ID: 1087277816

View in Genome Browser
Species Human (GRCh38)
Location 11:96177860-96177882
Sequence GTTTTTGAGGGAATTTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 438}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087277816 Original CRISPR GTTTTTGAGGGAATTTTTGA GGG Intronic
901387998 1:8923753-8923775 GTCTTTGAGCCAAATTTTGATGG - Intergenic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
902576342 1:17380212-17380234 GTTTTTGATGTTGTTTTTGATGG + Intronic
903467812 1:23564495-23564517 GTCTTTGAGGGAGGATTTGAGGG - Intergenic
903592542 1:24468143-24468165 TTTTTTGTGGGTTTTTTTGAGGG - Intronic
905488153 1:38322117-38322139 ATTTCTGAAGGAATTTTTGGAGG - Intergenic
906164285 1:43674323-43674345 GTTTTTGTGGGAATTTTTTGGGG + Intronic
906365277 1:45205360-45205382 GTTTTAGAGGGAGCGTTTGAGGG - Intronic
907173595 1:52496859-52496881 TTTTATGAATGAATTTTTGAGGG - Intronic
907273707 1:53305440-53305462 GTTTTTGTTGCAATTTTTAAAGG + Intronic
907468516 1:54655711-54655733 GTTTCTTAGGGATTTTTTTAGGG + Intronic
908215689 1:61949337-61949359 GGGTTTGATGGAATTTTTGGGGG + Intronic
909554931 1:76942950-76942972 GTTTTTCATGGAATTTGTTATGG - Intronic
910810051 1:91226799-91226821 GTTTTTAAGGGTAATTTGGAGGG - Intergenic
911457379 1:98143009-98143031 TTTTTGGAGGGAATTCTTCAGGG + Intergenic
911964388 1:104348140-104348162 TTTTATGAAGGAATGTTTGATGG - Intergenic
913074603 1:115331185-115331207 ATTTTTGAGGGCAATTGTGAAGG - Intronic
913208343 1:116562921-116562943 GATTTTGAGGGACTGTTGGAAGG - Intronic
913304412 1:117410937-117410959 GTTTTTGAGAGAAATTTAAAAGG + Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915886273 1:159724791-159724813 GTCTCTGAGGGAATTTTTATAGG - Intergenic
916371887 1:164106909-164106931 GTTATTGAGGGAATATGTGGTGG + Intergenic
916453973 1:164951496-164951518 GTATTTGAATAAATTTTTGAAGG - Intergenic
917128428 1:171713933-171713955 GTTGTTGAGGGAATACTTGTAGG - Intronic
917260907 1:173167365-173167387 GTTTTTGGGTGAAGTTTTTAGGG + Intergenic
917370323 1:174286125-174286147 TTTTTTGGAGGAATTTGTGAAGG + Intronic
917451529 1:175151375-175151397 GGTGTTGAGGGAAGTTTTGGAGG + Intergenic
917942225 1:179933678-179933700 GTTTTTGAGTGTGTTTGTGAGGG - Intergenic
918172009 1:182006456-182006478 ATATTTGAGGGAATAATTGAGGG + Intergenic
918551637 1:185749156-185749178 TTTGTTGAGGGAATTTTAGGTGG - Intronic
919592425 1:199521306-199521328 CTATTTGAGGGAAGTGTTGAAGG - Intergenic
919596660 1:199572350-199572372 GTTTTTGAAAGTATTTTTTAAGG + Intergenic
920568812 1:207000528-207000550 TATTTGGAGGGAATCTTTGAAGG + Intergenic
921410896 1:214835564-214835586 ATTTTTGAGAGCAGTTTTGATGG + Intergenic
921507764 1:215993740-215993762 ATTTTTGAGTGAATGTTTAATGG + Intronic
921572128 1:216792459-216792481 GTTTTTGAAGCAATCGTTGATGG - Intronic
922085447 1:222342439-222342461 GTTTTAGAGCCCATTTTTGATGG + Intergenic
922992005 1:229922053-229922075 TTTTTTGAAGTTATTTTTGAAGG + Intergenic
923417805 1:233781520-233781542 GTTTTTAAGGGTGTTTTTAAGGG + Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924161229 1:241234426-241234448 GTTTTTGAGGGAAGGTTTCTGGG - Intronic
924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG + Intergenic
1062928930 10:1339861-1339883 GCTTTTGATAGAAGTTTTGACGG + Intronic
1063136527 10:3221689-3221711 GTTTCTGGTGGCATTTTTGATGG - Intergenic
1063136896 10:3225175-3225197 GTTTCTGGTGGCATTTTTGATGG + Intergenic
1063217482 10:3937632-3937654 GTTTTTGATGGAATATTTGGGGG - Intergenic
1064452349 10:15453906-15453928 GTTTTTGTGAGATTTTGTGACGG + Intergenic
1064507559 10:16049755-16049777 GTTTGTGAGGTAATTTTAGGTGG + Intergenic
1065116615 10:22489378-22489400 AATTTTGAGGGTATTTTGGAAGG + Intergenic
1065699675 10:28412610-28412632 CTTTTTGAGTTATTTTTTGAAGG + Intergenic
1066374408 10:34844410-34844432 GTTTTTTAGGGTTTTTTTAATGG - Intergenic
1066521380 10:36223841-36223863 TTTTTGGAGGGAATGTTTGTTGG - Intergenic
1068361422 10:55978399-55978421 GTTTCTTAGGGCAGTTTTGAAGG - Intergenic
1068740296 10:60461608-60461630 GGTTTTGCTGCAATTTTTGATGG - Intronic
1069354852 10:67573270-67573292 GGTTTTGAGGAAATTTTTTTTGG - Intronic
1071676018 10:87657020-87657042 GTTTTTCAGGGAAGTCTTGGAGG + Intergenic
1072108365 10:92294604-92294626 TTTTTGGTGGCAATTTTTGAGGG + Intronic
1072380371 10:94862797-94862819 TTTTTTGAGGGTTTTTTTCATGG - Intergenic
1072392655 10:95003907-95003929 TTTTTTGAGGGTTTTTTTCATGG - Intergenic
1074972923 10:118556172-118556194 ATTTTTAAGGGTATTTTTGCTGG + Intergenic
1075148067 10:119900078-119900100 ATTTTGGGGGGAATATTTGAAGG + Intronic
1075355582 10:121771009-121771031 CTTTTTGTGGCATTTTTTGAGGG - Intronic
1075944743 10:126422899-126422921 CTCTTTGTGGGCATTTTTGAAGG + Intergenic
1075951166 10:126478984-126479006 GTGTTTAAGGGCATCTTTGAAGG - Intronic
1077894379 11:6442874-6442896 GTTGTTGAGGAAATTCCTGATGG - Intergenic
1079956238 11:26868830-26868852 TTATTTGAGGGAATAATTGAGGG + Intergenic
1080745692 11:35106662-35106684 GTGTTTGAGGGACTTTATGGAGG + Intergenic
1081539406 11:44019499-44019521 GTTTTTGAGAACATTTTTCATGG + Intergenic
1082298653 11:50476567-50476589 CTTTTTTACAGAATTTTTGAGGG - Intergenic
1084134621 11:67167508-67167530 GTTCTTGGGGGAACTTTTTAGGG + Intronic
1084207271 11:67602960-67602982 GTTTTGGACTGAATTTTTTAAGG + Exonic
1084778893 11:71396124-71396146 GTCTTTGTGGGAATTTTTTGAGG + Intergenic
1085853324 11:80147096-80147118 GTATTTGAGGGAGATATTGAGGG - Intergenic
1085910688 11:80821781-80821803 ATTTTTGATGAAATTTTGGAAGG - Intergenic
1086010309 11:82094950-82094972 CTTTTTGAAGAAATTTTTGAAGG - Intergenic
1087277816 11:96177860-96177882 GTTTTTGAGGGAATTTTTGAGGG + Intronic
1087472508 11:98594977-98594999 TTTTTTAAAGGAATTTTTGTAGG - Intergenic
1088152487 11:106761656-106761678 ATTTTGGAGCAAATTTTTGAAGG + Intronic
1088337300 11:108720582-108720604 GTATTTGAGGGATTTTTTGCGGG + Intronic
1089586144 11:119511073-119511095 GCTTTTGAAAGAGTTTTTGAAGG + Intergenic
1089808101 11:121109736-121109758 GTTTTTGAGGGTTTTTTTTTAGG - Intronic
1089932350 11:122326184-122326206 GTTTTAGAGGGGGTTGTTGATGG + Intergenic
1089988939 11:122839695-122839717 ATTTTTGAGTGGATTTGTGAGGG - Intronic
1090304577 11:125680066-125680088 ATTTTTGAGTCAACTTTTGAAGG + Intronic
1090807454 11:130211262-130211284 GCTTTTGGGGGAACATTTGAGGG + Intergenic
1090942975 11:131404831-131404853 ATTTTTGAAGGAATTTTAAATGG - Intronic
1091619985 12:2079754-2079776 GTTTTTGTGATTATTTTTGAAGG - Intronic
1093008164 12:14073955-14073977 CTTTTTGAGGGAGTTTGTTAGGG + Intergenic
1094350652 12:29521224-29521246 GTTTTTGAGGGAAGTAGAGAGGG + Intronic
1094869136 12:34578995-34579017 GTTTTTGAGGAATTTCTGGAGGG - Intergenic
1095358707 12:41309059-41309081 GTTTTTGAGGGGAGTATTGTAGG - Intronic
1096835977 12:54351646-54351668 GTTTTTAAAGGCATTTTTGTGGG - Intronic
1098229344 12:68357141-68357163 GGTTTTGAGGGTGTGTTTGAAGG - Intergenic
1098979142 12:76936304-76936326 GTTTTTGAAGGATTTTTAGCAGG + Intergenic
1099460329 12:82913204-82913226 GATTTTGAGATAGTTTTTGAGGG + Intronic
1099731996 12:86516648-86516670 TTTTTTGATGGGATTTTTCAAGG - Intronic
1100633529 12:96411965-96411987 TTGTTTGAAGGAATTCTTGAAGG - Intergenic
1100920619 12:99481855-99481877 GTTTTTGAAGGAATTATTTGCGG + Intronic
1101971980 12:109321081-109321103 GTTTTTGAGGGCTTTTAAGATGG - Intergenic
1102232615 12:111274065-111274087 GTTTTTGGGGGTTTTTTTGTTGG + Intronic
1102497023 12:113326923-113326945 GTTTTGGTGGGAATAGTTGATGG - Intronic
1102651002 12:114442424-114442446 GTTGTTGGGGATATTTTTGAGGG - Intergenic
1104540676 12:129661635-129661657 ACTTTTGAGGGAATGTTTTAAGG - Intronic
1104879135 12:132057598-132057620 GTTTTAGAGGGATTTATTGAAGG - Intronic
1105203533 13:18199971-18199993 GTTTTTGTGGACATTTTTGTGGG + Intergenic
1105783355 13:23723673-23723695 CATTTAGAGGGAATTTTTTATGG - Intergenic
1105959716 13:25320910-25320932 ATTTTTTAGGAAATTTGTGAAGG + Exonic
1106416467 13:29549972-29549994 GTTTTTTAAGGAATTCTTAAAGG + Intronic
1106519068 13:30481238-30481260 TTTTCAGAGGGATTTTTTGATGG + Intronic
1107160405 13:37219237-37219259 GATTTTGAGTTAATTTTTGAAGG + Intergenic
1107637908 13:42411506-42411528 GTCTATGAGGGTATTTCTGAAGG - Intergenic
1108231839 13:48352602-48352624 CTTTTTGTGGCAATTTTTAATGG + Intronic
1109281270 13:60358208-60358230 CTTATTGAGGAAATTATTGAAGG + Intergenic
1109929670 13:69198358-69198380 CTAGTTCAGGGAATTTTTGAGGG - Intergenic
1110303429 13:73956515-73956537 ATTTCTGAAGGCATTTTTGATGG - Intronic
1110592227 13:77276644-77276666 GGTTTTGTGGGATTTTTTGGGGG + Intronic
1110933277 13:81250076-81250098 GTTTGTGAGGGAATTTCTGGAGG + Intergenic
1111122929 13:83878601-83878623 TTTGTTGAGGGAAGTTTTTAGGG - Exonic
1111262294 13:85757045-85757067 CATTTTGAAGGGATTTTTGAAGG + Intergenic
1111613124 13:90630439-90630461 TGTTTTCAGGGAATTTTTTAAGG + Intergenic
1111628534 13:90819724-90819746 GTTTTAAAGTGAATTTTGGAAGG + Intergenic
1111662174 13:91225033-91225055 GTTTTTGAGTCAACTTTTGAGGG + Intergenic
1111980014 13:95005334-95005356 GTGGCTGAGGGAGTTTTTGAGGG - Intergenic
1112470764 13:99686549-99686571 CTTTTTGAGTGAATTGTTGTTGG + Intronic
1112722883 13:102265160-102265182 GTTTTGGAGGGAAGTTTTGATGG - Intronic
1113734389 13:112667451-112667473 CTTTTTGAAAGAATTTGTGAAGG - Intronic
1114304166 14:21405764-21405786 GATTCTGAGGGAAATTGTGACGG + Exonic
1115169005 14:30481685-30481707 GTTTTTGAGGATAATTTTGTGGG - Intergenic
1115292399 14:31787020-31787042 GTGTTTGAGAGATTTTTAGAAGG + Intronic
1115838381 14:37436098-37436120 GTTTTTGAAGGTATTTTACATGG + Intronic
1117461136 14:55945808-55945830 GTTTGTGAGGGCATTTCTGAAGG - Intergenic
1117936712 14:60914889-60914911 GTTTATGAGGGATTTTTGAAGGG + Intronic
1120324392 14:83006938-83006960 TTTGTTGAGGGACTTCTTGATGG + Intergenic
1120368892 14:83607301-83607323 CTTTTGGATGGAATTTTTGTGGG + Intergenic
1120374749 14:83689275-83689297 CATTTTGAGTTAATTTTTGATGG + Intergenic
1120484685 14:85098165-85098187 ATTTTTGAGGGATTTTTTAAAGG - Intergenic
1120603584 14:86543397-86543419 GTTTTTGGGGGCATTATTTAAGG - Intergenic
1120983778 14:90314813-90314835 GAATTTGACTGAATTTTTGAGGG - Intronic
1121953567 14:98193983-98194005 GTTTTTTAGAGAATAATTGAAGG + Intergenic
1122057223 14:99109339-99109361 CATTTTGAAGGAATTTTTGCTGG + Intergenic
1122523789 14:102365337-102365359 GTATCTGAGGGAATTTATGAAGG + Intronic
1123671989 15:22667730-22667752 GTTTTATTGGGCATTTTTGATGG + Intergenic
1124324035 15:28740942-28740964 GTTTTATTGGGCATTTTTGATGG + Intergenic
1124527922 15:30474189-30474211 GTTTTATTGGGCATTTTTGATGG + Intergenic
1124711674 15:32017822-32017844 GTTTTTGGGGGAGCTTTGGAAGG - Intergenic
1124770736 15:32533513-32533535 GTTTTATTGGGCATTTTTGATGG - Intergenic
1125145402 15:36461623-36461645 CTTTTTGATGGAATTATTTAGGG + Intergenic
1126314289 15:47352726-47352748 GTTTTTAATGGTAGTTTTGAGGG + Intronic
1127408408 15:58679231-58679253 GTTATTGATGGAAGATTTGAAGG - Exonic
1128349825 15:66881389-66881411 CTTTTTGAAGGAGTTTGTGAGGG + Intergenic
1128797273 15:70475047-70475069 GATTGTGAGGCAATTGTTGAAGG + Intergenic
1129007243 15:72384213-72384235 CTTTTTGAGGGATTTTTTTTTGG + Intergenic
1129576103 15:76747655-76747677 GCTCTTGAGGGAACTTTTGCAGG - Intronic
1130318018 15:82812931-82812953 GTTTTATTGGGCATTTTTGATGG + Intronic
1131368328 15:91858483-91858505 GTTTGTGAGGGGGTTTTTGTTGG + Intronic
1131444405 15:92485177-92485199 GGTGTTGAGGGGATATTTGATGG + Intronic
1131618035 15:94036928-94036950 ATTTATGAGGGAATTTGGGAGGG - Intergenic
1131916700 15:97273671-97273693 TAGTGTGAGGGAATTTTTGAGGG - Intergenic
1132183708 15:99783807-99783829 GTTTTTGAGGGAAATATGTATGG - Intergenic
1133714352 16:8432654-8432676 GTTTTTAAGGTATTTTTTAAGGG + Intergenic
1135390003 16:22084351-22084373 GTCTTTCAGAAAATTTTTGAAGG + Exonic
1135551669 16:23403246-23403268 GTTTTTGAGGGGGCTTTGGAGGG - Intronic
1137359485 16:47800341-47800363 TTTTTTGAGGGATTTTCTAAAGG + Intergenic
1138709734 16:58957283-58957305 GTTTTTTAAGGAATTTTTACAGG + Intergenic
1140018238 16:71209777-71209799 GTTTTTGTGGTAATTGTTAATGG - Intronic
1140322300 16:73964946-73964968 TTGTTTGATGGAACTTTTGATGG + Intergenic
1142531367 17:581778-581800 GGTTCTGAGGGAATTTCTGTGGG - Intronic
1142943827 17:3407910-3407932 GTATTTGAAGAAATTTCTGATGG + Intergenic
1145354494 17:22129221-22129243 TTCTTAGAGGGAATTTTTTAAGG - Intergenic
1149161252 17:53695850-53695872 GATTATGAAGGATTTTTTGAAGG - Intergenic
1149816118 17:59725376-59725398 GTTTTCAAGGGAATTTTGAAAGG + Intronic
1150036134 17:61800456-61800478 GAGTATGAGGTAATTTTTGAAGG + Intronic
1150889378 17:69129304-69129326 ATTATTGAGGTTATTTTTGAGGG - Intronic
1153286813 18:3464287-3464309 GATTTTCAGGGATTTTTTGGTGG + Intergenic
1153451214 18:5231737-5231759 ATATTTGAGGGAATAATTGAGGG - Intergenic
1153519031 18:5934609-5934631 ATTTTAGAGGGTATTTTAGAGGG + Intergenic
1155107317 18:22680373-22680395 CTTTTTGAGGGATGATTTGATGG - Intergenic
1155851056 18:30774566-30774588 GTTTTTGAGGGGATCATGGAGGG - Intergenic
1156650794 18:39224997-39225019 GAATGTGAGGGAATTTTTCAGGG - Intergenic
1156732321 18:40209111-40209133 GTTTTTGGGGGAACATTTCAAGG + Intergenic
1156827917 18:41455177-41455199 GTTTTTGAAGGGCTGTTTGAAGG - Intergenic
1157632286 18:49110458-49110480 GTTTTTAAAGACATTTTTGAGGG + Intronic
1158012019 18:52739893-52739915 GTTTTTGAGGGACTCTATGTGGG - Intronic
1158700645 18:59742839-59742861 TTTACTGAGGGAATTTTTGCTGG + Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159050005 18:63412630-63412652 ATTTTTGAGTTAATTTTTGTAGG - Intronic
1159368834 18:67505686-67505708 TTTTTTGAAGGAATTTTGAATGG - Intergenic
1159401697 18:67945478-67945500 AGTTTTGAAGGAAGTTTTGAAGG - Intergenic
1159480279 18:68981328-68981350 GTTTTCGAGGGAAGTTTTATTGG + Intronic
1159718194 18:71851199-71851221 GTTTTGGAGTGAAGTCTTGAGGG - Intergenic
1160464080 18:79061161-79061183 GTAATTGAGGGAATGTTTAAAGG + Intergenic
1160604949 18:80043191-80043213 ATTTTTGACTGACTTTTTGAAGG - Intronic
1161445836 19:4318646-4318668 GGTTTTGAGTGGAGTTTTGATGG + Intronic
1161757609 19:6145808-6145830 GTTGTTGAGGGGGTTGTTGAGGG - Intronic
1164042706 19:21507555-21507577 GTTTTTCTTGGAATTTTTGTGGG + Intronic
1165645953 19:37437287-37437309 GTTTTTGAGGGTTTTTATCATGG - Intronic
926410345 2:12596130-12596152 GTTTTTGTGGTAATGTTTTAAGG + Intergenic
926666240 2:15526808-15526830 GCAATTGAGGGTATTTTTGAGGG - Intronic
926869052 2:17392136-17392158 GATTTTGAGGGACTGTTAGAAGG + Intergenic
927301441 2:21520449-21520471 GATTTTGAGTGAAGTTTAGAGGG + Intergenic
927769556 2:25847428-25847450 GTTATTAAGGGAAATTTTGGTGG - Intronic
929088088 2:38188503-38188525 GTTTTTGAGGGTATTTGGAAAGG - Intergenic
929193623 2:39163167-39163189 AATTTAGAGGGAATATTTGATGG + Intergenic
929879879 2:45826271-45826293 GCATTTGGGGGAATTTTAGAAGG + Intronic
929998202 2:46842787-46842809 GTGTCTCAGGGAACTTTTGAAGG + Intronic
930165981 2:48204347-48204369 GTGTTTGAGTGGAATTTTGAAGG + Intergenic
931145482 2:59512361-59512383 GTCTTTGAGGGTATTTCTGAAGG - Intergenic
931507173 2:62942371-62942393 GCATTTGGGGGAAATTTTGAGGG + Intronic
933020485 2:77184393-77184415 GTTTCTGTGGGTATTTTTGTAGG - Intronic
933068841 2:77833322-77833344 GTTTTTAAGGCTATATTTGAGGG - Intergenic
934101073 2:88653559-88653581 GTATTTGAGGGATTTTTCAAAGG + Intergenic
936606536 2:113962909-113962931 GTGTTTGAGGGTGTGTTTGAAGG - Intergenic
936845890 2:116832611-116832633 GTTTTTGAGGGAATATAAAATGG - Intergenic
937030883 2:118739286-118739308 CTTTTTGAGGGAATGAATGAGGG - Intergenic
937421768 2:121762782-121762804 GTTTTTGATAGTATTTTTGAGGG + Intronic
937526655 2:122778905-122778927 GTTTTTAAGTGATTTTTTAAAGG - Intergenic
939111799 2:138017413-138017435 ATTTTTAAGAGAATTTTTGATGG - Intergenic
939448862 2:142346184-142346206 ATTTTTTAGGGAATTTTATAAGG + Intergenic
940264872 2:151826332-151826354 TATTTTGTGGTAATTTTTGACGG - Intronic
941526547 2:166613186-166613208 TTTTTTGAGCAAATTTTTAAGGG - Intergenic
942113492 2:172705220-172705242 ACTTTTGTGGGTATTTTTGAAGG - Intergenic
942827593 2:180198600-180198622 CTTTTTGATGGTAATTTTGATGG + Intergenic
942959756 2:181816026-181816048 GTTTTTGAGTGGCTTATTGAAGG - Intergenic
942965274 2:181885108-181885130 ATTGGTGAGAGAATTTTTGAAGG + Intergenic
943237534 2:185341239-185341261 TATTTTGAGCGAATTTCTGAGGG + Intergenic
944337830 2:198558322-198558344 ATTTTTGAGGGGCTTTTTGATGG - Intronic
944943413 2:204654667-204654689 TTTTTGGAGGGACTTCTTGAGGG + Intronic
945275652 2:207985082-207985104 GTTCCTGAGGAAATTTATGATGG - Intronic
946802654 2:223436774-223436796 ATTTTAGAGAGAAATTTTGAGGG - Intergenic
947242340 2:228009114-228009136 ATTTTTGAAGGAATTTTTGCTGG + Intronic
947584483 2:231345214-231345236 ATTTTTGGGGGATTTTTGGAGGG + Intronic
1170066081 20:12312015-12312037 TTTTTTCAGGGAATCTTGGAAGG - Intergenic
1171513515 20:25707330-25707352 GTTTTTAAGAGCTTTTTTGATGG + Intergenic
1172714742 20:36954322-36954344 GTGTTTGAGGGCATTTTTTTGGG - Intergenic
1174059238 20:47820953-47820975 GTTTTTGGGGGAGTTAGTGATGG + Intergenic
1174549494 20:51351718-51351740 GTTTCTGAAGCAATTATTGATGG - Intergenic
1177678911 21:24338603-24338625 GTCTTTGATGGAATATTTTAGGG - Intergenic
1177692138 21:24524601-24524623 GTTTTAGAGGGTTTTTTGGAAGG - Intergenic
1177730268 21:25020423-25020445 TTTTTTAAGGCTATTTTTGATGG - Intergenic
1177842918 21:26254623-26254645 GTTATTGAAGGAATTGTTGAAGG + Intergenic
1177959331 21:27642810-27642832 GTTGTTGTGTGAATTTATGAAGG - Intergenic
1178231602 21:30791274-30791296 GGTTTTCAGGGAAGTGTTGAAGG + Intergenic
1179394798 21:41029088-41029110 GTTTTTGAAGGCATATTAGAAGG - Intergenic
1179402185 21:41094511-41094533 CTTTTAGAGGTAACTTTTGAAGG - Intergenic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
1183448207 22:37874248-37874270 GTTGTTGAGGGAAGCTTTCAAGG + Intronic
951086977 3:18523698-18523720 ATTTTTGAGGCCATTTTTAATGG + Intergenic
951743602 3:25951551-25951573 CTTTTAGAGGGAATTCTTCAGGG + Intergenic
954848414 3:53579551-53579573 TTTACTGAGGGAATTGTTGAGGG + Intronic
955763207 3:62311804-62311826 GTTTCTGATGGTATTTATGAGGG - Intergenic
955994568 3:64666848-64666870 GTTTTAGAAAGAATCTTTGATGG + Intronic
956769542 3:72513085-72513107 TTTTGTGAGGGTGTTTTTGAAGG + Intergenic
957771700 3:84701720-84701742 TTTTCTGATGGAATTATTGATGG + Intergenic
957788916 3:84915784-84915806 ATTTTGGAGGGAAGTTTTCAGGG - Intergenic
957793523 3:84970881-84970903 GTTTTTGTTGCAATTTTTGTTGG + Intronic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
958181681 3:90068761-90068783 GTTTTCAAGGGAAATTTTGGAGG - Intergenic
958600703 3:96293266-96293288 GTTTTTAATGGGATTTGTGAAGG + Intergenic
958653357 3:96967818-96967840 GTTCTTGAAGGAACTTTGGAAGG + Intronic
958713349 3:97745823-97745845 ATTTTTAAGGGTAATTTTGATGG + Intronic
958740646 3:98066385-98066407 TTTTTTGAGGTAAATTTTGGGGG + Intergenic
959770712 3:110091765-110091787 GTTTTTCATGGAATTTTTTCAGG - Intergenic
959920666 3:111864707-111864729 GTTTTTGAGAGGATTTTTACAGG + Intronic
960112594 3:113859838-113859860 TTTTTTGAAAGAGTTTTTGAAGG - Intronic
960283709 3:115803739-115803761 GTTTTGGAAGGAATTTCTCATGG - Exonic
960526336 3:118715203-118715225 GTCTGTGAGGGTATTTCTGAAGG - Intergenic
960548961 3:118951750-118951772 GTATTTGAGAGAATATTTGTAGG - Intronic
960871972 3:122259090-122259112 GTTTCTGAGGGGTTTTTTGGGGG + Intronic
960902031 3:122563463-122563485 GATTTTTAGGAAATTTTTAAAGG - Intronic
962224330 3:133592972-133592994 GTTTTTGGGGGATTTTTTGGTGG + Intergenic
962983859 3:140516900-140516922 GTATTTGAAGGAATAATTGAGGG - Intronic
963457825 3:145568854-145568876 CTTTTTGTTGGAATTTTTGGAGG - Intergenic
963500691 3:146121689-146121711 GTTTTTCAGGGAATTGCAGAGGG + Intronic
963864182 3:150342652-150342674 GGTTTTGGGGTAATTTGTGATGG - Intergenic
965309252 3:167108742-167108764 CTTTATTATGGAATTTTTGAAGG - Intergenic
966468116 3:180255449-180255471 GCTTTTGAGGGATTTTTTAAAGG - Intergenic
967712107 3:192721091-192721113 GTTTTTGTGGGAGTTAATGAAGG + Intronic
969178346 4:5417324-5417346 GTTTTTTAAGGAATTTTTATGGG + Intronic
969693119 4:8717837-8717859 TTTCTTGAGGATATTTTTGATGG - Intergenic
969913969 4:10471998-10472020 TTTTTTCTGGGAATTTTTGAAGG + Intergenic
970632926 4:17972864-17972886 GGTTTTGAGAGTATTTTAGAAGG - Exonic
971246829 4:24936960-24936982 GTTTCCGAGGTAATTTTTGGTGG + Intronic
971460771 4:26893624-26893646 TTTTTTGAGTGAGTTTTTCAAGG + Intronic
971585533 4:28401356-28401378 TTGTTTGAGGCTATTTTTGATGG + Intronic
971755145 4:30697935-30697957 ATTTTTCAGGGCATTTTTTAAGG - Intergenic
972564938 4:40261142-40261164 GTTTTTTCAGGAATTTTTGCAGG + Intergenic
972630708 4:40839526-40839548 TTTATTGAGGGAATTTGTGAAGG + Intronic
972804166 4:42510568-42510590 ATTTTTGCAGGAAATTTTGAGGG - Intronic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974582706 4:63826103-63826125 ATTTTTGATGGAATTTCTTAGGG + Intergenic
974745716 4:66072827-66072849 GTCTCTGAGGGAATTTTCGTAGG + Intergenic
975263462 4:72333259-72333281 GTTGTTGATGAAATCTTTGAAGG - Intronic
976239524 4:82940182-82940204 CTTTGTGAGGGAATATTTGTAGG + Intronic
976680677 4:87752887-87752909 GATTTTGGGGGACTTTTGGAAGG - Intergenic
976895868 4:90110442-90110464 GTTTTTCAGAGAATGTATGATGG - Intergenic
977624734 4:99177997-99178019 TTATTTGAGGGAATAATTGAGGG - Intergenic
977659591 4:99567471-99567493 GTTTTTTAGTGATTTTTTGTTGG - Intronic
977704675 4:100058062-100058084 GTTTTTTAGTGAATGCTTGAAGG - Intergenic
978334251 4:107648774-107648796 GTTTTTGTGGGTTTTTGTGAAGG + Intronic
978612236 4:110555696-110555718 GTTTATGAGGTAGTATTTGAAGG - Intronic
978933639 4:114348984-114349006 TTTTTTGGGGGATATTTTGAAGG - Intergenic
979552443 4:122006204-122006226 GTTTTTCTGGGAATCTATGAGGG - Intergenic
979835934 4:125367383-125367405 GTTATAGAGGGTATTTTTCAAGG + Intronic
980662294 4:135878334-135878356 TTTTCTGAGGCAATTGTTGAAGG + Intergenic
980899157 4:138887929-138887951 GCTTTGGAGGTAATTTATGAGGG + Intergenic
981442676 4:144800534-144800556 TTTTTTGAGAGAGTTTATGAGGG - Intergenic
981657799 4:147131815-147131837 ATTTTTGAATGAATTTTTAAGGG - Intergenic
983396449 4:167203741-167203763 ATTTCTCAGGGAATTTTTCAAGG - Intronic
983458149 4:167990951-167990973 GGTTTTGAGCAAATTATTGAAGG - Intergenic
983901802 4:173143779-173143801 GTTTTTATGGTAATATTTGAGGG - Intergenic
984226797 4:177044964-177044986 CTTTGTGAGGGAAATTTTCACGG + Intergenic
985371504 4:189289975-189289997 TTATTTGAGTGAATTTTTGTTGG - Intergenic
985814317 5:2115255-2115277 GATTTTGAGGGTACTTTTAAGGG - Intergenic
986225678 5:5809896-5809918 GTGTTTGTGGGAAATTGTGATGG + Intergenic
986567192 5:9126656-9126678 GTTTTTGAGGGTACTTTGGCAGG + Intronic
986875806 5:12107497-12107519 GTTGTTTAGGGAATTGTTTAGGG - Intergenic
987170027 5:15245420-15245442 ATTTTTAATGGAATTTTGGAAGG + Intergenic
987418042 5:17685140-17685162 TTTTTTGAGTGAATTAATGAAGG + Intergenic
987857408 5:23438625-23438647 GTTTTTGAGAGAAAATTTAAAGG - Intergenic
988000169 5:25337719-25337741 CTTTTTGAAGGAAAATTTGAAGG - Intergenic
988230952 5:28478838-28478860 GTTTTGGAGGGATGCTTTGAAGG + Intergenic
988237972 5:28571502-28571524 ATTTTTGAGCAAATTTTAGAAGG + Intergenic
988451751 5:31350912-31350934 GTTGTTGATGGAATTTTAGAGGG + Intergenic
988473649 5:31564180-31564202 GTTTTTGAGAGATACTTTGATGG - Intergenic
989059316 5:37394506-37394528 GTTGTTGTGGGAGTATTTGAAGG + Intronic
989206038 5:38809749-38809771 GTTCTTGAGGGAAATTCTGGGGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989700002 5:44252627-44252649 GTTTTTAAGGGGATCATTGAGGG + Intergenic
989765069 5:45073328-45073350 GTTTTTGAAGAAATTTTAGAAGG + Intergenic
990372159 5:55131128-55131150 TTTTTTGAGGGAGGTTTTGAGGG - Intronic
990601393 5:57362154-57362176 GTTATTGAAGGAATGTTTGGTGG + Intergenic
990977979 5:61575639-61575661 GTTTTTGAAAGAATGTTTGCCGG + Intergenic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
992338986 5:75802722-75802744 GTTTTTGATAAAATTTGTGATGG + Intergenic
993645795 5:90459527-90459549 GTTTTTGAGTCAAATTTGGAAGG - Exonic
994073495 5:95626664-95626686 GTTTTTTAGGGAATCTAGGAAGG + Intergenic
994480740 5:100331565-100331587 CTTGTTGAGGGAATTTTATAAGG + Intergenic
994601600 5:101912354-101912376 CTTTTTGAGGGAATTGTGAATGG + Intergenic
994827806 5:104738117-104738139 GATTTTGATGCTATTTTTGAGGG + Intergenic
995257688 5:110065885-110065907 TTTGTTGAGGGACTTTTTTAAGG + Intergenic
997031008 5:130128153-130128175 TCTCTTGAGAGAATTTTTGAAGG - Intronic
997042279 5:130271697-130271719 GTTTTGGTGGGCATTTCTGAAGG + Intergenic
997121508 5:131178063-131178085 GTTTCTGAGGAAGTTTTTTATGG + Intronic
997762201 5:136460421-136460443 ATTTTTGAAGGCATTTTGGAAGG - Intergenic
998543195 5:143002681-143002703 GTGTTTCAGGAAATTTTTAAAGG - Intronic
1000590820 5:163155241-163155263 GTTATTGATCTAATTTTTGAAGG - Intergenic
1001105250 5:168847889-168847911 GTTTTTGAGAGGGTCTTTGAAGG - Intronic
1002123808 5:177026318-177026340 GTTTCTGAAGGAGTTTGTGAAGG + Intronic
1004198344 6:13525669-13525691 ATTTTGGAGGGAATTTGTCATGG - Intergenic
1004464674 6:15873471-15873493 CTTTTTGATGGGCTTTTTGATGG - Intergenic
1004919778 6:20365774-20365796 GTTATTGAGGAGATATTTGAAGG + Intergenic
1004938313 6:20529531-20529553 GTTTTTCAGGAAAGTTTTGCAGG - Intergenic
1004943725 6:20588151-20588173 GTTGCTGTGGGAATATTTGATGG + Intronic
1005148618 6:22721926-22721948 GTTTTTGAGGTGACTTTTTAAGG + Intergenic
1006215358 6:32437458-32437480 GTGTTTGAGGGAATTTCCAAAGG - Intergenic
1006382621 6:33708819-33708841 ATCTTTGTGGTAATTTTTGAAGG - Intronic
1007921953 6:45618219-45618241 TTTTTTGAGGAAATTGCTGAGGG + Intronic
1009055290 6:58327712-58327734 ATTTTTGAAGTACTTTTTGAAGG - Intergenic
1009235871 6:61122866-61122888 ATTTTTGAAGTACTTTTTGAAGG + Intergenic
1010316848 6:74461321-74461343 GTTTTTAAAGAAATTTTTGTGGG + Intergenic
1011460959 6:87603191-87603213 GCTTGAGAGGGAATTTTTAATGG + Intronic
1011869847 6:91880047-91880069 GTGTTTTAGGGAATTTGTCAAGG + Intergenic
1012426000 6:99115111-99115133 CTCTTTGAGGGAACTTTTGTGGG - Intergenic
1013663635 6:112324165-112324187 GTTATTGAGGGACATTTTGAGGG + Intergenic
1014566700 6:122957512-122957534 ATATTTGAGGGAATAGTTGAGGG + Intergenic
1014672764 6:124327216-124327238 GTTTCTAAAGGAATTTTGGAGGG + Intronic
1014784481 6:125602093-125602115 GTTTTTGGGGGTATTTTGGGGGG - Intergenic
1014813016 6:125906537-125906559 GTTTCTGTGGGAAGTTTGGAAGG + Intronic
1014896294 6:126904084-126904106 GAGTTTCAGGGAATTTCTGAGGG - Intergenic
1015318338 6:131842862-131842884 GTATTTGAGGGAATTGGTGAGGG + Intronic
1016060509 6:139625235-139625257 GTTTCTGAGTGACTTTTGGAGGG - Intergenic
1016311286 6:142736369-142736391 GGTCATAAGGGAATTTTTGAGGG - Intergenic
1016574440 6:145552817-145552839 CTTTTTGAGGAAATGTTTGCTGG - Intronic
1016609754 6:145975098-145975120 GTGTTTGGGGACATTTTTGATGG - Intergenic
1016942483 6:149494509-149494531 GTTTTTGAGTGATGTTTTTATGG - Intergenic
1017343989 6:153357941-153357963 TTTTTTGAGGGATTTTTTGAGGG + Intergenic
1017421123 6:154274362-154274384 GCTTATGTGGGAATTTCTGAAGG - Intronic
1017593423 6:156002065-156002087 GTTTTTGGTGGACTTTTTAAGGG + Intergenic
1018358685 6:163043999-163044021 GTCCTTGAGGGAAACTTTGAGGG + Intronic
1019114103 6:169742958-169742980 GATTCTGAGGTACTTTTTGAAGG - Intronic
1020751885 7:12151415-12151437 GTTTTAAAAGTAATTTTTGATGG + Intergenic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1022010074 7:26301146-26301168 GTTTTTGGGGGGATTTGGGAAGG - Intronic
1022741529 7:33126761-33126783 GATTTTGAGGAAGTTTTTAAAGG - Intergenic
1023167177 7:37354469-37354491 GTTTTTGAAAGAATTTTTCCAGG - Intronic
1023643699 7:42287318-42287340 GGTTTTGAGATAATTTTTTAAGG + Intergenic
1023984371 7:45086328-45086350 GGTTTTGAGGGAAGTGTTGCTGG + Intronic
1024218475 7:47267883-47267905 GTTTGGGAGGGAATATTAGAGGG - Intergenic
1024588655 7:50862305-50862327 AATTTTGAGGGGATTTGTGAAGG - Intergenic
1026233712 7:68508201-68508223 GTTTTTGATGTAATTTTTGTGGG + Intergenic
1026372053 7:69709923-69709945 ATTTTTAAGAAAATTTTTGAAGG - Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027141123 7:75658399-75658421 TTTTTTGAAGGAATTCTGGAGGG + Intronic
1028335921 7:89654824-89654846 GCTTCTGAAGTAATTTTTGAAGG + Intergenic
1028342835 7:89744311-89744333 GGATTTGAAGGAATTTCTGATGG - Intergenic
1028859929 7:95637714-95637736 GTTTTTTATGGATTTCTTGAGGG + Intergenic
1029892560 7:103945616-103945638 GGTTTTGAGGGAATATTTAATGG - Intronic
1031686885 7:124741386-124741408 TTTTCTGAAAGAATTTTTGAAGG - Intergenic
1032807735 7:135373980-135374002 GTGTTTGGGGGTATTTTTCATGG + Intronic
1032898631 7:136280821-136280843 GTTTATGAGCTAAGTTTTGAAGG - Intergenic
1032991283 7:137397438-137397460 GTTTTTGAGCTTATTTTTGACGG - Intronic
1033081215 7:138299657-138299679 TTTTATGAGGGAGTTTTAGAAGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034064974 7:148127335-148127357 TTTTTGGAGGGAAATTTTGAAGG + Intronic
1034614018 7:152398993-152399015 ATTTTTGTGGGATTTTTTTAGGG + Intronic
1036498577 8:9293318-9293340 ATTGTTGAGGGAATTTTTCAGGG + Intergenic
1036972463 8:13370093-13370115 GTTTTTGAGTAAAGTTTGGAAGG - Intronic
1037253200 8:16920982-16921004 ATTTTTGAGGGTTTTTTTGTAGG + Intergenic
1037319010 8:17626758-17626780 GCTTTTGGGGGTATTTTTGTTGG - Intronic
1038379660 8:27080601-27080623 CTTTTGGAAGGAATTTTTTAAGG + Intergenic
1038660472 8:29492605-29492627 GTATTAGAGGGAATTTATGAGGG + Intergenic
1039174417 8:34786859-34786881 GTTTTTGAGAGAATGTATGTGGG - Intergenic
1039199032 8:35066713-35066735 ATATTTGAGTTAATTTTTGAAGG - Intergenic
1040140207 8:43900833-43900855 CTTTTTGGGGGAATCTCTGAAGG + Intergenic
1040646535 8:49403509-49403531 GTTTGTGAGGGTATTTCTGGAGG + Intergenic
1040768724 8:50947860-50947882 GTTTTTAAGGGAATTTGAAAGGG - Intergenic
1041050433 8:53929184-53929206 GGTTTTGAGAAAACTTTTGAGGG + Intronic
1041402430 8:57459877-57459899 GTTTTTGAGCATATTTTTAAGGG - Intergenic
1041542451 8:59001400-59001422 GTTTCTGAGTGAATTTTTTAGGG - Intronic
1041570868 8:59335715-59335737 GTTTCTGAAGAAACTTTTGAAGG + Intergenic
1041758816 8:61341806-61341828 GCTTTTAAGGGAATTTTGCAAGG + Intronic
1043512217 8:80960814-80960836 GATTTTGAGGGAAATTTAAAAGG + Intergenic
1044253720 8:90034964-90034986 TTTTTGAAGGGTATTTTTGATGG + Intronic
1044507313 8:93037087-93037109 GTATTTGAGGGTTTTTTTGAAGG + Intergenic
1044868299 8:96593969-96593991 GTGTTTGAGGGATTTCTTGAAGG - Intronic
1045322676 8:101093708-101093730 ATTTATTAGGGAATTTTTGAAGG - Intergenic
1046304678 8:112349721-112349743 TTTTTTAAGGGAAGTTTTTAAGG - Intronic
1046429224 8:114101684-114101706 TTTTGTGAGGCACTTTTTGAAGG + Intergenic
1047255665 8:123211739-123211761 GTCTTTGTGTGAATTTGTGAAGG - Intergenic
1048684393 8:136887296-136887318 GTGTTTAGGGGAATTCTTGAGGG + Intergenic
1048700488 8:137083221-137083243 GTTTTTAAGGGAATCTTGGTGGG + Intergenic
1050509523 9:6379442-6379464 TTTTTTGAAGGATTTTTTGAAGG - Intergenic
1050938622 9:11429813-11429835 GATTTTGATGGACTTTTTGGTGG + Intergenic
1051295813 9:15594844-15594866 GTTTTAAAGGAAATTTGTGAAGG + Intronic
1051573345 9:18584700-18584722 GTCTGTGAGGGTATTTTTGGAGG + Intronic
1051779590 9:20674867-20674889 GTATTGGGGGGAAATTTTGAAGG - Intronic
1052295801 9:26895046-26895068 GTTTTTAAGGGAATTTTGGTGGG - Intergenic
1053655813 9:40217448-40217470 GTTGTTGAGGTCATTTATGAAGG + Intergenic
1054367928 9:64363675-64363697 GTTGTTGAGGTCATTTATGAAGG + Intergenic
1054528794 9:66158842-66158864 GTTGTTGAGGTCATTTATGAAGG - Intergenic
1054675547 9:67853419-67853441 GTTGTTGAGGTCATTTATGAAGG + Intergenic
1055263835 9:74472820-74472842 GTCTGTGAGGGTATTTTTGAAGG - Intergenic
1056029960 9:82543225-82543247 TTTTTTGAGATAATTTTTAAAGG - Intergenic
1056305634 9:85288260-85288282 TTTTTTCAGGGCATTATTGAAGG + Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056606848 9:88093025-88093047 GTTTTTAAGGGGATTTGTGGAGG - Intergenic
1057545886 9:96020513-96020535 GTCTTTGAGGGCATTTTAGGAGG - Intergenic
1058101129 9:100918756-100918778 GTCTTAGAAGGTATTTTTGACGG + Intergenic
1058225584 9:102357986-102358008 GTATTTAGGGGATTTTTTGAAGG - Intergenic
1058706880 9:107644840-107644862 GATTTTGAGGGGAATTTTGGTGG + Intergenic
1060132887 9:121122140-121122162 GGTTTTGGTGGAATTTTTAATGG + Intronic
1060746774 9:126141322-126141344 ATTTTTGATGGCAGTTTTGAGGG + Intergenic
1186116610 X:6310685-6310707 GTTTTTCAGGGAAGTTTGGTGGG + Intergenic
1186264191 X:7813950-7813972 GTTTTTAAGGGAATTTTGGTGGG + Intergenic
1186887185 X:13925604-13925626 GTTTTTGTGGCATTTTTTAAAGG - Intronic
1187397276 X:18929884-18929906 GTAGGTGAGGGAATTTTTTATGG - Intronic
1187928011 X:24267991-24268013 GTGATTTAGGGAAATTTTGAAGG + Intergenic
1189655918 X:43244994-43245016 GTTGTTGAGGGAATTTGTGGAGG + Intergenic
1190390961 X:49931160-49931182 GTTGTTGAGGTGATTGTTGAAGG + Intronic
1190727957 X:53203734-53203756 GTTTTTTGGGGGATTTTTTAGGG + Intronic
1191000483 X:55655558-55655580 GATTTTAAGGGACTTTTTAACGG - Intergenic
1191142798 X:57134157-57134179 AGTTTTGAGGGACTTTTTGTGGG + Intergenic
1191146869 X:57176142-57176164 ATATTTGAGGGAATAATTGAGGG - Intergenic
1191883625 X:65866457-65866479 GTTGTTGTGGGTATTTCTGAAGG + Intergenic
1192968785 X:76208441-76208463 GTTTTGGAAAGAATTTTAGAAGG + Intergenic
1193248440 X:79259077-79259099 GTGTTTGAAGGAAAATTTGAAGG + Intergenic
1193764793 X:85514178-85514200 GTTTTGGAGGGATTGTTTGCAGG - Intergenic
1194521390 X:94922520-94922542 GTTTTTGGGTGTGTTTTTGAAGG + Intergenic
1194762714 X:97813656-97813678 GTTTTTCAGGGAATTTTGATGGG - Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1196361399 X:114865039-114865061 GTGCTTGAGGAAACTTTTGATGG - Intronic
1197069857 X:122283715-122283737 ATTTTTGAGGGTTTTTATGAAGG - Intergenic
1197179657 X:123520647-123520669 GTATTTTGGGGAATTTTTAAAGG + Intergenic
1197582834 X:128306115-128306137 GTTTTTGAAGTAAATTTTAATGG - Intergenic
1197788049 X:130220322-130220344 GTTTGTGAGGGAGTTTTTGGTGG - Intronic
1200385151 X:155882799-155882821 ATATTTGAGGGAATATTAGATGG + Intronic
1200490758 Y:3820736-3820758 GTTTTTTGGGGATTTTTTGTTGG - Intergenic
1200910424 Y:8526971-8526993 GTTTTTGAGGGATTTTTGATGGG - Intergenic
1201384204 Y:13420481-13420503 GTTTTTGACAGCTTTTTTGAAGG - Intronic
1201463371 Y:14253454-14253476 GATTTTGAGGGAAGTTTGGATGG - Intergenic
1201524458 Y:14916072-14916094 GTTTTTGGGGGACGTATTGAAGG + Intergenic
1201667519 Y:16475187-16475209 GTTCTTGAGGGTATTGTGGAGGG + Intergenic
1202027849 Y:20543221-20543243 GTCTTTTGGGGAATCTTTGAAGG - Intergenic