ID: 1087287364

View in Genome Browser
Species Human (GRCh38)
Location 11:96279440-96279462
Sequence TTCAGTATACAGATGAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087287363_1087287364 -4 Left 1087287363 11:96279421-96279443 CCTTTTGTTCATTCTTACATTCA 0: 1
1: 0
2: 28
3: 194
4: 1456
Right 1087287364 11:96279440-96279462 TTCAGTATACAGATGAACAAAGG 0: 1
1: 0
2: 1
3: 32
4: 268
1087287362_1087287364 7 Left 1087287362 11:96279410-96279432 CCTTATGATGACCTTTTGTTCAT 0: 1
1: 0
2: 0
3: 22
4: 210
Right 1087287364 11:96279440-96279462 TTCAGTATACAGATGAACAAAGG 0: 1
1: 0
2: 1
3: 32
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087287364 Original CRISPR TTCAGTATACAGATGAACAA AGG Intronic
902419324 1:16265566-16265588 CTCATTTTACAGATGAATAATGG + Intronic
902474181 1:16672566-16672588 TTCAGTTCCCAGATGAACAGTGG + Intergenic
902484622 1:16734876-16734898 TTCAGTTCCCAGATGAACAGTGG - Intergenic
902497409 1:16883177-16883199 TTCATTATACAGCTGGACAATGG + Intronic
904095536 1:27974161-27974183 TTCTGTATGGAGATGAACACGGG + Exonic
904716084 1:32468621-32468643 TTCAGTATAATGATGATAAAGGG + Intronic
907992366 1:59595173-59595195 TTTAGTTTACAGATAAACCATGG - Intronic
908003255 1:59702483-59702505 TTCAGGATAAAGATGAATATTGG - Intronic
908507342 1:64817936-64817958 TTCATTATACAAATGGAGAAGGG + Intronic
908558023 1:65277291-65277313 TTCAGAGTACATATGAAAAAAGG - Intronic
909186531 1:72493617-72493639 GTAATTATAAAGATGAACAAAGG + Intergenic
910486075 1:87715763-87715785 TCCAGTATACAAATGGAAAATGG + Intergenic
912010794 1:104959121-104959143 TTCAGTATACAAATGAAGGGTGG - Intergenic
913002386 1:114593847-114593869 TTCATTTTACAGATGAGAAAAGG - Intronic
913438153 1:118868695-118868717 TTCAGTAGGCAGATGAAGAAAGG - Intergenic
913546753 1:119876506-119876528 TTCAGAAAACAGATGAGGAAGGG + Intergenic
913657757 1:120977489-120977511 TTCATTATACAGCTGGACAATGG - Intergenic
914009106 1:143760573-143760595 TTCATTTTACAGCTGGACAATGG - Intergenic
914522324 1:148428765-148428787 TTCATTATACAGCTGGACGATGG - Intergenic
914647736 1:149669225-149669247 TTCATTATACAGCTGGACAATGG - Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
918269351 1:182881916-182881938 TTCGGTGTACAGATGATTAAAGG + Intronic
919508374 1:198429199-198429221 TTCATTTTACAGATGAACCAGGG + Intergenic
920635625 1:207699769-207699791 TCCAGTATCTAGATGAACAGAGG - Intronic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1065364190 10:24918808-24918830 ATCATTTTACAAATGAACAAAGG + Intronic
1069302877 10:66929681-66929703 TTCACAATACAGATGAACGCAGG - Intronic
1071364576 10:84885391-84885413 TGCAGAAGACAGATGAACAGTGG - Intergenic
1072418204 10:95266542-95266564 TTCATTTTAAAGATGAAAAATGG - Intronic
1073501962 10:103947825-103947847 TTCAATATACATCTGAAAAATGG - Intergenic
1073619605 10:105033129-105033151 TTCAGTATAAAGAGGATAAAAGG + Intronic
1073802342 10:107055903-107055925 TTCAGTATTCAGAAGAAAAAAGG - Intronic
1076385607 10:130052983-130053005 TTGTGTATACAGAGGAACTATGG + Intergenic
1076945675 10:133648024-133648046 TTTACTATAAAAATGAACAAAGG + Intergenic
1077057618 11:602718-602740 TTCAGCAAACACTTGAACAATGG - Intronic
1078558146 11:12347585-12347607 TTCAATTTACAGATGCAGAAGGG - Intronic
1079291295 11:19190417-19190439 TTCAATATACAAATGATCAGTGG - Intronic
1079771166 11:24461597-24461619 TCAAGTATGCAGATGCACAAAGG + Intergenic
1079817044 11:25074489-25074511 TTCATTATTCAGATGATCAAAGG + Intronic
1079826220 11:25198434-25198456 TTCAGTGTACAGAGGATAAAGGG + Intergenic
1080175191 11:29354895-29354917 TTCACTGTACAGATGAAAATGGG + Intergenic
1080955412 11:37088374-37088396 TTTAATATACAAAGGAACAATGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1083539888 11:63505322-63505344 CTCCATGTACAGATGAACAAAGG + Intergenic
1087287364 11:96279440-96279462 TTCAGTATACAGATGAACAAAGG + Intronic
1087972136 11:104497513-104497535 TTCAGTACACAGGTGGACAATGG - Intergenic
1088396924 11:109379225-109379247 TTCAGAATACAGGGGAAGAAAGG + Intergenic
1088445174 11:109918654-109918676 TTCAGTAGACAAATAAACTATGG - Intergenic
1089130810 11:116210507-116210529 TTCAGCATTCAGGTTAACAATGG - Intergenic
1089873512 11:121697574-121697596 TAGAGTATACATATTAACAAGGG - Intergenic
1090050970 11:123379017-123379039 GTCAGTCTAAAGAGGAACAAGGG + Intergenic
1090810929 11:130242038-130242060 TTCAGAAAGCAAATGAACAAGGG - Intronic
1092658000 12:10707538-10707560 TTCAGTAGAGAAATGAACATGGG - Intronic
1092946389 12:13457972-13457994 TTCAGGACACAGATGGCCAAAGG - Intergenic
1093314644 12:17633090-17633112 TTAAGTATCCAGGAGAACAATGG - Intergenic
1093411027 12:18867154-18867176 TCCAGTGTACAGATGACAAATGG - Intergenic
1093907648 12:24711981-24712003 GTCAGTTTACATATGAACACAGG - Intergenic
1094158588 12:27364631-27364653 AACAGTATACAGAAGAACAATGG - Intronic
1095158590 12:38888942-38888964 TTCAATATATAGTTGAAGAAAGG - Intronic
1095448148 12:42302819-42302841 TCCAGGATACAGTTGAAGAACGG - Intronic
1098799978 12:74943891-74943913 TTCTGTAGAAAGATGAATAATGG - Intergenic
1100885444 12:99065012-99065034 TTCAGATTAAAGATGAACAGAGG + Intronic
1101016641 12:100508017-100508039 TTCTCTTTACAGATGAACAGAGG + Intronic
1101407829 12:104444275-104444297 AGCAGTATACTGATGTACAAGGG - Intergenic
1106637731 13:31547407-31547429 TCCATTGTACAGATGAACCATGG + Intergenic
1106863054 13:33932163-33932185 TAGAATAGACAGATGAACAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107607532 13:42075482-42075504 TTTTATATACAGATTAACAATGG - Intronic
1108050287 13:46428434-46428456 TTAAGTATACAGGTGGACAGTGG + Intronic
1109268259 13:60225341-60225363 ATCAGTAGACAGATGAGCAAAGG - Intergenic
1109542810 13:63801750-63801772 TTAAGTATACAGGTGGACAGTGG + Intergenic
1110402906 13:75115054-75115076 TTCATTTTTCAGATGAACCATGG + Intergenic
1112260477 13:97873611-97873633 TGCAGTTTACAGATAAGCAAGGG + Intergenic
1112752170 13:102594608-102594630 TTCATTTTACAGCTGTACAAAGG + Intergenic
1112872728 13:103994686-103994708 TTCAGTATGCATATGGAAAAAGG - Intergenic
1113301112 13:109020212-109020234 TTCATAATACAGATGAACATTGG + Intronic
1113708798 13:112450932-112450954 TTTAGAATACAGATGGCCAAAGG - Intergenic
1113710437 13:112460970-112460992 TTCATTTTACAAAAGAACAAAGG - Intergenic
1114772910 14:25449570-25449592 TGAACTATACTGATGAACAAAGG - Intergenic
1117087356 14:52215272-52215294 TTCAGTTTTCAGATAGACAAGGG + Intergenic
1119701468 14:76758533-76758555 TCCATTTTACAGATGAAGAAAGG - Intergenic
1119769776 14:77213339-77213361 TTGAGCATAAAGATGACCAAAGG + Intronic
1120003471 14:79330198-79330220 GTTAATAGACAGATGAACAAGGG + Intronic
1121721398 14:96111346-96111368 CTCAGTATACAGATGAGAACTGG + Intergenic
1121972790 14:98374111-98374133 TGCTTTATACAGATGAAGAAGGG - Intergenic
1122459545 14:101883822-101883844 TTCAGTAGAAACAGGAACAATGG - Intronic
1123453162 15:20386544-20386566 TTCAGTAATCAGAGGCACAAAGG - Intergenic
1126423281 15:48498592-48498614 TTCAGAATGCAGATGGAGAATGG + Intronic
1127526419 15:59796699-59796721 TTCAGTATTCAGATGACCAGTGG - Intergenic
1128194155 15:65735687-65735709 TGCTGTATACAGAAGCACAATGG + Intronic
1130356464 15:83135472-83135494 TTCAAGATACACATGAATAAAGG - Exonic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131610394 15:93955185-93955207 ACCAGTATACAGACCAACAAGGG - Intergenic
1132240357 15:100253161-100253183 TTCAGCCTCCCGATGAACAAAGG + Intronic
1133644452 16:7750834-7750856 TTCAATATATATTTGAACAAAGG - Intergenic
1134416394 16:14047349-14047371 TTCAGCAGAAAGATGAAGAAAGG + Intergenic
1134783406 16:16919177-16919199 TTGAGAATACAGATAAGCAAAGG - Intergenic
1135872895 16:26168471-26168493 TCCAGTTTAAAGATGAGCAATGG - Intergenic
1135983808 16:27168980-27169002 TTCATTATACATATGAACTGAGG - Intergenic
1139276114 16:65729023-65729045 TTCAGAATACAGATTCTCAAAGG - Intergenic
1139831707 16:69804029-69804051 TTCAATATAAAAATGAGCAAAGG - Intronic
1141324934 16:83047870-83047892 TTCATTTTACAGGTGAATAAAGG + Intronic
1143862864 17:9903936-9903958 TACAGTATAAAGATAAAAAATGG + Intronic
1145179056 17:20728976-20728998 TTCAGGGAACAGATGAACATGGG - Intergenic
1148779811 17:50114970-50114992 TCCATTGTACAGATGAGCAAAGG - Intronic
1151159674 17:72154625-72154647 TTCTGTTTACAGATAAGCAAAGG - Intergenic
1153436483 18:5073288-5073310 TCCAGTTTACAGATGAGAAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156748001 18:40415956-40415978 TTCAATAGACAGGAGAACAAAGG - Intergenic
1156832477 18:41510256-41510278 TTCAGTATAATGTTGAATAAAGG - Intergenic
1156975594 18:43218385-43218407 ATCAATATACATGTGAACAAAGG - Intergenic
1157147595 18:45180274-45180296 CTCATTTTACAGATGAACAGAGG - Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158204253 18:54973875-54973897 TTCAGCATACAGATACCCAAAGG - Intergenic
1159389833 18:67776452-67776474 CTCAATATACATGTGAACAAAGG + Intergenic
1159496374 18:69212687-69212709 TCCATTTTCCAGATGAACAAAGG - Intergenic
1159543909 18:69815312-69815334 TACAATATAAAGGTGAACAAAGG - Intronic
1160316616 18:77853950-77853972 TGCAGGCTAGAGATGAACAAGGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161917958 19:7244203-7244225 TACAGGATAAAGATGAAGAAAGG + Intronic
1163328840 19:16623011-16623033 TTCTGGATACAGATGTAAAAAGG - Intronic
1163768590 19:19177316-19177338 TTCCTTATCCAGATGAAGAAAGG + Exonic
1167854679 19:52227990-52228012 TTCAGTGTGCAGATGAACCTGGG - Exonic
1202707558 1_KI270713v1_random:34970-34992 TTCAGTTCCCAGATGAACAGTGG + Intergenic
925045772 2:772015-772037 TTCAGTTTAAAGATGAATATTGG - Intergenic
926802981 2:16678146-16678168 TTCAGTACAGTGTTGAACAATGG + Intergenic
928166914 2:28978473-28978495 TTCACTTTACAAATCAACAAGGG + Intronic
930414514 2:51074477-51074499 ATCTGTACACAGATGAAAAAAGG - Intergenic
930626328 2:53701835-53701857 TTCTGTAAACACAAGAACAATGG + Intronic
930698710 2:54438188-54438210 ATCATTTTACAGATGAGCAAAGG + Intergenic
930963440 2:57289505-57289527 TTCACTATAAAGATGGAAAACGG + Intergenic
930998153 2:57747853-57747875 TTGATAATACAGATGAATAATGG - Intergenic
931856049 2:66302727-66302749 ATGAGTAAACAGATGAATAAAGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
935073036 2:99712654-99712676 TTCAGTACACACATTCACAAAGG + Intronic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
939756858 2:146124597-146124619 TTTAGTGTACAGTTGAACATAGG - Intergenic
939761317 2:146184173-146184195 TTTAGTATACAATTGAAAAAAGG + Intergenic
941417574 2:165241203-165241225 TTCAGTATACTGTTGCTCAATGG + Intronic
941515343 2:166467363-166467385 TTCAGTATAAAGATATACTAAGG - Intronic
942039650 2:172046351-172046373 TTCATTATGTAGATGAGCAATGG - Intronic
944985270 2:205169025-205169047 TTCCGTTTACAGATGAATAATGG - Intronic
945378513 2:209110042-209110064 TTCAGTATACAGAAGAGGAGAGG - Intergenic
946022984 2:216654396-216654418 GTCCTTTTACAGATGAACAATGG + Intronic
948603048 2:239118279-239118301 TTCGGTTTAGAGATAAACAATGG - Intronic
1169045618 20:2532546-2532568 CTCGATATACAGATGAACAGTGG + Intergenic
1170406498 20:16043432-16043454 ATCAGTATACAAATAGACAATGG - Intronic
1173436399 20:43035635-43035657 TTCAAAAACCAGATGAACAAAGG + Intronic
1173784147 20:45780376-45780398 GTCAGTATAAAGAGGTACAAAGG - Intronic
1175369097 20:58475035-58475057 TCCAGTTTGCAGATGAACAGTGG + Intronic
1175554340 20:59837414-59837436 TTCAGTACCCAGACCAACAAGGG - Intronic
1177425697 21:20920769-20920791 TTCAGATTACAGAGGAACAGTGG + Intergenic
1179526802 21:41983649-41983671 TACTGTATACAGAGGAACAAAGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1181633282 22:24162491-24162513 TACAGTAAAGAGATGAACAAGGG + Intronic
1182481380 22:30611196-30611218 TTCATTCTATAGATGGACAAAGG - Intronic
1184526954 22:45029807-45029829 CTCAGTTTATAGATGAAGAAAGG + Intergenic
949294293 3:2502714-2502736 TTCATTTTACAGAGGAAGAAAGG + Intronic
949837231 3:8282176-8282198 TTCCTTATACAGAAGAACAGAGG - Intergenic
951090422 3:18566891-18566913 TACAGTAGACATTTGAACAAAGG + Intergenic
952647072 3:35673161-35673183 TTCAGAAGACACAGGAACAAAGG - Intronic
952762471 3:36926794-36926816 GACAGAATACAGAGGAACAAGGG + Intronic
953337585 3:42106853-42106875 TTCTGTTTAAAAATGAACAATGG - Intronic
953444541 3:42951590-42951612 TTATGTATACATATGAACAAGGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
959554690 3:107703142-107703164 TTCAGTTTACAAATTCACAAAGG - Intronic
962083933 3:132170825-132170847 TTCATTTAACAGATGAACTAAGG - Intronic
962658313 3:137572355-137572377 TGCAGTAAACAGATATACAATGG - Intergenic
963943632 3:151120557-151120579 TTCTGTATACAGATAAGGAAGGG + Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
967358758 3:188605543-188605565 TTCAGAATACAGATGAATTCTGG + Intronic
967616029 3:191567756-191567778 TTCATTTTAAAGATGAAGAAAGG - Intergenic
969964674 4:10982062-10982084 TTGAATAAATAGATGAACAAAGG - Intergenic
970272730 4:14364693-14364715 AACAGTATACAGAAGAAAAATGG - Intergenic
970341516 4:15112268-15112290 TTGATTTTACAGATGAAGAAAGG + Intergenic
970486396 4:16529124-16529146 TTAACTATACAGATGAGGAAAGG + Intronic
970779552 4:19719745-19719767 TTCAGGATACAAAAGAACATGGG + Intergenic
971292231 4:25354324-25354346 TTCAGTGTATTGATGAAGAAAGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971412576 4:26390578-26390600 TTCTGTATACTGATGAGCAATGG + Intronic
973184397 4:47307883-47307905 TTCATTAAATAGATGAAAAATGG - Intronic
974622711 4:64381931-64381953 TTCAGGATAAAGCTGGACAATGG + Intronic
976243439 4:82983769-82983791 TTCAGTTCACAGATGGCCAAAGG - Intronic
976276311 4:83282732-83282754 TTCATTTTACAGATGAAAAACGG + Intronic
976937342 4:90652853-90652875 TTGAGGATACAGAGAAACAATGG - Intronic
976981384 4:91235325-91235347 TCCTGTATACAGTTGAAGAAAGG - Intronic
978285391 4:107072210-107072232 TTCAGGATACAAAAGAAAAAAGG + Intronic
979797082 4:124859328-124859350 TTATGTATATAAATGAACAAAGG + Intergenic
980492382 4:133544661-133544683 TTAGGTATACAGATCAAGAAAGG + Intergenic
980681944 4:136174249-136174271 TTCATAAAACAGAGGAACAATGG - Intergenic
981160471 4:141492145-141492167 TTAAGTATACAGAAGAGGAACGG - Intergenic
982351908 4:154425154-154425176 TTCAGTACAGAGATTGACAATGG + Intronic
983260894 4:165455435-165455457 TTCAGTAAATAAATGCACAAAGG + Intronic
983858967 4:172680585-172680607 TTCAGTTTACAGATGACAAATGG - Intronic
984065320 4:175040940-175040962 TTCAAGATACAGATGACCATGGG - Intergenic
986098870 5:4586913-4586935 GTCAGCATGCAGGTGAACAAAGG - Intergenic
986645850 5:9915313-9915335 TTCAGTTTACAGAAGGAAAATGG + Intergenic
986994387 5:13590148-13590170 TTCAGTATACACATGTGCCAGGG + Intergenic
989230450 5:39080438-39080460 TTTATTATACATATTAACAATGG - Intergenic
989563776 5:42880502-42880524 TTCAGTAAACAGAGTAACAAAGG - Intronic
990203363 5:53402710-53402732 TTCAGTATATGGATGCACCAAGG - Intergenic
990536293 5:56726359-56726381 TTGAGTAGACAAATGTACAATGG - Intergenic
991022221 5:61991628-61991650 ATAAGGATACAGAGGAACAAAGG - Intergenic
991544632 5:67767804-67767826 TCCAGTATAGAGATGATAAATGG + Intergenic
991614605 5:68482956-68482978 TTCTGTGTACAGGTGATCAAGGG - Intergenic
992106989 5:73457586-73457608 ATCAGTAAACAAATGGACAAAGG + Intergenic
993249569 5:85501399-85501421 TACAGTCTGCAGATCAACAACGG + Intergenic
995439928 5:112180004-112180026 TTTAGTATATAGAAGAACAAAGG - Intronic
995963287 5:117872137-117872159 TTGCTTATACAAATGAACAATGG + Intergenic
996198663 5:120642124-120642146 TTCATCATCCAGATGAAAAATGG - Intronic
996398085 5:123033137-123033159 TTTATTTTACAGATGAAGAAAGG - Intronic
996594174 5:125182668-125182690 TCCAGTATTCAAATGAACAAAGG + Intergenic
997119611 5:131160674-131160696 TCCATTGTACAGATGGACAATGG + Intronic
998187137 5:139989263-139989285 TTTAGTATCCAGATGAAGGAGGG - Intronic
998195963 5:140071576-140071598 TTTAGTATCCAGATGAAGGAGGG + Intergenic
998767524 5:145504518-145504540 TTCAGTGGACAGATGACCACAGG + Intronic
999914852 5:156247158-156247180 TTCAGAATTCATATGAAAAAGGG - Intronic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1000700661 5:164445094-164445116 TTCAGGGCACAGATGAAAAAGGG - Intergenic
1001356641 5:171032561-171032583 TTCACTATACAGATATACAGGGG - Intronic
1006438140 6:34037167-34037189 TTCAGCAGAGAGCTGAACAAAGG + Intronic
1006687775 6:35851737-35851759 TTAAGTATAGAGATGAACTGAGG + Intronic
1007163497 6:39811647-39811669 TTCAGAATACAGCAAAACAAGGG - Intronic
1007932439 6:45704463-45704485 TTCTGTATTTAGATGGACAAAGG - Intergenic
1008237590 6:49069075-49069097 TTCAATGTACACATGAACAGGGG + Intergenic
1008328985 6:50222760-50222782 TCCAGGATACAGAGGAACATAGG - Intergenic
1008952954 6:57180893-57180915 TTGAGTATACAAATCAACAAGGG + Intronic
1009989530 6:70824771-70824793 TTCAGTTTACCGATGAGGAAAGG + Intronic
1010144113 6:72646114-72646136 TTCAGATTACAGATTAACAATGG - Intronic
1011793378 6:90924981-90925003 TTCAGGAAACATAAGAACAAAGG + Intergenic
1011861834 6:91767694-91767716 TTCTGTATACAGAAACACAAAGG + Intergenic
1015299976 6:131642093-131642115 TCCATTATAAAGATGAAGAAGGG - Intronic
1015686810 6:135872812-135872834 TTCAGTATACATGTGAACCTTGG + Intronic
1015875780 6:137820881-137820903 TTCAGAATAGAAATGGACAAAGG + Intergenic
1016263136 6:142198350-142198372 TTCATTATACACATGACAAATGG - Intronic
1016710542 6:147166348-147166370 CTCAGTATACAAATACACAATGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017393460 6:153968049-153968071 TTCTGTAAACAGATGAAAAGTGG - Intergenic
1021897849 7:25254129-25254151 TTCATAATAAAGATGAAAAAGGG - Intergenic
1023430882 7:40089959-40089981 TTAAGTATGCAGTTGAACCAAGG - Intronic
1023576990 7:41638890-41638912 CTCAGTATAAAAATGAACAATGG + Intergenic
1026182840 7:68057164-68057186 TTCATTTTACAAATGAAGAAGGG - Intergenic
1027484507 7:78743796-78743818 TTCAGTATGGAGATTAAAAATGG - Intronic
1029027994 7:97438291-97438313 TTCAGTATACATAAGAGTAAAGG + Intergenic
1030013458 7:105194881-105194903 TTCTGTCTACTGATGGACAAAGG + Intronic
1030742452 7:113126257-113126279 TACAGTGAACAGATGAAAAATGG + Intergenic
1030891445 7:115003903-115003925 CTCATTTTACAGATGAAAAACGG - Intronic
1030994845 7:116347739-116347761 TTCAGTGTACACCTGAACATGGG - Intronic
1032570379 7:132989901-132989923 TTCAATATACGGGTGAATAATGG + Intronic
1034108708 7:148515174-148515196 TGCAGTATGCAGATGAAACAAGG + Intergenic
1034344959 7:150380178-150380200 TTCATTTTACAGATGAACATGGG - Intronic
1035700694 8:1637524-1637546 TTCAGTAAACAAATGACCAGAGG + Intronic
1036445060 8:8814239-8814261 TACAGTATAAAGATAAAAAATGG - Intronic
1037024749 8:14021196-14021218 TTAAGTAAATGGATGAACAAAGG - Intergenic
1037052951 8:14399630-14399652 TTCATTATACAGTTGAATAAAGG - Intronic
1037059375 8:14487547-14487569 ATCACTAAACAGAAGAACAATGG - Intronic
1040559650 8:48513285-48513307 TTCAGTATACATGTGTTCAAGGG + Intergenic
1040652239 8:49462269-49462291 CTCATTTTACAGATGAAAAATGG + Intergenic
1040917606 8:52579523-52579545 TGGAGTTTACAGATAAACAAGGG + Intergenic
1041480944 8:58318882-58318904 TTCAATAAATAAATGAACAAAGG + Intergenic
1041520048 8:58745975-58745997 TTCAGGAGACACCTGAACAAAGG + Intergenic
1041648638 8:60279996-60280018 ATCACTATACAGATGAAATATGG + Intronic
1041872922 8:62655498-62655520 GTCACTATAGGGATGAACAAAGG + Intronic
1045741091 8:105360375-105360397 TTGAGGAAACAGATGAAAAATGG + Intronic
1047024978 8:120814446-120814468 TTCAGTGTGCAGATGAACACAGG - Intergenic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1047546660 8:125824616-125824638 TTCAGTATTCACTTGAATAATGG + Intergenic
1047608710 8:126499853-126499875 TGCATTATAAAGATGAACATAGG - Intergenic
1048239646 8:132728590-132728612 TTCAGTGCAGAGATAAACAAAGG + Intronic
1050140109 9:2508799-2508821 TTAAGTAAATAGATGGACAATGG - Intergenic
1050836596 9:10088481-10088503 TCAAGTATAAAGATGAAGAAAGG + Intronic
1052444660 9:28545064-28545086 TGCACTTTACAGATGAGCAAGGG + Intronic
1054877422 9:70111452-70111474 CTCATTTTACAGATGAGCAATGG - Intronic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1057543141 9:95994637-95994659 TGGAGTATACAGATGAGCAGGGG + Intronic
1058310772 9:103499355-103499377 TCCAATATACAGAAGAAAAATGG - Intergenic
1059085236 9:111294311-111294333 TATATTATACAGATGAACAGTGG - Intergenic
1060517120 9:124272780-124272802 TTCATTTTACAGATGAGGAAAGG + Intronic
1060958224 9:127659823-127659845 TTCAGAGTTTAGATGAACAAAGG - Intronic
1061597835 9:131643789-131643811 TACAGGATACAGATGTACCATGG - Intronic
1186013238 X:5161614-5161636 TTCTGAACACAGATGAACATAGG - Intergenic
1186753894 X:12649811-12649833 TTCAATACAGAGAGGAACAAGGG - Intronic
1187279308 X:17845677-17845699 TTCAGTAGAGTGATGAATAATGG + Intronic
1187420913 X:19132988-19133010 TTGAGTGTACAGATGGGCAAAGG - Intergenic
1187722899 X:22170447-22170469 TTCATTCTTCAGATGAAGAAAGG - Intronic
1188077075 X:25791131-25791153 TTCATTATACAGATTGAAAAAGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188791292 X:34411270-34411292 TCCAGTATAAAAATGGACAAAGG + Intergenic
1190516059 X:51224598-51224620 TTTTGTCTACAGATGAATAAAGG + Intergenic
1191955763 X:66640908-66640930 TTCAGGATACAGATGCAGAAAGG - Intergenic
1192339879 X:70255174-70255196 ATCAATAGTCAGATGAACAAAGG + Intergenic
1193535951 X:82715542-82715564 TACAGTGGACAGATAAACAAGGG + Intergenic
1194068425 X:89289986-89290008 TTGGGTATACTGATGAACTATGG - Intergenic
1194871657 X:99140280-99140302 TTCATTTTACAGATGTAAAATGG - Intergenic
1197268961 X:124405265-124405287 TTCTGTAGACAGAAGAGCAAAGG + Exonic
1199362184 X:146934464-146934486 TTCAGCACACAAATAAACAAAGG - Intergenic
1200722568 Y:6624151-6624173 TTGGGTATACTGATGAACTATGG - Intergenic
1202365405 Y:24158910-24158932 TTCTGTATATAAATGAGCAATGG + Intergenic
1202505376 Y:25511212-25511234 TTCTGTATATAAATGAGCAATGG - Intergenic