ID: 1087285719

View in Genome Browser
Species Human (GRCh38)
Location 11:96263156-96263178
Sequence TAAATCAGAATTGATTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 382}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087285719 Original CRISPR TAAATCAGAATTGATTAAAG AGG (reversed) Intronic