ID: 1087283969

View in Genome Browser
Species Human (GRCh38)
Location 11:96244145-96244167
Sequence ATTTCAAAACATCTGGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 390}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087283969_1087283976 18 Left 1087283969 11:96244145-96244167 CCGTGTTCCAGATGTTTTGAAAT 0: 1
1: 0
2: 0
3: 37
4: 390
Right 1087283976 11:96244186-96244208 AGCCTCAGTGTCTCCCTGGAGGG 0: 1
1: 0
2: 6
3: 35
4: 488
1087283969_1087283974 14 Left 1087283969 11:96244145-96244167 CCGTGTTCCAGATGTTTTGAAAT 0: 1
1: 0
2: 0
3: 37
4: 390
Right 1087283974 11:96244182-96244204 TGAGAGCCTCAGTGTCTCCCTGG 0: 1
1: 1
2: 4
3: 61
4: 453
1087283969_1087283975 17 Left 1087283969 11:96244145-96244167 CCGTGTTCCAGATGTTTTGAAAT 0: 1
1: 0
2: 0
3: 37
4: 390
Right 1087283975 11:96244185-96244207 GAGCCTCAGTGTCTCCCTGGAGG 0: 1
1: 1
2: 2
3: 33
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087283969 Original CRISPR ATTTCAAAACATCTGGAACA CGG (reversed) Intronic
900916152 1:5640126-5640148 ATTTCAAAATATTTGGAATGAGG + Intergenic
903427663 1:23266442-23266464 ATTTCAAAAGATGTGAAAGATGG - Intergenic
903962796 1:27067389-27067411 ATTTCTTATCTTCTGGAACAGGG - Intergenic
906285299 1:44583500-44583522 AGGTCAAAACATTTGGAATAGGG - Intronic
906398720 1:45489487-45489509 ATTTCAAAACACCTCAAACTCGG + Intronic
906513018 1:46422319-46422341 TTTTCAAAACACCTGGCACATGG - Intergenic
906666720 1:47627335-47627357 ATTTCAAAAGACTTGGAAGAGGG + Intergenic
908301550 1:62765798-62765820 ATTTAAAAACATGTAAAACAAGG - Intergenic
908518436 1:64917103-64917125 ATTTCATAACATTGGAAACAAGG + Intronic
909617649 1:77629661-77629683 CCTTCAAAAGATCTGGAGCAAGG + Intronic
909805872 1:79873669-79873691 ATTTCAGAATATATAGAACAAGG - Intergenic
910505632 1:87947279-87947301 ATTTAAACACATATGGAAAATGG + Intergenic
911199319 1:95028515-95028537 ATTAAAAAAAATCTGGAACTGGG + Intronic
912221422 1:107681591-107681613 ATTTCCAAAAATATGGAAAAAGG + Intronic
912376102 1:109211179-109211201 ATTTCAAAACATGAGGGACAAGG + Intergenic
912943234 1:114063354-114063376 ATTGGAATACAGCTGGAACAGGG + Intergenic
913056747 1:115169182-115169204 ATTTCAAAACATTTCCCACAGGG + Intergenic
916000866 1:160614007-160614029 ATTTCGGAAGATCTGGAGCAGGG + Intronic
916121004 1:161527986-161528008 ATTTCAAAACATCTAGGGGAAGG - Intergenic
916130775 1:161609628-161609650 ATTTCAAAACATCTAGGGGAAGG - Intronic
916243829 1:162666629-162666651 ATGTAAAATCATCTGGCACATGG + Intronic
916895792 1:169160464-169160486 ATTCCAAAACATCTAGTACCAGG - Intronic
917389877 1:174523646-174523668 ATTTCAAAACCACTAGAAGAGGG - Intronic
917713838 1:177713435-177713457 TTTATAAAACATCTGTAACAGGG + Intergenic
918079095 1:181192009-181192031 TTCTCAAAATTTCTGGAACAGGG + Intergenic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
918769607 1:188538634-188538656 ATTTCAGAAGATCTGTAAGAGGG - Intergenic
919561154 1:199120827-199120849 ATTTCAATGCATCTGAAAGACGG - Intergenic
920998688 1:211019834-211019856 AAATCAAAACATGTGGAACTTGG + Intronic
921358671 1:214309978-214310000 ATTTCTTAAAATGTGGAACAGGG - Intronic
921434083 1:215096732-215096754 ATTTTTAAAGATATGGAACATGG + Intronic
921609895 1:217199300-217199322 ATCTTAAAACATCTTGAACCCGG + Intergenic
923164228 1:231344056-231344078 ATTAAAAAACATCTTGAAAATGG - Intronic
923171280 1:231420380-231420402 GTTTCAAAACAGTAGGAACAGGG + Intronic
923306047 1:232689584-232689606 ATTTCTCAACATCTGGTCCATGG + Intergenic
923318011 1:232800463-232800485 ATTTCTAAACTTCTGGAAAGGGG - Intergenic
924021957 1:239792901-239792923 ATTTCACAGCATCTGTAACTAGG - Intronic
924771157 1:247080640-247080662 CTCTCAAAACATATGGTACAAGG - Intergenic
924880881 1:248161209-248161231 CCTTCAAAATATCTGTAACATGG - Intergenic
1063849588 10:10170913-10170935 ATTTTCTAACATCAGGAACAAGG - Intergenic
1063912350 10:10844279-10844301 TTTTCAAAACATTCAGAACAAGG + Intergenic
1064488660 10:15825709-15825731 ATTTCAAAACATGTTGTACACGG - Intronic
1065423925 10:25579208-25579230 ATTGCAAAAAATCCTGAACATGG - Intronic
1065440070 10:25743906-25743928 TTTTAAAAGCATATGGAACATGG + Intergenic
1065690840 10:28331965-28331987 ATTTCTAAACATCTGCAACCTGG - Intronic
1065733199 10:28728114-28728136 ACTTCTGAACATTTGGAACATGG + Intergenic
1067487187 10:46661754-46661776 ATTACAAAATAGCTGGAAGAGGG - Intergenic
1067607618 10:47680253-47680275 ATTACAAAATAGCTGGAAGAGGG + Intergenic
1067953436 10:50766272-50766294 TTGTTAAAGCATCTGGAACATGG + Intronic
1068284335 10:54914545-54914567 AACTCAAAACATATGGAATAGGG + Intronic
1068410911 10:56653346-56653368 ATTTAAAAAAATCAGAAACAAGG - Intergenic
1069588796 10:69629674-69629696 ATTTTAAAACATCAGGAAGGAGG + Intergenic
1070362100 10:75700713-75700735 ATGTGAAAACTCCTGGAACATGG + Intronic
1070473256 10:76805415-76805437 ATATGATAACATCAGGAACAAGG - Intergenic
1070694356 10:78551100-78551122 ATATCAAATCATCTGGGACTTGG - Intergenic
1071451798 10:85799838-85799860 ATTTCAAAATAGCTAGAAGAGGG + Intronic
1071534531 10:86416960-86416982 GTTTAAAGACACCTGGAACAGGG - Intergenic
1071623175 10:87141618-87141640 ATTACAAAATAGCTGGAAGAGGG + Intronic
1072338349 10:94421011-94421033 ATTTCAAAACAGCTAAAAGAGGG - Intronic
1072645918 10:97253615-97253637 ATTTCAAAATAACTAGAAGAGGG + Intronic
1073497290 10:103904648-103904670 ATTTTAGAAAATCTGGACCATGG + Intronic
1074089652 10:110237270-110237292 TTTTCATAAGATCAGGAACAGGG - Intronic
1074383914 10:113002189-113002211 AACTGAAAACATCTGGATCAGGG - Intronic
1074684058 10:115942259-115942281 ATTGCTAAACATCTTAAACATGG + Intronic
1074724172 10:116290373-116290395 ATTTCAGAAGATCTAGAAAAAGG - Intergenic
1074789860 10:116876143-116876165 ATTTCTAAACTTCTAGAGCAAGG + Exonic
1077650995 11:3972239-3972261 ATTTTAAAAGATCTGTAACTGGG - Intronic
1077824992 11:5797410-5797432 ATTTAAAAACATCTGGCACCAGG + Intronic
1078472964 11:11606428-11606450 AGTGCTAAACATCTGGTACATGG + Intronic
1078616466 11:12870583-12870605 TTTTCAAAATATCTAGGACAAGG + Intronic
1078979158 11:16512740-16512762 ATTTGACAACTTCTGGCACAGGG + Intronic
1079898696 11:26153865-26153887 ATTTCAAAACAGCTAGAAGTGGG + Intergenic
1079927671 11:26515293-26515315 ATTTCCAAACTTCTGGATCAAGG - Intronic
1080203110 11:29696955-29696977 CTATCAAAACATCTGGAATATGG - Intergenic
1080274174 11:30485400-30485422 ATTGCATAACATGTGTAACAAGG + Intronic
1080504391 11:32898178-32898200 ATTTTTAAACATCTGTAATATGG + Intronic
1080840646 11:35980688-35980710 ATTTCAAAACATCTGGCTAGCGG - Intronic
1081009521 11:37791542-37791564 CTATCAAAACATCTGGGACATGG - Intergenic
1081030662 11:38077721-38077743 ACTTCAAAACATGTTGTACATGG + Intergenic
1081232383 11:40601485-40601507 GATTCAATACATCTGGAATAGGG + Intronic
1082170323 11:48996716-48996738 ATCTCAAAACCTGAGGAACAAGG + Intergenic
1082186568 11:49189277-49189299 ATTGGAAATCATCTGGGACAGGG - Intronic
1083214236 11:61208428-61208450 CTTTGACAACATCTGGAACCAGG + Exonic
1083217120 11:61227257-61227279 CTTTGACAACATCTGGAACCAGG + Exonic
1083220002 11:61246083-61246105 CTTTGACAACATCTGGAACCAGG + Exonic
1085905666 11:80759036-80759058 CTATCAAAACATTTAGAACAAGG + Intergenic
1086679769 11:89656096-89656118 ATTGGAAATCATCTGGGACAGGG + Intergenic
1086695492 11:89839648-89839670 ATCTCAAAACCTGAGGAACAAGG - Intergenic
1086710661 11:90004837-90004859 ATCTCAAAACCTGAGGAACAAGG + Intergenic
1086992541 11:93319985-93320007 ATTTAAAAACATGTTGTACATGG - Intergenic
1087047616 11:93856173-93856195 ATTTCAAATTATGGGGAACAAGG - Intergenic
1087209642 11:95433827-95433849 ATTTTAAAACATCAGGAAATGGG - Intergenic
1087281335 11:96214381-96214403 TTTTCAAAACATCTGTAAGATGG + Intronic
1087283969 11:96244145-96244167 ATTTCAAAACATCTGGAACACGG - Intronic
1087903137 11:103665161-103665183 ATATCAGAATCTCTGGAACAAGG - Intergenic
1088260572 11:107939749-107939771 ATATCAATACTTCTGCAACAGGG - Intronic
1088302394 11:108373404-108373426 ATCTCCAAAGATCAGGAACAAGG + Intronic
1091535312 12:1402130-1402152 ATTGCAAAATATTTAGAACAGGG + Intronic
1092553896 12:9534678-9534700 ATTTCAAGAAATCAGGATCATGG - Intergenic
1093422857 12:18994963-18994985 ATTTCAAAATATCTGAAAGAGGG + Intergenic
1094518199 12:31155937-31155959 ATTTCAAGAAATCAGGATCATGG + Intergenic
1094549055 12:31432947-31432969 ATTTCAAGACATCTATAATAAGG - Intronic
1095082595 12:38023812-38023834 GTTTCCAAACATCTGAAAAAAGG - Intergenic
1096953183 12:55497364-55497386 ATTTCAAAACCACGGGAACCTGG + Intergenic
1097475452 12:60050097-60050119 ATTTCAAAACATCTTTCAGAAGG - Intergenic
1097890176 12:64770184-64770206 TTTTGAAAACTTCTGCAACATGG - Intergenic
1099937411 12:89143633-89143655 ATTCCAAATCAACTGGAAAATGG - Intergenic
1100608906 12:96174511-96174533 ATTTCAAAATAGCTAGAAAAGGG - Intergenic
1102533765 12:113566022-113566044 ATGCAAAAACATCTGGCACAAGG - Intergenic
1105485435 13:20825900-20825922 ATTTTAAAATATCTAGAACAAGG - Intronic
1105668192 13:22584080-22584102 ATTTGAAAACAATGGGAACAAGG - Intergenic
1106236144 13:27862097-27862119 ATTTCAAAATAACTGAAAGATGG + Intergenic
1106460599 13:29964423-29964445 ATCTTATAACTTCTGGAACATGG - Intergenic
1106882660 13:34148678-34148700 ATTTCTAAAAATCATGAACAGGG + Intergenic
1107003906 13:35585047-35585069 TTTTCAAAACATTTGGAAACTGG - Intronic
1107216220 13:37922000-37922022 ATTTCAAAGTAGCTGGAAGAAGG - Intergenic
1107796934 13:44062571-44062593 TTTTTATAACAGCTGGAACATGG + Intergenic
1108345434 13:49541788-49541810 ATTCCAATACGACTGGAACATGG + Exonic
1108475176 13:50809192-50809214 CTTTCTAAATATCTGGTACAAGG - Intronic
1108684334 13:52805628-52805650 ATTTCCTAACCTATGGAACAGGG + Intergenic
1110296037 13:73867055-73867077 ATTTTAAAATATCAGGAAAAAGG + Intronic
1110399193 13:75069937-75069959 ATTTCAAAGCATCTCCAAAAAGG + Intergenic
1110507282 13:76301676-76301698 AATTAAAAACACCTGGAACATGG - Intergenic
1112622719 13:101067935-101067957 CTTTCAAATAATATGGAACATGG - Exonic
1112632238 13:101174747-101174769 ATTTAAAAGCATATGGAACCTGG + Intronic
1112892020 13:104248327-104248349 ATTTAGAAACATGTGGAATAAGG + Intergenic
1113015137 13:105820696-105820718 ATTGCAAAACATCAGAGACATGG - Intergenic
1113057673 13:106287305-106287327 ATTACAGAACCACTGGAACATGG - Intergenic
1115191362 14:30750607-30750629 ATTACAACACATCTGTACCATGG + Intergenic
1115327556 14:32158645-32158667 GTTTCAATACATATGGGACATGG + Exonic
1115401440 14:32965631-32965653 CTCTCTAAAAATCTGGAACAAGG + Intronic
1115607487 14:35018723-35018745 ATTTCAAAATATCATGAAAATGG + Exonic
1115849332 14:37576864-37576886 ATATGAAGACATCTGTAACATGG - Intergenic
1116559357 14:46358878-46358900 ATTTCAAAACAGCTAGAGGAGGG + Intergenic
1117648103 14:57873687-57873709 ATTTCAGAACACTTGGAAAATGG - Intronic
1117723403 14:58648548-58648570 ATTACAAAAAATCTCAAACATGG + Intergenic
1117826133 14:59705596-59705618 TCTTCAAAAAATCTGGGACAGGG - Intronic
1117848615 14:59941821-59941843 ATTTTCAAAAATCTGGAAGAAGG - Intronic
1119109558 14:71958778-71958800 CTTACAAATCATCTGGAAAATGG + Intronic
1119996224 14:79256646-79256668 ACTTCACAGCAGCTGGAACAGGG + Intronic
1121941354 14:98073913-98073935 ATTTCAAGGCATCAGGCACATGG - Intergenic
1124693509 15:31845128-31845150 ATTTTAAACCAGCTGTAACATGG - Intronic
1125038411 15:35154149-35154171 ATTACAAAACAGCTGGAAGAGGG + Intergenic
1125054875 15:35346856-35346878 ATATCTAAATATATGGAACAAGG - Intronic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1127490635 15:59459384-59459406 ATATCAGATCATCTGGAAAAAGG + Intronic
1127536620 15:59895766-59895788 ATTTTAACTCTTCTGGAACAGGG - Intergenic
1130539717 15:84813430-84813452 AGTTCAAAATAACTGGAAGATGG + Intergenic
1132023059 15:98381496-98381518 ATCTCAGAATATCTGGAACATGG + Intergenic
1132242861 15:100273851-100273873 ATGTCAAAACTTATGGGACAAGG - Intronic
1136257320 16:29050445-29050467 ATTTAAAATCATCCTGAACATGG + Intronic
1138864973 16:60806582-60806604 ATATCAAAACATATGGGATATGG + Intergenic
1139124660 16:64063659-64063681 TTTGCAAAATATCTGGCACAAGG + Intergenic
1140367011 16:74389768-74389790 ATTTAAAATCATCCTGAACATGG + Intronic
1141019214 16:80479295-80479317 TTTTCAAAACATCTTGGAAAAGG + Intergenic
1147273023 17:39290444-39290466 ATTCCCTAACATCAGGAACAAGG - Intronic
1147623572 17:41884565-41884587 ATTTTAAAACAACTGCACCAGGG - Intronic
1148197209 17:45722599-45722621 ATTTCAACACATATAGAACTTGG - Intergenic
1149933873 17:60784051-60784073 GTATCTAAACATCTGGAATATGG + Intronic
1150578463 17:66451314-66451336 ATTTCAAAACTTTTAGAATACGG + Intronic
1150831431 17:68523446-68523468 AAATCAAAACACCTGGACCAAGG - Intronic
1151130911 17:71895181-71895203 AATTCAAAACATCCAGATCAGGG + Intergenic
1152500731 17:80707212-80707234 TTCTGAAAACATCTGGAGCATGG - Intronic
1153057479 18:960895-960917 ATTTCAAAACTTCTTTGACAAGG + Intergenic
1154406250 18:14094355-14094377 TTTATAAAAGATCTGGAACAAGG - Intronic
1155196661 18:23481415-23481437 AATTCCACACATCTGGCACATGG - Exonic
1155526727 18:26723455-26723477 ATTTCTAATGACCTGGAACAGGG - Intergenic
1155652421 18:28158038-28158060 ATTTCATAAAACCTGGAGCATGG + Intronic
1156114402 18:33769755-33769777 ATTATACAACATCTGGAAAAAGG - Intergenic
1156387736 18:36621386-36621408 AACCCAAAACATCAGGAACAGGG - Intronic
1156730140 18:40183904-40183926 ATTTAAACACATGTGGAGCATGG - Intergenic
1156754176 18:40500777-40500799 ATTTCCAAACATCTGGACTTTGG - Intergenic
1156809399 18:41228308-41228330 ATTTCTGCACATCTGAAACATGG + Intergenic
1157183088 18:45514926-45514948 ATTTGACAAAATGTGGAACAGGG - Intronic
1157399411 18:47374703-47374725 ATTTTATAATATTTGGAACAAGG + Intergenic
1157430287 18:47619246-47619268 ATTTCAACACATAGGTAACACGG - Intergenic
1158274360 18:55750431-55750453 TTTTCAAAACATCTGATAAAGGG + Intergenic
1158743840 18:60174559-60174581 ATTTAAAAACATATGCAAAATGG + Intergenic
1159033342 18:63253531-63253553 ATTTCAAAACATCAGTGACTAGG + Intronic
1159529852 18:69641479-69641501 AATTCATTAAATCTGGAACAGGG + Intronic
1162006822 19:7786481-7786503 ATTTTAAAATACCTGGCACATGG + Intergenic
1163321703 19:16578397-16578419 ATTTCCACAGATCCGGAACATGG - Exonic
1164018139 19:21270995-21271017 CTATCAAAACATCTGGGATATGG - Intronic
925095171 2:1192809-1192831 ATCACAAAACCTCTAGAACAGGG - Intronic
925446686 2:3932167-3932189 ATTGCAAAAAATATGGAACCAGG - Intergenic
925783116 2:7402085-7402107 ACTTCAAGACATCAGGAACTAGG - Intergenic
928139880 2:28719162-28719184 ATTTCAAACCATTTTAAACAAGG - Intergenic
929657340 2:43747213-43747235 ATTCCAAAAGATCAGGAACTGGG - Intronic
930397964 2:50847306-50847328 ACTTAAAAACATCTGGAAACTGG + Intronic
930535803 2:52644719-52644741 ATTTCAAAACAAAAGGAAGAAGG - Intergenic
930604499 2:53479428-53479450 GTTTAAAAACTTCTGCAACAAGG - Intergenic
931208712 2:60172056-60172078 CTTGCACTACATCTGGAACATGG + Intergenic
933574018 2:84046329-84046351 ATTTCAAAAAATCTCTAACGAGG + Intergenic
933853368 2:86389603-86389625 TTTTCACAAGATCAGGAACAAGG - Intergenic
935985447 2:108668217-108668239 ATTTCAAAATAGCTAGAAAAGGG - Intronic
936137876 2:109911864-109911886 ATTTCAAAATAGCTAGAAAAGGG - Intergenic
936206821 2:110459621-110459643 ATTTCAAAATAGCTAGAAAAGGG + Intronic
936670306 2:114648727-114648749 AGTCCAAAACATCTGCATCAGGG + Intronic
937169644 2:119852795-119852817 ATATCAAAACTTGTGGAATAAGG - Intronic
939219572 2:139284242-139284264 CTATCAAAACCTCTGGAATATGG + Intergenic
940991976 2:160106536-160106558 TTTTTAAAACAACTGGAAAAAGG - Intronic
942552529 2:177134396-177134418 AATTTAAAAAATCAGGAACAAGG + Intergenic
942797281 2:179836478-179836500 ATTTCAAGATATCTGAATCAAGG + Intronic
943767625 2:191678891-191678913 ATTTTAATACATCTGGAAGGTGG - Intronic
943965418 2:194327015-194327037 ATTTCAAAATATCTGTTATATGG + Intergenic
944039974 2:195342299-195342321 ATCTGAAATAATCTGGAACAAGG - Intergenic
944055605 2:195519182-195519204 ATTTTAAAAGAATTGGAACAAGG + Intergenic
944895733 2:204162179-204162201 CTGTAAAAACATCTGGATCAGGG - Intergenic
945387256 2:209217413-209217435 ATATCAAAACCTCTGCGACATGG + Intergenic
945571199 2:211469995-211470017 ACTTGAAAACATGAGGAACAAGG + Intronic
945802891 2:214455558-214455580 ATTTCAAAATAGCTGGAAGAGGG - Intronic
945884524 2:215361223-215361245 ATTTCAAAACATTTGCATCTTGG + Exonic
1169100188 20:2940837-2940859 TTTACAAATCATCTGGAAAAAGG - Intronic
1170734853 20:19005839-19005861 ATTGCAAAAAATCTGAGACAGGG - Intergenic
1172057371 20:32163961-32163983 TCCTCAAAACATCTGGAATATGG + Intronic
1172519057 20:35555650-35555672 ATTTTAAGAAATCTGGAACCTGG + Intronic
1172987574 20:39004857-39004879 ATTTCAGACCACCTGGAAGAGGG + Intronic
1173286797 20:41679512-41679534 ATTTAAAAAAAACTGGAAAATGG + Intergenic
1175288297 20:57853106-57853128 ATTTCTAAATAACTGGATCATGG - Intergenic
1175346098 20:58277514-58277536 TTTTGAAAACATCAGAAACAGGG + Intergenic
1175515960 20:59569950-59569972 ACTTCTAAGCATCTGGCACACGG + Intergenic
1176312770 21:5162305-5162327 ATTTCAATACAGCTAGAACCAGG + Intergenic
1177102557 21:16915386-16915408 AGTTCCAAATATCTGGAAAATGG + Intergenic
1177352050 21:19955908-19955930 ATTTCAAAATAGTTAGAACAGGG - Intergenic
1177670854 21:24224623-24224645 ATTGCACCACAACTGGAACATGG - Intergenic
1177760105 21:25393579-25393601 CTTCCAAAACAGCTGGAAGATGG + Intergenic
1179207192 21:39292510-39292532 ATTTCAAAACGTCTGGGGCGAGG - Intronic
1179844278 21:44099725-44099747 ATTTCAATACAGCTAGAACCAGG - Intronic
1179944538 21:44662934-44662956 ATGTCAAAATATATGGAACATGG + Intronic
1181554370 22:23659430-23659452 GTTTCAACACATCTTGAATATGG - Intergenic
1182961527 22:34479936-34479958 ATTTCTATGCATTTGGAACATGG - Intergenic
949606143 3:5656422-5656444 ATTTAAAAATACATGGAACAAGG + Intergenic
951000669 3:17555660-17555682 ATTTCAAAACATGTTAAATATGG + Intronic
951097983 3:18653886-18653908 ATTTCAAAATAACTAGAAGAGGG - Intergenic
951664792 3:25110706-25110728 ATTTCAAAATCTCAGGAAGAAGG + Intergenic
952543257 3:34390676-34390698 ATTTCAAAACTGCTAGAAGAGGG - Intergenic
952864807 3:37847539-37847561 ATTTCAAAATATCTTTAAAAAGG - Intergenic
954750107 3:52808719-52808741 ATTTTATGGCATCTGGAACATGG + Exonic
955941558 3:64150920-64150942 AACTCTAAACATCTGGAAAAGGG + Intronic
956998827 3:74860046-74860068 TTTTTAAAATATCTGAAACATGG - Intergenic
958422916 3:93948892-93948914 TTTTCATAAAATCAGGAACATGG - Intronic
958528143 3:95289200-95289222 ATTTCAAAATATCTTGAATCTGG - Intergenic
958666273 3:97141649-97141671 ATATCAAAACCTCTGGGAAATGG + Intronic
958843617 3:99238937-99238959 ATTTCAAAATAGCTAGAAGAAGG - Intergenic
959331996 3:105018402-105018424 AGTTAAAAACACCTGGCACATGG + Intergenic
959799477 3:110474503-110474525 ATTTCAAATCATTTTCAACAGGG + Intergenic
960300460 3:115997126-115997148 GTTTCAATACATCTGGAATGGGG + Intronic
960607757 3:119525564-119525586 ATTTCAAAACACCTTGATCAAGG + Exonic
960965503 3:123101557-123101579 ATTTCATAACTTCTTCAACATGG + Intronic
961866119 3:129954639-129954661 ATTTCCACACCTCTGGCACAAGG + Intergenic
962032390 3:131614854-131614876 ATATTAAGACATCTTGAACAAGG - Intronic
962195915 3:133363268-133363290 AATTCAGTCCATCTGGAACAGGG + Intronic
962628092 3:137247530-137247552 ATTACAAAACAGCTGGAAGAGGG - Intergenic
963493818 3:146034781-146034803 ATTTCAAAACATTAGGCCCAGGG - Intergenic
964305046 3:155330739-155330761 AATTCAAAATATCTGGATGAGGG - Intergenic
965641617 3:170834862-170834884 ATTTCAAAAAATCTTTAAAATGG - Intronic
966357418 3:179095750-179095772 ATTCCATGACATCTGGACCATGG + Intergenic
968166871 3:196473552-196473574 ATTTAAAGATATCTGTAACATGG + Intronic
970111799 4:12645871-12645893 ATATCAAAACAGCTATAACAGGG + Intergenic
972364287 4:38359774-38359796 ATTAAAAAAAATCTGGATCACGG + Intergenic
972689238 4:41380593-41380615 ATTTAAAATGATCTGGATCAGGG + Intronic
973917782 4:55654074-55654096 ATTTCAAAACACCTGGCCTAAGG + Intergenic
974092527 4:57327089-57327111 ATTGCAAAATATCTCCAACATGG + Intergenic
974183225 4:58410166-58410188 TTTTCAACACATCTTGAAGAAGG - Intergenic
975728663 4:77316927-77316949 AGTCCAAACCATCTGGGACAAGG - Intronic
978103705 4:104875448-104875470 ATTCCAGAATCTCTGGAACATGG + Intergenic
978264203 4:106803134-106803156 ATTCCAAAACATTTGGAAGTTGG + Intergenic
978350712 4:107818058-107818080 ATTGCAAAACATATGGACCAGGG - Intergenic
978870997 4:113577827-113577849 ATGTCCAAACACATGGAACATGG - Intronic
980064975 4:128177005-128177027 ATATGAAAAGATATGGAACAAGG + Intronic
980345562 4:131612428-131612450 ATTTCAACATATTTGAAACAAGG + Intergenic
980840871 4:138259709-138259731 ATTTCAAAACACCTTAAATAAGG + Intergenic
980998173 4:139801612-139801634 ATTTGAAAAGAGCAGGAACAGGG + Intronic
981266794 4:142793751-142793773 ATTTCAAAACACCAGCAGCAAGG + Intronic
981425524 4:144598041-144598063 ATTGCAAAACAGCAGGAAAATGG + Intergenic
981428982 4:144639113-144639135 ATTTCAAAATTTCTGGAATGTGG + Intergenic
981816893 4:148840932-148840954 ATTTTAAAACATATGGATAAAGG - Intergenic
982598458 4:157415135-157415157 ATTTTAAAATATCTGAGACAGGG + Intergenic
982710768 4:158756633-158756655 ATTTCAGAACATCTTGGATAAGG - Intergenic
984144153 4:176040819-176040841 ATTTCAAAAAATTTGGGAGAAGG - Intergenic
984506961 4:180631972-180631994 ATTTCAAAAGATCAGGAAAATGG - Intergenic
985287167 4:188347951-188347973 ATTTCAAAATAACTAGAAGATGG + Intergenic
987115650 5:14724696-14724718 TTTTCAAAGCATTTGGAACCGGG + Intronic
987186084 5:15420386-15420408 ATTTCTAAATATCTGGAATTTGG - Intergenic
989542775 5:42637004-42637026 AATTCACAATATCTGGTACAAGG + Intronic
989759470 5:44995598-44995620 ATTTCAAAGTGTCTGGAAAAGGG - Intergenic
990131370 5:52589811-52589833 ATTTCAAAATAGCTAGAAGATGG + Intergenic
992578571 5:78146731-78146753 ATTTCAAAACATGTAGGACATGG - Intronic
993100500 5:83532831-83532853 ATTTCAAAAAATATGCAAAATGG - Intronic
993303992 5:86252201-86252223 GTTTCAGTAGATCTGGAACAGGG - Intergenic
994963308 5:106633560-106633582 ATTTCAAAAGATCTATAAAAGGG - Intergenic
995424720 5:112007684-112007706 ATTAAAAAACAACTGCAACAAGG - Intergenic
995856938 5:116602855-116602877 ATTTGGAAACATCTGGATAACGG - Intergenic
996260685 5:121464043-121464065 ATTTCAAATCAGTGGGAACAGGG - Intergenic
996503868 5:124246574-124246596 TTATCAAAACCTCTGGAATATGG + Intergenic
997152656 5:131515337-131515359 ATTTCATAACCTCTACAACACGG + Intronic
997629723 5:135357656-135357678 ATTTTAAAACCTCTGAAAAAAGG + Intronic
998094291 5:139388574-139388596 ATTTTGCCACATCTGGAACAAGG + Exonic
998238570 5:140421961-140421983 ATTTCAACAGATCAGCAACAAGG - Intronic
998803813 5:145898398-145898420 ATTTCAAAACATCAAGTAGAAGG + Intergenic
998897945 5:146820173-146820195 ATTTCAAAACATCTAGAAGCAGG + Intronic
999013649 5:148071957-148071979 ATTGAAAAATATCTCGAACATGG - Intronic
1000505377 5:162110212-162110234 ATTTCAAAACATCAGCTCCATGG + Intronic
1001305634 5:170570536-170570558 ATTTGATAAGATTTGGAACAAGG - Intronic
1001850582 5:174961208-174961230 ATTTCAAAATAGCTAGAAGAGGG - Intergenic
1003354375 6:5352932-5352954 ATTTCAAAATATCTAGAAGAAGG - Intronic
1003430658 6:6034256-6034278 ATTACAAAATAACTGGAAAATGG + Intergenic
1003807931 6:9747256-9747278 TTTTAAATTCATCTGGAACAAGG + Intronic
1003925245 6:10871489-10871511 ATTTCCCAACATGTGGTACAAGG - Intronic
1004310036 6:14537253-14537275 TTTTCAGAACATCTGGAATGTGG - Intergenic
1004753859 6:18590400-18590422 ATTGCAAAACATCAGGATAAAGG - Intergenic
1005356868 6:24992966-24992988 ATTGTAAAACATCTGCAATAAGG + Intronic
1005787320 6:29258060-29258082 TTTTCTAAACATTTGCAACATGG - Intergenic
1007036845 6:38682194-38682216 ATTTCAAAACATAAGGCACTTGG + Intronic
1007993187 6:46278810-46278832 ATTTTAAAATATTTGCAACAGGG - Intronic
1008453731 6:51684065-51684087 CTTTCAGAATAGCTGGAACATGG - Intronic
1008469837 6:51872314-51872336 ATTGCAAAACACCAGGGACAAGG + Intronic
1009316981 6:62231981-62232003 ATTTCAAAACATATTAAACCAGG - Intronic
1009564649 6:65297822-65297844 AATTCAAAACAACTGCCACATGG + Intronic
1009733299 6:67638535-67638557 ATTTCAAAATAACTAGAAGAGGG - Intergenic
1010748662 6:79593412-79593434 ATTTCAAAATATCTAGGACTGGG - Intergenic
1010792684 6:80082939-80082961 AATTCAAAACATTGGGAAGATGG + Intergenic
1010941678 6:81926449-81926471 TTTACAAAATACCTGGAACAGGG + Intergenic
1011118672 6:83925600-83925622 ATTCCAAAACACTTAGAACAAGG - Intronic
1011891489 6:92167093-92167115 AGTTCAAAACATCTCAAATATGG - Intergenic
1011908716 6:92408075-92408097 ATTTCAAAAAATCTAAAAGAAGG - Intergenic
1012597474 6:101056622-101056644 ATTTCAAATGATCTGGTAAAAGG - Intergenic
1012769598 6:103414325-103414347 ATTTCAAGACATCTAGAGTATGG - Intergenic
1014813504 6:125910418-125910440 ATTTCAAAACATATTTAAGATGG + Intronic
1015494866 6:133870049-133870071 ATTTAAAAACATCTGATAAAGGG + Intergenic
1016241546 6:141937379-141937401 ATTTGAGAACAACTGGAATAAGG + Intergenic
1016692561 6:146954857-146954879 ATTTCAAAAGGTCTGGAAAAGGG - Intergenic
1017261537 6:152393339-152393361 CATTTAAAACATCTGGAAGAAGG + Intronic
1018383805 6:163284889-163284911 ATTAAAAAACAGCTAGAACATGG - Intronic
1018579810 6:165298655-165298677 ATCTCAAAACGTAAGGAACAAGG + Intronic
1018624299 6:165762969-165762991 CTTTCAAAAGCCCTGGAACAAGG + Intronic
1021337733 7:19424554-19424576 CTTTCAAAATATCTTGATCATGG + Intergenic
1021384716 7:20014840-20014862 ATTTCAAAAAATTAGAAACAAGG + Intergenic
1021386606 7:20038799-20038821 ATTTCAAAACAGATGGTAGAAGG + Intergenic
1021489642 7:21205009-21205031 ATTTCAGAACATCGGAAATAAGG + Intergenic
1022332022 7:29388954-29388976 ATTTTAACACATCTGTTACATGG + Intronic
1022418735 7:30200538-30200560 ATTTCAAAAGATCTGAAATAAGG + Intergenic
1023176148 7:37437657-37437679 ATTTCAAAACAGCTAAAAGAGGG - Intronic
1023330119 7:39106366-39106388 ATTACACATCATCTGGAACATGG - Intronic
1023472827 7:40543180-40543202 ACTTCAAAACATCTGGGATTGGG + Intronic
1024506871 7:50169146-50169168 ATTTGCAAATATCTGCAACAAGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025856324 7:65282878-65282900 AATTCAAAAAATCTAGAACCTGG + Intergenic
1028363140 7:89993368-89993390 ATTTGGAAACATGTGGCACATGG - Intergenic
1028424054 7:90666278-90666300 ATTTCATAAACTCTGGATCAGGG + Intronic
1028804908 7:95014063-95014085 ATTTCCTAAAATCAGGAACATGG + Intronic
1029953536 7:104612890-104612912 ATATGAAAAATTCTGGAACAAGG - Intronic
1030190105 7:106801949-106801971 ACTTCAAATCATCTAGAAGAGGG - Intergenic
1030332721 7:108289293-108289315 ATTTCAAAACATGTTGTACATGG - Intronic
1030339426 7:108360015-108360037 TGCTTAAAACATCTGGAACATGG - Intronic
1030347701 7:108453558-108453580 GTTTCAAAACAACTGCAATAGGG - Intronic
1030654325 7:112149717-112149739 AATTCAGTACATCTGGAAAACGG + Intronic
1030718385 7:112838505-112838527 ACCTCAGAAGATCTGGAACAAGG + Intronic
1030982830 7:116206904-116206926 ACTTGCCAACATCTGGAACAAGG - Intergenic
1031263980 7:119560055-119560077 ATTTTAATATAGCTGGAACATGG + Intergenic
1034324254 7:150216349-150216371 ATTTTTACACATCTGGAAAAGGG - Intergenic
1034686431 7:152975368-152975390 TTCTCAAAACATCTGGCCCAGGG - Intergenic
1034752147 7:153579434-153579456 ATACCAAAACATATGGAATACGG + Intergenic
1034768939 7:153752882-153752904 ATTTTTACACATCTGGAAAAGGG + Intergenic
1035590014 8:805539-805561 AGTTCAAAACAACTGACACAAGG - Intergenic
1037045186 8:14291273-14291295 ATTTCAAAATAGCTAGAAGAGGG + Intronic
1037046675 8:14313746-14313768 ATTTCAGAGAATCTGTAACAGGG - Intronic
1037144420 8:15555655-15555677 ATATCAAAACATCAGGAAATTGG - Intronic
1037797153 8:22005426-22005448 TTTTCATAACATTTTGAACAAGG + Exonic
1037829459 8:22179224-22179246 ATCTGAAAGCACCTGGAACAAGG - Intronic
1038809316 8:30823818-30823840 ATTTAAAAATAGCTGGAAGAGGG - Intergenic
1038898813 8:31818749-31818771 TTTTTATAACATGTGGAACACGG - Intronic
1039540642 8:38365347-38365369 ATTTCCCAAGATCTAGAACAGGG - Intronic
1041154488 8:54971151-54971173 ATTTCAAAACAGCTAAAAGAGGG + Intergenic
1041547681 8:59064138-59064160 ATTTCAGACCATAGGGAACATGG - Intronic
1041834769 8:62199014-62199036 AATTCTACACATCTGGGACAGGG - Intergenic
1042071366 8:64938885-64938907 ACTTCAAAACATCATGGACATGG - Intergenic
1042613594 8:70624727-70624749 ATTTCAGAACATCAGAAATAAGG - Intronic
1043190994 8:77223065-77223087 ATTTCAAAACAAGTGCCACATGG + Intergenic
1043286871 8:78543155-78543177 ATCTTAAAATATCTGGAACCAGG - Intronic
1044082183 8:87898860-87898882 GATTCAAAACCTATGGAACATGG - Intergenic
1044103093 8:88165681-88165703 ATAATAAAACATCTGGAACATGG - Intronic
1044106488 8:88213893-88213915 ATTTCCAAACATTTGGAATATGG - Intronic
1046829944 8:118733591-118733613 AATTCAAAACATCTGGCATATGG - Intergenic
1046873548 8:119229210-119229232 ATTTCAAAGCTTCAGGGACAAGG - Intronic
1047085038 8:121506675-121506697 ATTTTAAAACAATTGGAACAGGG + Intergenic
1047095725 8:121623391-121623413 AATTCCAAACATTTGGAATAAGG - Intronic
1047329973 8:123878108-123878130 AATTAAAAACAGCTGGAAGAAGG + Intronic
1047948663 8:129909119-129909141 ATTTCAAATCTTCTGGAGCATGG - Intronic
1048542975 8:135359683-135359705 ATTTGAAAGCATCTAGCACAGGG + Intergenic
1048791174 8:138105345-138105367 ATTTGAAAACATATGGTACATGG + Intergenic
1051059572 9:13030558-13030580 ATTGCCAGATATCTGGAACATGG + Intergenic
1051116982 9:13706970-13706992 GTTTCAAAACATCTGGCTGAAGG - Intergenic
1053136240 9:35651821-35651843 TTTTCAGAATTTCTGGAACATGG - Intergenic
1054798995 9:69327995-69328017 AATTCAAAACATGTGATACAAGG - Intronic
1056120339 9:83481542-83481564 ATTTTAAAAAATATGGAAGAGGG + Intronic
1057024146 9:91723281-91723303 ATTTCAAAACGTTGGGAATAAGG - Exonic
1057143257 9:92740487-92740509 ATATCAAAACTTCAGGATCACGG + Intronic
1058195998 9:101976643-101976665 ATTTCTGAACATCTGCAACTGGG + Intergenic
1060160732 9:121360839-121360861 ATTGCAAATCACCAGGAACAAGG + Intronic
1186382249 X:9073182-9073204 ATTTCAACATATCTGCATCAAGG - Intronic
1186802592 X:13108567-13108589 ATGTCAAAACGTGTGGAATATGG - Intergenic
1188189849 X:27159699-27159721 ATTTTAAAACTTCAGAAACAAGG + Intergenic
1188403538 X:29778292-29778314 ATTTCAAAATATCTAAAATAGGG + Intronic
1188730287 X:33637623-33637645 AATTAAAAACATCTGGCTCAGGG - Intergenic
1190406893 X:50097251-50097273 ATTTCTAAACATCTGGATCTGGG + Exonic
1190897027 X:54630423-54630445 CTATCAAAACCTCTGGGACATGG - Intergenic
1193079240 X:77389898-77389920 ATATCAAAACATCTCAAAGATGG + Intergenic
1193193892 X:78606803-78606825 ATTTGAAAATGTCTGGAACATGG + Intergenic
1193451962 X:81682163-81682185 ATTTCAAAACATTTGCATCTTGG - Intergenic
1193534556 X:82697038-82697060 ATTTTTAAAAATATGGAACACGG - Intergenic
1193807650 X:86013538-86013560 GTTTCAAAACATCTTGGCCAGGG - Intronic
1194066264 X:89266329-89266351 ATTTCACAACATTTGCAGCAGGG - Intergenic
1194354123 X:92859808-92859830 ATTTCAAAAGATATAGAAAAAGG + Intergenic
1194971192 X:100346140-100346162 GTTTGAAAACACCTAGAACAGGG + Intronic
1195023393 X:100851449-100851471 ATTTCACCAAATCTGGAAGATGG + Intronic
1195812785 X:108852296-108852318 ATTGCAACACCTCTGGAGCAAGG + Intergenic
1196023683 X:111017049-111017071 ATATCAAAATTTATGGAACACGG + Intronic
1197027861 X:121776897-121776919 GTATCAAAACTTCTGGGACATGG - Intergenic
1197265854 X:124370040-124370062 ATTTGAAAACATAAGGAAGAAGG - Intronic
1197630787 X:128855289-128855311 ATTTCAAAACAGCTAGAAGACGG + Intergenic
1197896215 X:131318251-131318273 ATTTCATAGGATCAGGAACAGGG - Intronic
1198045206 X:132894440-132894462 ATTTCAAAAAATCTGAAACCCGG - Intronic
1199533465 X:148875548-148875570 TTTTAAAAACATTTGAAACATGG + Intronic
1200016402 X:153167357-153167379 ATTTTAAAAAATCTGGAATTTGG - Intergenic
1200524277 Y:4252464-4252486 TTTTACTAACATCTGGAACATGG + Intergenic
1200662477 Y:5976829-5976851 ATTTCAAAAGATATAGAAAAAGG + Intergenic
1200720435 Y:6600448-6600470 ATTTCACAACATTTGCAGCAGGG - Intergenic