ID: 1087277353

View in Genome Browser
Species Human (GRCh38)
Location 11:96173917-96173939
Sequence CTGTTTCTCTTCAGGACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087277353 Original CRISPR CTGTTTCTCTTCAGGACAAG GGG Intronic
900365216 1:2309207-2309229 CCGTTTCTTTTCAGCAGAAGGGG + Exonic
900775828 1:4584884-4584906 CTGTTTTCCTTCAAAACAAGAGG - Intergenic
905669435 1:39781743-39781765 CTGTCTCTCTTTAAGGCAAGGGG + Intronic
906884623 1:49630999-49631021 CTGTTTCTCTGCAAGGCAACAGG - Intronic
907238429 1:53067206-53067228 CTGTTTCTCTGCCGGGCCAGTGG + Intronic
908270568 1:62417881-62417903 CTGTTTCTCTGGAGAACAACTGG - Intergenic
912668252 1:111602485-111602507 CTGTGTCTCAGCAGGAAAAGGGG - Intronic
913273485 1:117116811-117116833 CTTTTTCTCTTCAGAACAAAGGG + Intronic
915779761 1:158534485-158534507 TTGTTTCTCTTTAGGAGATGAGG - Intergenic
916712577 1:167424921-167424943 CTGTTTCTTTTCAGGACTTTGGG + Exonic
917617054 1:176756665-176756687 CTGTTTCTCTTCAGAAAGACAGG + Intronic
919305703 1:195833873-195833895 CTGTTACTCTTTAAGACATGTGG - Intergenic
919891892 1:201981916-201981938 TTGTTTCTCTTCTGTACCAGTGG - Intergenic
920534855 1:206730812-206730834 CTGTACTTCTCCAGGACAAGAGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922106229 1:222516194-222516216 CTTTTTTTCTTCAGGACCTGGGG - Intergenic
922874771 1:228931859-228931881 CTGATCCTCTTCAGGAGGAGTGG - Intergenic
923784960 1:237057616-237057638 CTCTTCCTCTTCAGCACATGGGG - Intronic
924348409 1:243093759-243093781 CTTTTTTTCTTCAGGACCTGGGG - Intergenic
1063056720 10:2513090-2513112 CTCATTCTCTTCAGCACAAATGG + Intergenic
1063256071 10:4328871-4328893 TTGTTTCTATTCAGCACAAGAGG - Intergenic
1063982312 10:11463841-11463863 CTCTTTCTTTTCAGGTAAAGAGG - Exonic
1065097948 10:22301080-22301102 TTGTTTTTCTTCAGTATAAGAGG + Intergenic
1066149219 10:32597574-32597596 CTGTTTCTTTGGAGGAGAAGAGG + Intronic
1066727951 10:38411142-38411164 CTTTTTTTCTTCAGGACCTGGGG + Intergenic
1070407103 10:76106777-76106799 CAGATTCTCTGCGGGACAAGAGG + Intronic
1070565865 10:77603471-77603493 CTGTGTCCCTTCAGGAGAACAGG + Intronic
1070832981 10:79431638-79431660 CTGGGTCCCTTCAGGACCAGTGG - Intronic
1072412309 10:95214630-95214652 CATTTACTCTTCTGGACAAGCGG - Intronic
1074994246 10:118742105-118742127 CTGTGTCTCTTCATTACCAGAGG + Intronic
1076145219 10:128113431-128113453 ATGATTTTCTTCAGGACAGGTGG + Exonic
1076353354 10:129833645-129833667 CAATTTCTCATCAAGACAAGAGG - Intergenic
1076686935 10:132202420-132202442 CCGTTTCTCTCGAGGACAAAGGG - Intronic
1077728048 11:4696563-4696585 GTGTTTATATTCAAGACAAGAGG + Intronic
1079728802 11:23914114-23914136 CTGTTCCATCTCAGGACAAGTGG + Intergenic
1081551655 11:44119068-44119090 CTGTCTCTCATCAGGAGAAAGGG + Intronic
1082055128 11:47808318-47808340 CTTTTTCCCTTTAAGACAAGGGG + Intronic
1082077284 11:47984033-47984055 TTGTTTTGCTTCAGGACAACGGG + Intronic
1082943584 11:58734612-58734634 CTCTTTCTCTCCAGGGTAAGAGG - Intergenic
1083096133 11:60253519-60253541 CTGATTCTCTTCAGGGAAAGAGG + Intergenic
1083106337 11:60361787-60361809 CTGGTTCTCTTCAGGGAAGGAGG - Intronic
1083582264 11:63832560-63832582 CTGTTTCTCTGCAGAAAATGCGG + Intergenic
1083763308 11:64830340-64830362 CTGTTTATCTTGAGGAAATGGGG + Intronic
1086476097 11:87176320-87176342 CTGCTTCTCTTCATGACAGAAGG - Intronic
1087277353 11:96173917-96173939 CTGTTTCTCTTCAGGACAAGGGG + Intronic
1087324506 11:96705017-96705039 CTATTTCTCTTTAGCAGAAGAGG + Intergenic
1087730745 11:101775836-101775858 CTGTTTGTCTAAAGGACTAGGGG - Intronic
1088046469 11:105457946-105457968 CTCTCTCCCTTCAGGACAATAGG - Intergenic
1089148146 11:116345384-116345406 CAGTTGCTCTTCAGGGGAAGAGG - Intergenic
1094142067 12:27191643-27191665 CTGGTGCTATTCAGGACAACAGG + Intergenic
1095403124 12:41838307-41838329 CTTTTCCTCTTCAGGGAAAGAGG - Intergenic
1098444796 12:70555464-70555486 CTGTTTTCCTTCAGGAGAAGGGG - Intronic
1099870803 12:88346981-88347003 CAGTTTCTTTTCATGAGAAGTGG + Intergenic
1102621692 12:114200981-114201003 CTGTATCTTTTCAGCATAAGTGG - Intergenic
1104461302 12:128958300-128958322 CACTTTCTCTTCTGGATAAGTGG + Intronic
1108773106 13:53729843-53729865 ATGTTTCTCAAGAGGACAAGGGG + Intergenic
1112063795 13:95769363-95769385 CTGTTTATGTGGAGGACAAGGGG + Intronic
1112658245 13:101475461-101475483 CTATTTGTCTTAAGGAGAAGGGG + Intronic
1113003774 13:105675976-105675998 CAGTTTGTCTTCAGTAAAAGAGG + Intergenic
1113668594 13:112159478-112159500 CTGTTTCCCGAGAGGACAAGTGG + Intergenic
1116457564 14:45136421-45136443 CTGGTTCCCTTCAGGAAAGGTGG + Exonic
1117401932 14:55366026-55366048 CAGACTTTCTTCAGGACAAGAGG - Intergenic
1117604088 14:57407709-57407731 GACTTTCTCTTGAGGACAAGAGG + Intronic
1118149508 14:63174518-63174540 CTGTTTCTCTTCTTGAAAAGTGG + Intergenic
1118455815 14:65945124-65945146 GTGTTCCTCTCAAGGACAAGGGG - Intergenic
1119891241 14:78183749-78183771 CTGTTTTTCTTCAGGTCTTGGGG + Intergenic
1121698632 14:95934101-95934123 CTGTGTCTTTTCAGGAGATGAGG - Intergenic
1121789323 14:96687114-96687136 CTGTTTCTTTCCAGGGCAAATGG - Intergenic
1124632260 15:31344590-31344612 CTGTTTCTCTTCTGGACTGTGGG + Intronic
1125211324 15:37218812-37218834 CTCTTTCTCTGCAGGTAAAGTGG - Intergenic
1128529230 15:68432427-68432449 CAGATTCTGTTCAGGAAAAGTGG + Intergenic
1129778757 15:78255096-78255118 ATATTTCTCATCAGGACAAATGG + Intergenic
1130520083 15:84655401-84655423 ATGTTTCTCTTCAGTACAGGAGG - Exonic
1130995519 15:88901702-88901724 CTGTTATTCTTCAGGCCCAGGGG + Exonic
1131435247 15:92416778-92416800 TTTTTTTTCTTCAGCACAAGAGG - Intronic
1133254034 16:4505470-4505492 TTGTGTCTCTGCAGGACCAGAGG + Exonic
1133873262 16:9709426-9709448 CTGTTTCCTTCCAGGAGAAGGGG - Intergenic
1135493068 16:22926499-22926521 CTGTTCCTCTCCAGGCCTAGAGG + Intergenic
1137316792 16:47333673-47333695 CTGTTTGGCTTTAGGACTAGAGG + Intronic
1137696080 16:50463042-50463064 CACTTTCTCTGCAGAACAAGTGG - Intergenic
1138012053 16:53390261-53390283 CTATTTCTCAGCTGGACAAGTGG - Intergenic
1138195655 16:55050181-55050203 CTGTTTCTCTTCAGATCAGCTGG + Intergenic
1138694909 16:58804036-58804058 CTTTTTCTCTTCAGAACAAAGGG - Intergenic
1141471177 16:84239698-84239720 CTGTTTCTCTGCCAGGCAAGGGG + Exonic
1141676257 16:85519062-85519084 CAGTTTCTCCTCTGGACAAGTGG + Intergenic
1142116323 16:88357980-88358002 CAGTTTCTTCCCAGGACAAGTGG - Intergenic
1143818683 17:9541742-9541764 CTGTTTCTCTTCTGCAAAATGGG + Intronic
1144117579 17:12113842-12113864 CTGTCTCTTTGCAGGAAAAGAGG - Intronic
1144273978 17:13647172-13647194 CTGTTTCTCATCTGCACATGAGG - Intergenic
1145811625 17:27767678-27767700 CTGCTTCTCTGCAGCACATGGGG - Intronic
1146841832 17:36161750-36161772 TTGCTTCTCTTCAGCACACGGGG + Intergenic
1146841971 17:36162518-36162540 CTGCTTCTCTTCAGCACACGGGG - Intergenic
1146854141 17:36249710-36249732 TTGCTTCTCTTCAGCACACGGGG + Intronic
1146854282 17:36250478-36250500 CTGCTTCTCTTCAGCACACGGGG - Intronic
1146870045 17:36373602-36373624 TTGCTTCTCTTCAGCACACGGGG + Intronic
1146870185 17:36374370-36374392 CTGCTTCTCTTCAGCACACGGGG - Intronic
1146877402 17:36424683-36424705 TTGCTTCTCTTCAGCACACGGGG + Intronic
1146877542 17:36425451-36425473 CTGCTTCTCTTCAGCACACGGGG - Intronic
1147072926 17:37974226-37974248 TTGCTTCTCTTCAGCACACGGGG + Intergenic
1147073066 17:37974994-37975016 CTGCTTCTCTTCAGCACACGGGG - Intergenic
1147084448 17:38053764-38053786 TTGCTTCTCTTCAGCACACGGGG + Intronic
1147084588 17:38054532-38054554 CTGCTTCTCTTCAGCACACGGGG - Intronic
1147100395 17:38177730-38177752 TTGCTTCTCTTCAGCACACGGGG + Intergenic
1147100535 17:38178498-38178520 CTGCTTCTCTTCAGCACACGGGG - Intergenic
1147222320 17:38943728-38943750 TTGTTTCAATTCAGGACAGGTGG - Exonic
1147861683 17:43527676-43527698 CTGTTTCTCTTCTGAAAAATGGG - Intronic
1148450809 17:47776997-47777019 CTGTGTCTCTGCGGGATAAGAGG - Intergenic
1148566075 17:48633762-48633784 GTCTTTCTTTTCAGGACAGGAGG - Intergenic
1148895507 17:50836918-50836940 CTGTTTCTCTCCAGGTGAACGGG - Intronic
1148903366 17:50895270-50895292 CTGTGTCTCTTCAGGACGCGAGG + Intergenic
1149338673 17:55664174-55664196 CAGTTGCTCTTCAGTCCAAGAGG + Intergenic
1149394167 17:56221922-56221944 CTTTTTCTCTTCAGTCCAAGGGG + Intronic
1150083337 17:62260777-62260799 TTGCTTCTCTTCAGCACACGGGG + Intergenic
1150083474 17:62261544-62261566 CTGCTTCTCTTCAGCACACGGGG - Intergenic
1151153092 17:72104720-72104742 CTGTTTCTCTGCAGCCCAGGTGG - Intergenic
1152551132 17:81030868-81030890 CTGTTTCCCACCAGGGCAAGTGG - Intergenic
1157036447 18:43980436-43980458 CTGTGTCTCTTGAGAACATGAGG + Intergenic
1157982631 18:52399205-52399227 TTGTTTCTTTTCTGGACAAAAGG + Intronic
1159499156 18:69246449-69246471 CAGTTACTCTTCAGCACCAGAGG - Intergenic
1159570278 18:70104546-70104568 GTGTTCCTCTGCAGGAGAAGAGG + Intronic
1160663231 19:311163-311185 CTGAGTCCCTTCAGGACCAGTGG - Intronic
1161280842 19:3444691-3444713 CTATTTCCATCCAGGACAAGCGG + Intronic
1161528214 19:4770532-4770554 CTGCTTCTCTCCAGGAGAACCGG + Intergenic
1163240849 19:16062669-16062691 CTGTTTCTCTCCACACCAAGGGG + Intergenic
1167799346 19:51730125-51730147 CTGTTTCTCTCCAGGGAAAGTGG - Intergenic
927722068 2:25389564-25389586 CTGTAGCTCTTCAGCACAACGGG + Intronic
929312189 2:40438219-40438241 CTGTTTCTCTTCAGGGTTAGTGG - Intronic
929601995 2:43210355-43210377 CTGATTCTTTGCAGGGCAAGGGG + Intergenic
931682656 2:64764834-64764856 TTGTTACTCTTCAGTACAATAGG - Intergenic
931794291 2:65694515-65694537 CTATTATTCTTCATGACAAGTGG + Intergenic
931825138 2:65992444-65992466 CTGTCTCTCTTCAGAACCTGGGG + Intergenic
932989362 2:76767021-76767043 CTTTATCTCTTCAGGCCTAGTGG + Intronic
934232386 2:90196133-90196155 CTGTCTCTCTCCAGGAAAGGGGG + Intergenic
936383255 2:112006321-112006343 CTGTATTTCATCAGGACAACAGG + Intronic
936514797 2:113174695-113174717 CTGTTGCCCATCAGGACAACAGG - Intronic
936621977 2:114109504-114109526 CTGTTACTCCTCAGAACCAGAGG - Intergenic
936652949 2:114450694-114450716 CTATTTCTCTTGAGGATAAGTGG + Intronic
937445994 2:121958368-121958390 CTGTTTCTCTTCTGGAAAATGGG - Intergenic
937736817 2:125301302-125301324 CTGTTTTACTTTAGGACATGGGG - Intergenic
939409846 2:141810649-141810671 CTGTTCCTGTTCATGACTAGGGG + Intronic
940322237 2:152389799-152389821 CTTTTTCACTGCAGGAGAAGAGG + Intronic
940611750 2:156001692-156001714 CTTTTTCCCTTCAAGAGAAGAGG + Intergenic
941677615 2:168361010-168361032 ATGTTTGTCTTCTGGAAAAGGGG - Intergenic
942460752 2:176166739-176166761 CTGTTCCTCATCAAGACAAATGG + Intronic
942681881 2:178485298-178485320 CTGTTCCTTTTTAGGAAAAGAGG + Intronic
944403848 2:199360321-199360343 CTGTTTCTGGGCAGGACAAATGG + Intronic
945869763 2:215214365-215214387 CTGTTTCCCTACAGGGAAAGGGG - Intergenic
946165162 2:217859121-217859143 CTGCTTCTCTTCAGGGCACTGGG - Intronic
946478440 2:220031128-220031150 CTCTTACCCTTCAGGTCAAGGGG - Intergenic
946538137 2:220653758-220653780 CTTTTTCTTCTCAGGACAATAGG + Intergenic
946862507 2:224013802-224013824 CTGTTCCTCTGCAGGAATAGAGG - Intronic
947333029 2:229050408-229050430 CTGTTTCACCACAGAACAAGGGG - Intronic
1168808794 20:689202-689224 CTGGTTCTTTTCAGGAGCAGGGG + Intergenic
1170749151 20:19129987-19130009 CTGATTCTCTTCAAAAGAAGGGG - Intergenic
1170980140 20:21204891-21204913 CTTTTTCTCTTCACTACATGTGG + Intronic
1172029793 20:31973798-31973820 CTTTTACTCTTCATGACACGGGG + Intronic
1174704998 20:52646476-52646498 TTTTTTTTCTTCAGGTCAAGAGG + Intergenic
1175885103 20:62285759-62285781 GTGTTTCCCTTCGGGAGAAGCGG - Intronic
1184852265 22:47127832-47127854 TTGGTTCTCTTCAGGGCAAGTGG + Intronic
949106257 3:203603-203625 CATTATCCCTTCAGGACAAGGGG - Intronic
950095625 3:10328604-10328626 CTTTTTCACTTCAAGGCAAGGGG - Exonic
951311498 3:21131333-21131355 CTGTTTCTCATAAGGAAAAGTGG + Intergenic
952586820 3:34903292-34903314 CTGTATCTTTTCAGGACAATAGG + Intergenic
953080354 3:39610933-39610955 GTGTTCCTCTTCAGGTCAACAGG - Intergenic
954130448 3:48558001-48558023 CATTTTCTCTTCAGGAAAATGGG + Intronic
954952819 3:54490273-54490295 CTGTTTCTCTTCCTGTGAAGTGG - Intronic
955403728 3:58611751-58611773 CTGTTTCTCTTCCGTAAAATGGG + Intronic
957649959 3:82987848-82987870 TTGTTTTTTTTCAGTACAAGTGG + Intergenic
958057108 3:88427443-88427465 ATGTTAGTCATCAGGACAAGGGG + Intergenic
959154064 3:102644834-102644856 CTGTTTCCCTTCAGGACATTTGG + Intergenic
960505242 3:118485880-118485902 TTGTTTCTCTGCAGGAACAGGGG + Intergenic
966233862 3:177679186-177679208 TTGTTTCTGTTCAGTTCAAGAGG + Intergenic
967088153 3:186112439-186112461 CTGTTTCTCTCCTGGAGGAGAGG - Intronic
967882635 3:194312836-194312858 CTGTTTCTCATCAGGCGGAGAGG + Intergenic
968204040 3:196782768-196782790 CTTTTTCTCTTCTGGAACAGAGG - Exonic
969533731 4:7743098-7743120 CTGTTTCTCTTCTGGAAAATTGG - Intergenic
970500636 4:16673139-16673161 CTTTTTCTTTTCAGGGAAAGGGG + Intronic
974295490 4:59993913-59993935 TTGGTTCTCTTCAGGAAAACTGG + Intergenic
974786870 4:66629654-66629676 CTATTTCTCTTCAAGTCCAGAGG - Intergenic
977311129 4:95388626-95388648 CTGTTACTCTACAAGACTAGTGG - Intronic
979213316 4:118132796-118132818 ATCTTTCTCTTCAAGACAATGGG + Intronic
979254933 4:118599422-118599444 CTTTTTTTCTTCAGGACATGGGG + Intergenic
980527198 4:134006098-134006120 CTGTTTCTTTTTAGGTCATGGGG + Intergenic
982585173 4:157227816-157227838 CTGTGTCTCTTCAGTACAATAGG + Intronic
982900189 4:160989150-160989172 CTGTTTATCATAAGGAGAAGAGG + Intergenic
983341166 4:166463148-166463170 TTGTTTTCTTTCAGGACAAGAGG + Intergenic
984143304 4:176030440-176030462 CTTGTTCTCTTCAGGAACAGAGG + Intergenic
984995244 4:185424807-185424829 CTGTTTCTCTTCTGTAAAACTGG + Intronic
987709773 5:21492352-21492374 CTGCTTCTCTGCAGGCCCAGAGG + Intergenic
987825729 5:23027906-23027928 CTCTTTCACTACAGGAAAAGAGG + Intergenic
988749840 5:34181811-34181833 CTGCTTCTCTGCAGGCCCAGAGG - Intergenic
989751159 5:44895517-44895539 GTCTTTCTCTTCAGCACAACAGG + Intergenic
990514196 5:56516920-56516942 ATGTTTTTCTTCAGGAGCAGGGG - Intronic
991030919 5:62081529-62081551 CAGATCCTCTGCAGGACAAGAGG + Intergenic
991738099 5:69645015-69645037 CTGCTTCTCTGCAGGCCCAGTGG - Intergenic
991760095 5:69911409-69911431 CTGCTTCTCTGCAGGCCCAGTGG + Intergenic
991787237 5:70206691-70206713 CTGCTTCTCTGCAGGCCCAGTGG - Intergenic
991789675 5:70224741-70224763 CTGCTTCTCTGCAGGCCCAGTGG - Intergenic
991814424 5:70499851-70499873 CTGCTTCTCTGCAGGCCCAGTGG - Intergenic
991817559 5:70521143-70521165 CTGCTTCTCTGCAGGCCCAGTGG - Intergenic
991839326 5:70786460-70786482 CTGCTTCTCTGCAGGCCCAGTGG + Intergenic
991879683 5:71207081-71207103 CTGCTTCTCTGCAGGCCCAGTGG - Intergenic
991882123 5:71225110-71225132 CTGCTTCTCTGCAGGCCCAGTGG - Intergenic
992024718 5:72658993-72659015 ATGTCTCCCTCCAGGACAAGAGG + Intergenic
992502448 5:77356037-77356059 CTTTTTCTGTGCAGGACCAGAGG - Intronic
992604325 5:78440260-78440282 GTGTTCCTTTTCAGGAGAAGGGG + Intronic
994421893 5:99533671-99533693 CTGCTTCTCTGCAGGCCCAGAGG + Intergenic
994460949 5:100066910-100066932 CTGCTTCTCTGCAGGCCCAGAGG - Intergenic
994485096 5:100380338-100380360 CTGCTTCTCTGCAGGCCCAGAGG - Intergenic
995182879 5:109245337-109245359 CTGTTTTCCCTCAGGAAAAGAGG + Intergenic
998637198 5:143968935-143968957 CTGTTTTTCCTGAGGAGAAGTGG + Intergenic
999551621 5:152693824-152693846 CTGTTTCTCTTCAAGATAGGTGG + Intergenic
1003176630 6:3757097-3757119 CTGTTTCTCTTCAAAACAAAAGG + Intergenic
1004773877 6:18820463-18820485 CTGTTTCTCTTTATAACAAGAGG - Intergenic
1005532470 6:26721851-26721873 CTGTTTCTCTACTGGAGAAGTGG - Intergenic
1005535930 6:26755743-26755765 CTGTTTCTCTACTGGAGAAGTGG + Intergenic
1005538325 6:26779814-26779836 CTGTTTCTCTACTGGAGAAGTGG + Intergenic
1005822795 6:29611593-29611615 CTCTTTGTATCCAGGACAAGAGG - Intronic
1008492183 6:52097937-52097959 CTGTTTGACTTCTGGATAAGAGG - Intergenic
1009006964 6:57799402-57799424 CTGTTTCTCTACCGGAGAAGTGG + Intergenic
1009009177 6:57822164-57822186 CTGTTTCTCTACCGGAGAAGTGG + Intergenic
1009018667 6:57929235-57929257 CTGCTTCTCTGCAGGCCCAGAGG - Intergenic
1010141756 6:72621640-72621662 CAGTTTCTCCTCAGGACACAAGG + Intergenic
1011861959 6:91769474-91769496 CTGTGACTCTTCAGGATAACTGG + Intergenic
1012858505 6:104530552-104530574 CTATTTCTCTTTAGGGCAATGGG + Intergenic
1015243217 6:131049438-131049460 CTTTTTCTCTTTAAGAGAAGTGG + Intronic
1015598150 6:134886114-134886136 CTGTGTCTGTGCAGGACAAGGGG + Intergenic
1017042662 6:150320056-150320078 GTGTCTCTCTCTAGGACAAGTGG + Intergenic
1017180610 6:151548455-151548477 CTCTTTCTCTTCAGTACAGGAGG - Exonic
1018395888 6:163377782-163377804 ATGTTTCCTTTCAGGACATGTGG - Intergenic
1018538102 6:164845468-164845490 AAGTTTTTCTTCAGGAAAAGGGG - Intergenic
1020127035 7:5538903-5538925 CTCTTTCTCATCTGGAGAAGGGG - Intronic
1021961474 7:25877390-25877412 CTGTCTCTCTTCAAATCAAGAGG - Intergenic
1024070024 7:45777100-45777122 CTTTTTTTCTTCAGGACCTGGGG + Intergenic
1024127701 7:46317521-46317543 CTGTGTCTCTTCAGGAACAGTGG - Intergenic
1025935626 7:66034073-66034095 TTGTTTCTCTTCAGGACCAACGG + Intergenic
1032047421 7:128621387-128621409 CTTTTTTTCTTCAGGACCTGGGG + Intergenic
1032495700 7:132360489-132360511 CAGTTTCTCTTTAGGACTATGGG + Intronic
1035643124 8:1198697-1198719 ACGTGTCTCTTCAGGACATGAGG - Intergenic
1035969977 8:4237244-4237266 CTGAATCTCTTCAGGACCAAAGG - Intronic
1036179988 8:6576302-6576324 CTGTTTCTCTGCAGGAAGATGGG + Intronic
1037428840 8:18788109-18788131 CTGGTTTTCTTTAAGACAAGGGG - Intronic
1038309482 8:26435299-26435321 CTGCTTCTCTGCAAGCCAAGGGG + Intronic
1038848637 8:31253139-31253161 TTGTTTCTTTTCAGGACAATTGG - Intergenic
1041549868 8:59088543-59088565 CTGTTTCTGTTCATGTCAGGAGG + Intronic
1043192653 8:77245971-77245993 CTCTTTCTCTTCACAAAAAGAGG + Intergenic
1046343967 8:112897610-112897632 ATGTTACTCTTTAGGAAAAGTGG + Intronic
1047936521 8:129786023-129786045 CTATTTCTCTACAGGACAAAGGG - Exonic
1048046330 8:130776696-130776718 CTGTTTGGGATCAGGACAAGTGG + Intergenic
1048457345 8:134590347-134590369 CTCTTTCTATTAAGGACAAAAGG - Exonic
1048475120 8:134736021-134736043 CAGTTTCCCTCCAGGACAGGTGG - Intergenic
1048755860 8:137737586-137737608 CTTTTTCTGTTAAGGACAGGGGG - Intergenic
1048766423 8:137849001-137849023 CTGTGACTCTTCAGGACAAATGG + Intergenic
1048885115 8:138903517-138903539 CTGTTTCTGTTCTGCACAACAGG - Intronic
1049795376 8:144494933-144494955 CTGTGTCTCTAGAGGGCAAGGGG + Intronic
1050019206 9:1266542-1266564 CTCTTTCTCTAGAGGGCAAGTGG - Intergenic
1050940006 9:11446648-11446670 CAGTGTCTATTCAGGTCAAGAGG - Intergenic
1056688138 9:88783654-88783676 CTGTTTCTCTTCTCTATAAGGGG + Intergenic
1058654343 9:107206268-107206290 CTGGTTCTCTTTTGGAAAAGAGG + Intergenic
1058893517 9:109381201-109381223 GAGTTCCTCTTGAGGACAAGAGG + Intronic
1059571676 9:115444157-115444179 ATGTGCCTCTTCAAGACAAGTGG - Intergenic
1059826247 9:118032373-118032395 CTGTTTCTGTTCTGTACATGTGG + Intergenic
1061196381 9:129109360-129109382 CTGTTTCTCTCCAGGACTCCTGG + Intronic
1186336486 X:8595036-8595058 CTGTTTCACTTGAGAATAAGGGG - Intronic
1188652471 X:32649038-32649060 ATGTTTCTCTTCAGTACATTGGG + Intronic
1188820611 X:34770414-34770436 CTGTTTCACTTAAAAACAAGGGG + Intergenic
1189241953 X:39532146-39532168 CTGTATGTCTGCAGGTCAAGTGG + Intergenic
1189464777 X:41270020-41270042 CTCTTTCTTTTGTGGACAAGTGG - Intergenic
1189496433 X:41513089-41513111 CAGATTCTCTGCAGGGCAAGTGG + Intergenic
1191013133 X:55782077-55782099 ATGCTTCTCTTCAGAACAAAAGG - Intergenic
1193593937 X:83422928-83422950 CTGTTACTATTCAAGACAATGGG + Intergenic
1197112088 X:122788512-122788534 CTGTTTCTCTTCATCACACTAGG - Intergenic
1197292011 X:124670036-124670058 CTGTTTCTCATTTGGACAATGGG + Intronic
1199064891 X:143404549-143404571 CTGTTTTTAGTCAGCACAAGTGG - Intergenic
1199732659 X:150651807-150651829 CTGTTTGTATTCAGGGCAGGAGG + Intronic
1202195874 Y:22297883-22297905 CTGGGTCTCTTCAGGACATGGGG + Intergenic