 11:82828855-82828877 CAGAGATTGGAGAAGATGGCAGG - Intronic
1086487635 11:87325546-87325568 CAGAGAATGGACAAGGTGGCAGG - Intergenic
1086817725 11:91393916-91393938 ATGACCATGGAGTAGGTGGCTGG + Intergenic
1086920943 11:92585952-92585974 ATGTGAAGGGAGAAGGTGGCTGG + Intronic
1087044807 11:93836072-93836094 ATGAGGAAGGAGAAGGTGTCAGG - Intronic
1087185449 11:95187910-95187932 GTGAGGATGGAGAAAGTGGGTGG - Intronic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1087655506 11:100917963-100917985 CTGATAATGGTGAAGGTGTCTGG - Intronic
1088701599 11:112417964-112417986 ATGAGGATGGAATAGGTGGCAGG + Intergenic
1088940216 11:114446749-114446771 ATGAGGTTGGAGAAGGTGGGAGG + Intronic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1090124997 11:124075885-124075907 CTGAGATTGGAGTGGGTGCCAGG + Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1090717686 11:129444674-129444696 GAGGTAATGGAGAAGGTGGCCGG + Intronic
1090913752 11:131144409-131144431 AGGAGAGTGGAGAAGTTGGCAGG - Intergenic
1091241115 11:134053123-134053145 CTCAGCATGGAGACGGGGGCGGG + Intergenic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1092146276 12:6216795-6216817 CTGTGATCGGAGAAGGCGGCTGG - Intronic
1092896051 12:13011358-13011380 CTGAGAAGGAAGAAGGTTACAGG + Intergenic
1093456647 12:19371458-19371480 CTCAGAAGGGAGAGGGTGGAAGG - Intronic
1095828763 12:46560181-46560203 ATGAAAATGGAGAAGAAGGCAGG + Intergenic
1096577959 12:52566349-52566371 CTGATAATGAAGGAGGTGGGTGG + Exonic
1096582018 12:52591845-52591867 ATGAGAATGTAGAAGGGTGCAGG - Intronic
1096747499 12:53738434-53738456 CTGAGAGCGGAGCAGATGGCGGG - Intergenic
1097014274 12:55974254-55974276 CGGAGAGGGGAGAAGGGGGCCGG + Intronic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1097527733 12:60759382-60759404 TTGAAGATGGAGAAGGGGGCAGG - Intergenic
1097694425 12:62762874-62762896 CCGAGAAGGGAGAGGCTGGCAGG + Intronic
1097983158 12:65754956-65754978 CTCAGGAGGGAGAAGGGGGCGGG + Intergenic
1099938037 12:89151394-89151416 CTCAGAATGGGGAGGGTGGAAGG + Intergenic
1100067005 12:90661255-90661277 CTGAGAATGGATAAGCTAGATGG + Intergenic
1101217033 12:102595327-102595349 CTGAGGATGGTGAAGATAGCTGG + Intergenic
1101555898 12:105809052-105809074 TTGAGTATGGTAAAGGTGGCAGG - Intergenic
1102022598 12:109694581-109694603 GTAAGAATGGAGATGGAGGCCGG + Intergenic
1102486418 12:113260753-113260775 CTGAGAAGAGGGAGGGTGGCAGG - Intronic
1102521903 12:113483002-113483024 CTGCAAATGGAGCAGCTGGCTGG + Intergenic
1103147327 12:118606933-118606955 ATGAGACAGGAGAAGTTGGCAGG - Intergenic
1103277390 12:119723992-119724014 CTTAAAAAAGAGAAGGTGGCCGG + Intronic
1104787268 12:131457728-131457750 CTGTGGATGGAGAACCTGGCTGG - Intergenic
1104950988 12:132439927-132439949 CCGGAAATGGAGAAGGTGGCTGG + Intergenic
1105002375 12:132699086-132699108 CAGAGACTTGAAAAGGTGGCGGG - Intronic
1105500208 13:20965292-20965314 CTGAGCATGTAAAATGTGGCTGG + Intergenic
1105831404 13:24165540-24165562 CTGAGAGAGGAGAAGAGGGCAGG - Intronic
1106480913 13:30136145-30136167 GTGGGAATGGAGAAGGAGACAGG - Intergenic
1111459414 13:88519977-88519999 CTTAAAAGGGTGAAGGTGGCCGG + Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1113711203 13:112466664-112466686 CTGTGCATGGAGAAGCTGGGAGG - Intergenic
1113778630 13:112963170-112963192 CTGAGAGTGGTGGAGGTGGGTGG - Intronic
1113849170 13:113408113-113408135 CTGAGGATGGAGTGGGCGGCCGG + Intergenic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1114686012 14:24532396-24532418 AAGAGATTGGAGAAGGGGGCTGG - Intergenic
1114959525 14:27867599-27867621 CTAAGAATGGAGTAGGTGAGAGG - Intergenic
1115488290 14:33934181-33934203 CTGGGAATGGGGATGGTGGGAGG - Intronic
1117162035 14:52999437-52999459 CTGTGAATGTAGAAGGTGGGGGG + Intergenic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118849760 14:69574323-69574345 CTGGGGATGGAGAAGGTGCCTGG + Intronic
1118970654 14:70634447-70634469 CAGAGAATGGATTGGGTGGCAGG + Intergenic
1119774943 14:77242509-77242531 CTGAGACTGAAGAAGGCAGCAGG + Intronic
1119972300 14:78984851-78984873 ATGAGACTGGAGAAGGAGGCAGG + Intronic
1121158182 14:91707131-91707153 ATGAGTTTGGAGAAGCTGGCAGG - Intronic
1121456698 14:94043095-94043117 GTGAGGAGGGAGAAGGTGGTGGG - Intronic
1121553426 14:94819356-94819378 CTGAGATTGGAGCAGGTGCCAGG + Intergenic
1121616506 14:95317328-95317350 CTGGGAGTGGAGATGGGGGCAGG - Intronic
1122151522 14:99728552-99728574 CTGGAAATGGAGAGGGTGGAGGG - Intergenic
1123020405 14:105395339-105395361 CTGAGAGTGGGGAAGGTGTGAGG - Exonic
1124259680 15:28177502-28177524 CTGTGAATGTTGCAGGTGGCCGG - Exonic
1124347548 15:28932579-28932601 CTGACAGTGGAGATGGTGGACGG + Intronic
1124431818 15:29614735-29614757 CTGGGAAGGTAGAAGGTGGCAGG + Intergenic
1124825195 15:33087248-33087270 ATAAGAAAGGAGAAGGTAGCTGG + Intronic
1125128645 15:36255044-36255066 CAGAGAGTGGGGAAGGTGGGGGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126185787 15:45829533-45829555 CTGAGAATGGAGCAGGTGCTAGG + Intergenic
1126974237 15:54156737-54156759 CTGAGAGTAGAGAAGCTGGACGG + Intronic
1127451279 15:59118781-59118803 CTGAAAAAGGAGGAGATGGCAGG - Intronic
1127735808 15:61838395-61838417 CTGAGAATGTGACAGGTGGCTGG - Intergenic
1128614421 15:69098315-69098337 CTGAGGATGGAGAGTGTGCCAGG + Intergenic
1128674441 15:69598194-69598216 ATGAGAAGGGAGAAAGTGGATGG + Intergenic
1129071840 15:72957847-72957869 TTAAGAATGGAAAAGTTGGCCGG - Intergenic
1129167831 15:73788772-73788794 TGGAGTATAGAGAAGGTGGCAGG + Intergenic
1129384925 15:75191163-75191185 CTGGGCCTGGATAAGGTGGCTGG + Intergenic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132709167 16:1258864-1258886 CTCAGGATGGAGGAGGGGGCAGG - Exonic
1133970543 16:10564689-10564711 CTGAGAATGGTGGTGGTGGATGG - Intronic
1134717929 16:16366156-16366178 CTGAAAATGGACAAGCTGCCCGG - Intergenic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1134956822 16:18386003-18386025 CTGAAAATGGACAAGCTGCCCGG + Intergenic
1135711999 16:24725542-24725564 CTGAGAATGGAGAGAGGAGCTGG - Intergenic
1136021127 16:27440752-27440774 TTGAAAGTGAAGAAGGTGGCTGG + Intronic
1136155035 16:28376825-28376847 CTGAGACAGGAGAATGAGGCAGG - Intergenic
1136402019 16:30024374-30024396 CTGGGAAGGGAGGAGGTGGGGGG - Exonic
1137488327 16:48909953-48909975 CTGAGAGTGGGGATGATGGCAGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1138462506 16:57159351-57159373 CTGCAAATGCAGAAGTTGGCAGG - Intronic
1138749217 16:59398631-59398653 CTGAGGATTGAGAAGGAGCCAGG - Intergenic
1139625974 16:68188428-68188450 CTGCCAATTCAGAAGGTGGCGGG + Intronic
1139705978 16:68741002-68741024 CTGAGAATGGAGGTGTTGACAGG + Intronic
1140879572 16:79185713-79185735 TTGAGAGCAGAGAAGGTGGCAGG + Intronic
1141046134 16:80717603-80717625 AGGAGACTGGAGAAGGTGTCTGG - Intronic
1141104100 16:81219000-81219022 TTGAGAATGGACAAGGAGGCTGG - Intergenic
1141202812 16:81910729-81910751 CTGAGGGTGGAGCAGGAGGCAGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141263572 16:82475571-82475593 CTGAGGATGCAGAGGCTGGCAGG - Intergenic
1141636384 16:85316167-85316189 CTGAAAATGGAATAGGTGGCTGG - Intergenic
1141799837 16:86299340-86299362 ATGAGAATGAAGAAGATGACAGG - Intergenic
1142169965 16:88616582-88616604 CTGATAAGGGAGAAGGAAGCAGG - Intronic
1142796786 17:2314152-2314174 TTGAGAATGCAGAAGGAGCCGGG + Intronic
1142966563 17:3585548-3585570 CTGAGAAGCGGGAAGGGGGCGGG + Intronic
1143658861 17:8312679-8312701 CTGAAAACGGAGAAGATGGGTGG - Intronic
1143863691 17:9908934-9908956 GGGGGTATGGAGAAGGTGGCGGG + Intergenic
1144501328 17:15787997-15788019 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1144863080 17:18317953-18317975 CTGAGCAGGGAGTAGATGGCTGG - Exonic
1145163503 17:20590671-20590693 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1147043791 17:37737987-37738009 TTCAGAAAGGAGAAGGAGGCAGG - Intronic
1148018787 17:44540167-44540189 TTGAGAGTGGAGAAGGAGGGGGG - Intergenic
1148114554 17:45167980-45168002 CTGAGGCTGGAGAATGTGGGCGG - Intronic
1148748466 17:49931348-49931370 AGGAGAATGGAGGAGCTGGCTGG - Intergenic
1148805132 17:50260066-50260088 CTGAGACTGGAGAAGCTGGAGGG - Intergenic
1149604637 17:57916202-57916224 CTGAGAATGCAGAAGGCCGAGGG + Intronic
1149678449 17:58487547-58487569 CTGAGAACGGCGGCGGTGGCGGG + Intronic
1150331868 17:64300905-64300927 CTTAGAATGGAAAAGGCCGCCGG + Intergenic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150621031 17:66807811-66807833 CTGAGAAGGGAGAGGGAGGCGGG + Exonic
1150719945 17:67605743-67605765 CTGATAACGGCGCAGGTGGCTGG - Intronic
1150985846 17:70196225-70196247 ATGGGAAGAGAGAAGGTGGCTGG + Intergenic
1151290305 17:73145079-73145101 TTGGGAATGGAGATGTTGGCTGG - Intergenic
1151521092 17:74630231-74630253 CAGAAAATGCAGATGGTGGCCGG + Intergenic
1151690257 17:75679660-75679682 AGGAGATTGGAGAAGGAGGCTGG + Intronic
1152235812 17:79137816-79137838 CTGAGAAGGCAGAGTGTGGCTGG - Intronic
1153253596 18:3148549-3148571 TTGAAAATGGTGATGGTGGCCGG + Intronic
1153562535 18:6385559-6385581 CTTTGAATGGAGATGGTGGTAGG - Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154132603 18:11750242-11750264 CTGAGAAAGGAGCAGGTAGAAGG + Intronic
1154172926 18:12063780-12063802 TAGAGAAGGGAGCAGGTGGCCGG + Intergenic
1155930024 18:31697307-31697329 CAGCAAATGGAGAAGATGGCAGG + Intergenic
1156105683 18:33657337-33657359 CTGAGAATTGGGAGGCTGGCAGG + Intronic
1156475111 18:37401021-37401043 CTGAGAATAGAGTAGGTGTGGGG + Intronic
1156653254 18:39252346-39252368 GAGAGATTGGAGAAGGTGGGGGG - Intergenic
1156692246 18:39722263-39722285 CTGATAATTCAGAAGGTGGTGGG + Intergenic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157623398 18:49028990-49029012 CAAAGAATGGAGAATGTGGCTGG - Intergenic
1159190583 18:65036595-65036617 TAGAGAGTGGCGAAGGTGGCAGG + Intergenic
1159623788 18:70669272-70669294 CTGAGATTGGAGAAGGAGTCAGG - Intergenic
1160028144 18:75235883-75235905 CTCAGAATGGAAGAGCTGGCTGG - Intronic
1160210110 18:76870799-76870821 CTGAGAAGCAGGAAGGTGGCTGG + Intronic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1161062684 19:2223018-2223040 CCGAGAATGAAGAAGCTTGCAGG - Intronic
1161255933 19:3309544-3309566 CTCAGAGTGGAAAATGTGGCTGG + Intergenic
1161498626 19:4600850-4600872 CTGAGAAGGGAGCAGCTGGCAGG - Intergenic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1162207989 19:9070330-9070352 CTCAGAATGGAGGAGGAGGAGGG + Intergenic
1162784321 19:13024794-13024816 CTGAGATGGGAGCAAGTGGCTGG + Intronic
1163057338 19:14730349-14730371 CTGAAAATGAAGACAGTGGCCGG - Intronic
1163282991 19:16328404-16328426 CTGAGAATGGGGAAGGTGAGGGG - Intergenic
1163539072 19:17896075-17896097 CTGAGATGGGAGGAGGTGCCCGG + Intergenic
1163647512 19:18498200-18498222 CTGAGAATGGGGGAGGCTGCAGG + Intronic
1164848031 19:31451053-31451075 CTGAGAAAGCAGGAGGTGTCAGG + Intergenic
1165281983 19:34805570-34805592 CTGGAAATGGAGAAAGTGGCTGG - Intergenic
1165577890 19:36837395-36837417 CTGAAAATGGAACAGATGGCCGG + Intronic
1165767226 19:38359194-38359216 CTGAGGGTCGAGAGGGTGGCTGG - Intronic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166205784 19:41267853-41267875 ATGAGAATGGAGAATGTTACTGG - Intronic
1167077797 19:47259828-47259850 ATGAGAACAGAGAGGGTGGCAGG + Intronic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
925031615 2:654199-654221 CAGACACTGGAGAAGGTGGGAGG + Intergenic
925276859 2:2656287-2656309 CAGACAATGAAGACGGTGGCAGG + Intergenic
926008405 2:9390193-9390215 CAGAGAATGGTGGAGATGGCAGG - Intronic
926938758 2:18113821-18113843 TTGAGAATGGAGAAAGACGCTGG - Intronic
927996934 2:27493479-27493501 CTGAGAAGGGAGAAGGCAGAAGG + Intronic
928096143 2:28406356-28406378 AAGAGAATGGAGAGCGTGGCCGG - Intronic
928275682 2:29898149-29898171 CTGGGGCTGGGGAAGGTGGCAGG - Intronic
928512232 2:32012188-32012210 CTGAAGTTGGAGAAGGTGGGAGG - Intronic
929189569 2:39126553-39126575 TTAAGAATGCAAAAGGTGGCCGG - Intergenic
929570002 2:43016715-43016737 GAGAGAAGGGAGAAGGTGCCAGG - Intergenic
931393517 2:61865272-61865294 CTGAGTAAGAAAAAGGTGGCTGG + Intergenic
932435478 2:71700608-71700630 CTGAGAATGGAGAAAGCAGAGGG - Intergenic
932865484 2:75336960-75336982 CTGAGGAGGGAGATGGAGGCTGG - Intergenic
933943139 2:87261961-87261983 CTGAGGAAGGAGAACGTGCCGGG - Intergenic
934541728 2:95180930-95180952 CTGGGAGTGAAGAAGGTGGCAGG - Intronic
935373370 2:102370534-102370556 CCGTGACTGGAGAATGTGGCAGG - Intronic
935744846 2:106181325-106181347 CTGAGAAGGGAGCATGTGCCGGG - Intronic
935785534 2:106545202-106545224 CAGTGAAAGGAGACGGTGGCAGG - Intergenic
935856171 2:107276828-107276850 CAAAGAATGGAGAAGGTTGATGG + Intergenic
936337073 2:111599602-111599624 CTGAGGAAGGAGAACGTGCCGGG + Intergenic
936477392 2:112851246-112851268 AAGAAAATGGAGAAGGTGCCAGG + Intergenic
937202127 2:120210422-120210444 CTGAAAACAGAGAAGGTGGCTGG + Intergenic
937334107 2:121050397-121050419 CTGCGACTGGAGCAGGAGGCTGG - Intergenic
938193211 2:129301184-129301206 CTGAGCATGGCCAAGATGGCTGG - Intergenic
938265071 2:129922770-129922792 CTGAGCCTGGAGGGGGTGGCCGG + Intergenic
938370773 2:130767125-130767147 CCATGAAGGGAGAAGGTGGCTGG + Exonic
939189275 2:138897288-138897310 ATGACAATGAAGACGGTGGCAGG + Intergenic
939498574 2:142952155-142952177 TTGAGCCTGGGGAAGGTGGCGGG - Intronic
940127453 2:150342941-150342963 CTCAGAATGCAGATGGTGCCTGG + Intergenic
940895866 2:159081439-159081461 CTGTGGATTGAGAATGTGGCAGG + Intronic
943663206 2:190580840-190580862 ATTAGAATTGAGAAGGTTGCAGG + Intergenic
944853291 2:203742399-203742421 CTAAAAATGTAGAAGGTGGCTGG - Intergenic
945075705 2:206037063-206037085 CTGAGAATGCACTAGGTGCCAGG - Intronic
945395244 2:209307853-209307875 CTGGGAGTGCAGAAGGGGGCAGG + Intergenic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
946787981 2:223268169-223268191 CTGAGAACAGAGTAGGTGGTGGG - Intergenic
947297854 2:228652666-228652688 CTGAGAACAGATATGGTGGCTGG + Intergenic
947910620 2:233798662-233798684 CTGAGCTTGGAGAATGTGGGAGG + Intronic
947992935 2:234501056-234501078 CTGTAAATGGAGAATGGGGCTGG + Intergenic
948029472 2:234805242-234805264 CTGAGAACCTAGTAGGTGGCAGG + Intergenic
948771343 2:240252713-240252735 CTGGGGATGGAGACGGTGCCGGG + Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1169073229 20:2746446-2746468 CTGAGAATGTAGACAGAGGCAGG + Intronic
1169264062 20:4157037-4157059 CTCAGAATCCAGAAGATGGCCGG - Intronic
1171190107 20:23152716-23152738 CTGTGCTTGGAGAAGGTGGCTGG - Intergenic
1171308174 20:24123780-24123802 CTGGAAATGGTAAAGGTGGCAGG + Intergenic
1172603928 20:36201901-36201923 CTGAGAATGGAGAAAGGTACAGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1176205028 20:63883608-63883630 CTGAGAATGGGAAAGGGGTCAGG - Intronic
1176263589 20:64196770-64196792 CAGAGAATAGAGAGGGTTGCAGG - Intronic
1177006848 21:15684030-15684052 ATGAGACTGGAGAAGTGGGCAGG + Intergenic
1177583135 21:23053781-23053803 CAGAGGTTGGAAAAGGTGGCAGG - Intergenic
1178602137 21:34003898-34003920 CTGGGAATGGAGGTGGTGGGAGG + Intergenic
1178804010 21:35823693-35823715 CTGAGGCTGGAGACGGTGGCGGG - Intronic
1179396998 21:41049704-41049726 CTCAGAAAGGAGAGGGTGGGAGG - Intergenic
1180179033 21:46109742-46109764 CTGAGATTGGAGTGGGTGGTGGG + Intronic
1180185401 21:46136830-46136852 CTGGGAATGGAGGCGCTGGCAGG - Intronic
1180661691 22:17473058-17473080 TTGAGGGTGGAGAAGGTGGAAGG + Intronic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1181643854 22:24219830-24219852 CTGAGAGTGGAAGAGGTGGCGGG - Exonic
1183029859 22:35095473-35095495 CTGGCAATGGAGAAGGAGGTTGG + Intergenic
1183944743 22:41318830-41318852 CTGAGAATGTGCAAGGAGGCTGG - Intronic
1184086402 22:42268515-42268537 CTGAGAATGCTGAAACTGGCTGG + Intronic
1184818837 22:46893427-46893449 CTGACAATGGGGATGATGGCAGG + Intronic
1184913627 22:47552154-47552176 CTGGGAATGGAGGAGGTGCTTGG - Intergenic
1185288930 22:50014532-50014554 CTCAGGCTGGAGAGGGTGGCCGG - Intergenic
1185314604 22:50173592-50173614 CAGAGAGTGGAGAATGTAGCAGG + Intronic
950677658 3:14564396-14564418 GTCAGAGTGGAGGAGGTGGCCGG - Intergenic
950708193 3:14796760-14796782 CTGAGAAAGGAGGAGGGAGCTGG - Intergenic
951673822 3:25214878-25214900 GTAAGAATGGAGAAAGTGGATGG - Intronic
952920023 3:38277661-38277683 ATGAGAAAGGTGAAGGAGGCCGG - Exonic
953022866 3:39127081-39127103 TTGAGAAGGGAGAAGGTGAAAGG - Intronic
953800582 3:46019684-46019706 ATAAGAATGGAAAAGTTGGCTGG + Exonic
953850483 3:46462785-46462807 CTGAGAACAGAGAAGGGGGCAGG + Intronic
954299465 3:49691769-49691791 CTGGGTATGGAGTAGGTGCCAGG - Intronic
954788836 3:53115537-53115559 GAGAGAAAGGAAAAGGTGGCGGG - Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955291231 3:57693963-57693985 CTAAGAAAGGAGGAGGTGGTAGG - Intergenic
955408933 3:58643432-58643454 CTGAGATAGGAGCATGTGGCAGG + Intronic
956342868 3:68246292-68246314 CTATAAATTGAGAAGGTGGCCGG + Intronic
956381605 3:68670176-68670198 TTGAGAAGGGAGGAGGTGTCAGG + Intergenic
956482788 3:69689591-69689613 CAGAGATGGGAGAAGGTGACAGG + Intergenic
957883850 3:86256989-86257011 CAAAGACTGGAGAAGGTGGAAGG + Intergenic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
959943255 3:112101798-112101820 CTGAGAAAGGCGTAGGTGGGAGG - Intronic
960603938 3:119485836-119485858 CTGAAAATGAAGAAGGGAGCAGG + Intronic
961518268 3:127451914-127451936 ATGAGAATGGAGAAGGGGAGAGG - Intergenic
961935780 3:130582072-130582094 CTGAGTATGGAGAAGTGGGAAGG + Intronic
963289304 3:143471191-143471213 CTGAGAATGGTGAGGCTGCCGGG + Intronic
964004397 3:151811139-151811161 ATGAGAATGAAGAATGTGGTAGG - Intergenic
964212745 3:154246307-154246329 TTGAACATGGAGAATGTGGCTGG + Intronic
964590802 3:158360712-158360734 CTGAGATTGGAGCAGGTGCCAGG + Intronic
964916358 3:161846739-161846761 ATGAGTATGAAGAAGGTGTCAGG + Intergenic
965802859 3:172512418-172512440 CAGTGATGGGAGAAGGTGGCAGG - Intronic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
967489364 3:190072069-190072091 CTGAGAAAGGAGAACCTGGGAGG - Intronic
968008392 3:195257901-195257923 GTGAGGATGGAGAGGCTGGCTGG - Intronic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968166236 3:196467459-196467481 TTGAGAAGGGAGTATGTGGCTGG - Intergenic
968557095 4:1251016-1251038 CTGAGAACGGAGAGGGATGCAGG + Intergenic
969100605 4:4765416-4765438 ATGGAAGTGGAGAAGGTGGCAGG - Intergenic
969253972 4:5990259-5990281 CTGAGCTTGGAGAATGGGGCTGG - Intergenic
970546081 4:17131767-17131789 CAGAGAATGGGGAAGGTGCTAGG - Intergenic
972242800 4:37211607-37211629 CTGAGAACACACAAGGTGGCAGG + Intergenic
972436017 4:39036172-39036194 CTGAGTATGGAGAGGGTCCCCGG + Intergenic
972726288 4:41748658-41748680 ATGGATATGGAGAAGGTGGCTGG + Exonic
973026991 4:45284716-45284738 CTGAAATTGGAGCAGGTGCCGGG + Intergenic
973041069 4:45471494-45471516 CTGATATTGGAGAAAGTGCCAGG - Intergenic
974489880 4:62551062-62551084 CTGAGATGGGAGAGGGTAGCTGG + Intergenic
976053887 4:81040099-81040121 CTGAGAATTGAAAAGGAGGTTGG - Intronic
976329660 4:83814854-83814876 CTGAGAGTTGAGATGGTGGTGGG + Intergenic
976351563 4:84065903-84065925 CTGAAAAAGAAGAAGGTAGCAGG + Intergenic
976467599 4:85388379-85388401 CAGAGAATGGAGAAGGTGCTTGG + Intergenic
977578148 4:98696494-98696516 CTGGGAATGGAGAAGTTCCCTGG + Intergenic
977922385 4:102659906-102659928 CTGGGGATGGAGAGGGTAGCTGG - Intronic
978350737 4:107818233-107818255 CAGAGAATGGAGCTGGTGGTTGG - Intergenic
978913683 4:114097074-114097096 CTCAGAATGGGGAAGGTGGAAGG - Intergenic
981767054 4:148263027-148263049 CAGGGAGTGGAGATGGTGGCAGG - Intronic
981995645 4:150971463-150971485 TTGAGGAAAGAGAAGGTGGCTGG - Intronic
982167522 4:152628288-152628310 CTGAGGGTGGAGAAGGAGGCGGG - Exonic
982399765 4:154953681-154953703 CTGAGAATTGAGGAACTGGCTGG + Intergenic
982714517 4:158792807-158792829 CTTAGAATGGAGAAGGTAAATGG + Intronic
982826663 4:160010981-160011003 CTGGGGATGGAGCAGGTGGTTGG + Intergenic
983347828 4:166549086-166549108 CTGAGAATGGTGAAGCTGTGTGG - Intergenic
983570681 4:169204844-169204866 CTTCAAAAGGAGAAGGTGGCCGG - Intronic
984884312 4:184436652-184436674 CTAGGCAGGGAGAAGGTGGCAGG + Intronic
984908016 4:184648464-184648486 CTGAGAATGGGGGAAGAGGCAGG + Exonic
985189381 4:187355275-187355297 ATGAGAACGGAAAAGGTGGAAGG - Intergenic
985314631 4:188643634-188643656 TTGAGAGTTGGGAAGGTGGCAGG - Intergenic
985812768 5:2102346-2102368 CTGTGAAAGGCCAAGGTGGCTGG - Intergenic
986006869 5:3676069-3676091 CAGAGAGTGGAGATGGTGACGGG - Intergenic
986253326 5:6081275-6081297 CAGAGAATGGAGAGGCTGGGAGG - Intergenic
988400363 5:30753453-30753475 CAGGGAATGGTGAAGATGGCTGG - Intergenic
988907431 5:35803596-35803618 GTGAGAATGAAGAAGGTGAGTGG - Intronic
991353802 5:65747411-65747433 ATGAGAATAGAGAAGGTAGCTGG + Intronic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
992310066 5:75488846-75488868 CTCAGAATAGAGAAAGAGGCTGG - Intronic
992475085 5:77094221-77094243 CTGGGAATGGACTAGATGGCTGG - Intergenic
992912667 5:81412601-81412623 ATGAGAATGGAGGAGGAGGAGGG - Intergenic
993576557 5:89609279-89609301 CTGACCATGAAGAAGGTAGCAGG - Intergenic
993955259 5:94224937-94224959 GTCAGAATGGGGAAAGTGGCAGG - Intronic
994713084 5:103289840-103289862 CTGAGAAGGGAGAAGATGGAAGG - Intergenic
996281010 5:121729010-121729032 CTGAGAATGCTTAAGGTGGTTGG - Intergenic
997535331 5:134616039-134616061 CTGAGACAGGAGAATGTGGCAGG + Intronic
997572154 5:134938632-134938654 GTGAGAGTGGAGAAGGGGGAGGG + Intronic
997959667 5:138310028-138310050 CTGAGAAGGTAGAAAGTGGCTGG - Intronic
998745827 5:145258937-145258959 CTGAGACTGCACAGGGTGGCAGG - Intergenic
999547332 5:152644301-152644323 CTGAGAAGGGAAAGGGTGGGAGG + Intergenic
1001224441 5:169931721-169931743 CTCACATGGGAGAAGGTGGCTGG + Intronic
1001548326 5:172584403-172584425 CTGAGATTAGAGAAGGTGGGAGG + Intergenic
1002132415 5:177089703-177089725 CTGAGGTGGGAGAGGGTGGCAGG + Intronic
1002376343 5:178791787-178791809 ATGATAATGTAGAAGTTGGCCGG - Intergenic
1002398443 5:178976210-178976232 CAGAGAATGGGGCAGCTGGCGGG - Intergenic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1003583328 6:7362535-7362557 CTGTGAATGGAGCAGATGGCAGG + Intronic
1004181803 6:13386970-13386992 CTGAGAAATGAGATGGAGGCTGG - Intronic
1004436550 6:15600701-15600723 CTGAGAACTGAGCAGGTGGTAGG + Intronic
1005293309 6:24399961-24399983 CTGAGTATAGAGAACATGGCTGG - Intergenic
1005886826 6:30103370-30103392 CTGAGAGTGGAGATGGGGGCGGG - Exonic
1006137303 6:31902752-31902774 CTGAGAATGGAGGGGAGGGCGGG - Intronic
1006848911 6:37083319-37083341 CTGAGAGTGGAGAGGGTGAAGGG - Intergenic
1007663188 6:43498952-43498974 CTGAGAAGCAAGAAGGAGGCAGG - Intronic
1007712600 6:43834100-43834122 CTGACAATGGAGAAGGCTCCAGG - Intergenic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1008118312 6:47579383-47579405 AGGAGACTGGAGAAGCTGGCTGG + Exonic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1010130716 6:72490342-72490364 CTGAGAATGAAGAAGGTGTAAGG + Intergenic
1012132079 6:95508657-95508679 CTGAGATTTCAGAATGTGGCTGG + Intergenic
1013117175 6:107112470-107112492 CTGGGCATGGAGAAGGTAGGCGG + Intronic
1013185868 6:107757423-107757445 CTGAGGATGGAGAGTGTGGCTGG + Intronic
1013764871 6:113563038-113563060 CAGAGAAGGATGAAGGTGGCAGG - Intergenic
1014715558 6:124861048-124861070 CTGAGAAGGGACAAGGAGGAAGG - Intergenic
1014951093 6:127556919-127556941 CTGAGACTGGATGAAGTGGCTGG - Intronic
1015402403 6:132800842-132800864 ATGAGATTGGAGAAGCTGTCAGG - Intergenic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1016888887 6:148985917-148985939 CTGTGAAGGGAAAAGGAGGCAGG + Intronic
1017495059 6:154976440-154976462 CTGAGAATGTAGAAGGATGTTGG + Intronic
1017703746 6:157100456-157100478 CTCAGAATGAAGAAGCAGGCTGG - Intronic
1017769771 6:157636017-157636039 CTGAGTGTGGAGGAGGTGCCGGG - Intronic
1018916654 6:168136541-168136563 CAGAGCATGGGGAAGGTTGCAGG + Intergenic
1019182424 6:170198971-170198993 CTGAGAATGGGGATGGAGGCAGG + Intergenic
1019194030 6:170271004-170271026 ATGAAAGTGAAGAAGGTGGCCGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019893959 7:3968444-3968466 CTGAGAGTCGAGAAGCTGCCAGG - Intronic
1019980711 7:4619941-4619963 CAGAGAATGCAGAGGATGGCGGG + Intergenic
1020354311 7:7260203-7260225 GTGATGATGGAGAAGGGGGCCGG - Intergenic
1020956847 7:14750496-14750518 ATCAGAATGGAGATGGAGGCGGG - Intronic
1021205260 7:17772480-17772502 CTGAGAATGGAGAGGTGGACTGG + Intergenic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1022537439 7:31106807-31106829 CTGAGGGGGGAGAAGGAGGCAGG + Exonic
1023669542 7:42561324-42561346 CTGAGGATGGAGGTGGTGGTTGG - Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1024620197 7:51150421-51150443 CACTGAATGGAGAAGGTTGCTGG - Intronic
1025107026 7:56179830-56179852 CTGAGGCAGGAGAAAGTGGCAGG + Intergenic
1026070992 7:67119476-67119498 CTCAGAAGGGAGAAGGTGGTGGG - Intronic
1026127701 7:67594116-67594138 AGGAGAATCGAGAAGGAGGCAGG - Intergenic
1026185786 7:68081864-68081886 CTGTGAAGAGAGAAGGTGGTGGG + Intergenic
1026385449 7:69842995-69843017 CTGATAATGGAGTATGTGCCAGG + Intronic
1026525416 7:71149366-71149388 CTCAGAATGGAGCAGCTGGTAGG - Intronic
1026705908 7:72692822-72692844 CTCAGAAGGGAGAAGATGGTGGG + Intronic
1027471945 7:78584673-78584695 GTGTGATTGAAGAAGGTGGCTGG + Intronic
1027762036 7:82290916-82290938 TTAAGAGTGGGGAAGGTGGCAGG - Intronic
1028279837 7:88909427-88909449 CTGAAAAGGCAGAAGATGGCAGG + Intronic
1028633494 7:92961709-92961731 CTGAGAATGGAGCTGGAGGTGGG + Intergenic
1029747604 7:102525185-102525207 CTGAGACTGGAGATGGTCCCAGG + Intergenic
1029765555 7:102624275-102624297 CTGAGACTGGAGATGGTCCCAGG + Exonic
1030270519 7:107663977-107663999 ATGAAAATAGAGAAGCTGGCTGG - Intronic
1030395444 7:108980822-108980844 GAGAGAATGGTGAAGGTGGTGGG - Intergenic
1031900021 7:127398525-127398547 CTGAGATTGTAGAAAGTGTCAGG + Intronic
1032079437 7:128851321-128851343 GTGACAATAGTGAAGGTGGCTGG - Exonic
1033332687 7:140429320-140429342 CTAAGAGTGGAGCAGGGGGCTGG - Intergenic
1034631916 7:152537622-152537644 CTGAGGATGGAAAAGGTACCTGG - Intergenic
1034860335 7:154589587-154589609 TTGAGCATGGGGAATGTGGCTGG + Intronic
1034963234 7:155375019-155375041 CTGAGGGTGGAGGAGGTCGCGGG - Intergenic
1036736632 8:11324363-11324385 CTGAGCTTAAAGAAGGTGGCAGG - Exonic
1036931984 8:12965351-12965373 CAGAGCATAGAGATGGTGGCAGG + Intronic
1037583611 8:20261546-20261568 GGGAGAATGCAGAAGGGGGCTGG - Intronic
1037769141 8:21788930-21788952 CCGCGAAGGGAGAAGGGGGCGGG - Intronic
1038041122 8:23725280-23725302 CTGAGAATAGGGAAGGAGGTGGG - Intergenic
1038611775 8:29065577-29065599 CTGAGAAGGGAGAGGGAGGCCGG - Intergenic
1039868468 8:41526387-41526409 GGGAGATTGGAGAAGGTGGTTGG + Intergenic
1041599166 8:59695214-59695236 CTGAAAATGGGTAAGGTGGAAGG + Intergenic
1041876252 8:62690667-62690689 CTGCAAATTGAGAAGCTGGCTGG - Intronic
1041965534 8:63670483-63670505 CTGAAATTGGAGCAGGTGCCAGG + Intergenic
1042678355 8:71348770-71348792 CTGAGAGTCGAGAACGTGCCTGG - Intronic
1044194472 8:89357919-89357941 CTGAGACTGGAGAGGGAGACAGG - Intergenic
1044392583 8:91669352-91669374 CTGAGTCTAGAGAAGATGGCTGG - Intergenic
1045163107 8:99571625-99571647 CTTAAAATGGAAAAGTTGGCAGG - Intronic
1046985683 8:120385794-120385816 CTCAGAAGGGTGAAGGTGGGAGG - Intronic
1048010132 8:130448793-130448815 CAGAGAAGGGAGTAGGTGGTGGG + Intergenic
1048504790 8:135011370-135011392 CTGAGAGGGAAGAAGGTTGCAGG + Intergenic
1048837862 8:138538306-138538328 CTGAGAGTGGAGAAGAAGGAAGG + Intergenic
1049034186 8:140061750-140061772 CTGAGAATGGAGCAGCAGTCAGG + Intronic
1049549398 8:143249916-143249938 CTCAGAGAGGAGAAGGTGTCCGG + Exonic
1049646153 8:143736692-143736714 GTGACTATGGAGAAGGTGACTGG - Intergenic
1049742235 8:144246742-144246764 CTGAAAAGGGAGCAGGTGGTGGG + Intronic
1049853798 8:144849197-144849219 CAGAGAATGCAGGAAGTGGCTGG + Intronic
1050377376 9:4986538-4986560 CTGAGTATGGAGAAGGAAACTGG + Intronic
1051015304 9:12467598-12467620 CTGTGAATGTAGAAGTTGGGGGG + Intergenic
1052038426 9:23709430-23709452 ATCGGAATGGAGAAGGTTGCTGG - Intronic
1052703814 9:31970074-31970096 CTGAGAATGGATGAGGAGCCAGG - Intergenic
1052812148 9:33070866-33070888 CTGGGAAGGGTGGAGGTGGCGGG + Intronic
1053754652 9:41293299-41293321 CAGACAGTGAAGAAGGTGGCAGG - Intergenic
1054260173 9:62857603-62857625 CAGACAGTGAAGAAGGTGGCAGG - Intergenic
1054331594 9:63762402-63762424 CAGATAGTGAAGAAGGTGGCAGG + Intergenic
1054817380 9:69488069-69488091 CTGACAATGGAGAAACTGGCGGG + Intronic
1054961587 9:70975998-70976020 CTGGGAATGGAGATAGGGGCTGG - Intronic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1055514909 9:77024145-77024167 TGGAGACTGGAGAAGGTGGGGGG + Intergenic
1055645353 9:78357357-78357379 CTGAGATTGGAGCAGGCAGCAGG - Intergenic
1055869525 9:80857498-80857520 ATGAGAAAGGAGAATGTTGCTGG + Intergenic
1056192086 9:84194605-84194627 CTGAGAGTGGAGCAGGTGCAGGG + Intergenic
1056798435 9:89674972-89674994 CTTAGAATGGGGAAGGCTGCTGG + Intergenic
1056896818 9:90559082-90559104 CTGTGAGTGAAGAGGGTGGCTGG + Intergenic
1057231446 9:93324038-93324060 CTGAGAATGAACCAGGTGACTGG - Intronic
1057236653 9:93366585-93366607 CTGAGAATGAACAGGGTGACTGG + Intergenic
1057318235 9:93986395-93986417 CTCAGGATGGAGCAGGTGACTGG - Intergenic
1057327850 9:94082298-94082320 CTGAGAATGCAGTGGGTGCCTGG - Intronic
1057643704 9:96853562-96853584 CTGACAATGCAGAAGGGGCCAGG + Intronic
1057862454 9:98652285-98652307 CTGAGAGTGCAGAATGGGGCTGG - Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058750357 9:108033244-108033266 ATGAGGATGGAGAAAGTGGTGGG - Intergenic
1058940953 9:109812224-109812246 CTGAGAAGGGAGAAGGGAGGAGG + Intronic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059161741 9:112041356-112041378 CTGGGAATGGAGAAAGTTGCAGG + Exonic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1060021175 9:120132670-120132692 CTGAGAATGGATAATGTGACAGG - Intergenic
1060495743 9:124117621-124117643 CTTGGAATGGAGAGGGTGGCTGG + Intergenic
1061033183 9:128099135-128099157 CTGAGAGTCGAGAAGGCGGGAGG - Intronic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061412563 9:130429440-130429462 CTGAAACTGGAGAAGGGGACAGG + Intronic
1061538055 9:131261553-131261575 CTCAGACAGAAGAAGGTGGCCGG + Intronic
1061621353 9:131813220-131813242 CTGACAAAGGATGAGGTGGCAGG + Intergenic
1062149611 9:135010935-135010957 AGGAGCATGGAGGAGGTGGCTGG - Intergenic
1202798239 9_KI270719v1_random:147436-147458 GTGAGAATGGAGAAGATGCTGGG - Intergenic
1202798964 9_KI270719v1_random:155316-155338 CAGACAGTGAAGAAGGTGGCAGG + Intergenic
1186637544 X:11422591-11422613 CTGAGAATGAAACAGGTGACAGG + Intronic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1187081698 X:15996707-15996729 TTGAGAAGGGAGAAGCTGGGAGG - Intergenic
1187394270 X:18906422-18906444 CTGAGAGTGGAGGCCGTGGCCGG + Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1189169769 X:38897828-38897850 GTGAGAAAGGACAAGGTGGCCGG + Intergenic
1189414782 X:40804190-40804212 CTGAGGATGGAGAAGAGAGCTGG + Intergenic
1190066062 X:47242523-47242545 GTGAGACTGCAGAAGGAGGCTGG + Intronic
1190123410 X:47682737-47682759 AGGAGAAGGGAGAAGGTGGATGG - Intergenic
1190357200 X:49616979-49617001 CTGTGAATGGTGCAGGTGTCTGG + Intergenic
1192234177 X:69285608-69285630 AAGAGAATGGAGAAGGGGGAAGG + Intergenic
1192557446 X:72101701-72101723 CTGGTAATGGGGAAGCTGGCAGG - Intergenic
1193018605 X:76764570-76764592 CAGAGAATGGAAAAGGTGAGTGG + Intergenic
1193384457 X:80854291-80854313 CTAAGAATGAAGAAAGAGGCTGG - Intergenic
1193829400 X:86270383-86270405 CTGAGAATGGAACAAGTGGAAGG + Intronic
1193964368 X:87966578-87966600 CTCATAAGGGAGAAGGTGGGAGG + Intergenic
1194205112 X:91002841-91002863 CTGAAATTGGAGAAGGTGCCCGG + Intergenic
1194597339 X:95874665-95874687 CTCAGAAGGGAGAGGGTGGGAGG + Intergenic
1195031616 X:100932104-100932126 CTGAAAATAGAGAAGTTGGTGGG - Intergenic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1199188069 X:144939737-144939759 CTGAGATTGGAGCAGGAGCCGGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200550932 Y:4577962-4577984 CTGAAATTGGAGAAGGTGCCCGG + Intergenic
1201683497 Y:16675788-16675810 CTGAGAATGGAGAAAGAGAATGG + Intergenic