ID: 1087287884

View in Genome Browser
Species Human (GRCh38)
Location 11:96285680-96285702
Sequence CCCCTGAATGTCTTCATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087287884 Original CRISPR CCCCTGAATGTCTTCATCTG AGG (reversed) Intronic
901320172 1:8335257-8335279 GCCCTGAATTTGTTCCTCTGAGG + Intronic
902170664 1:14607987-14608009 AGCTTCAATGTCTTCATCTGTGG - Intronic
904337562 1:29808112-29808134 ACCCAGAATCTCTACATCTGAGG + Intergenic
908444542 1:64188711-64188733 CCCCAGAATGTATTCAGATGTGG - Intergenic
909227241 1:73041526-73041548 CCCCACATTGTCTTCCTCTGAGG + Intergenic
910184242 1:84519063-84519085 CCCCTTAAATTTTTCATCTGTGG - Intergenic
913996554 1:143655501-143655523 CCACTGAAGGTCTTCTTCTCTGG + Intergenic
914505698 1:148287310-148287332 CCACTGAAGGTCTTCTTCTCTGG - Intergenic
915547273 1:156607561-156607583 CTCCTGAAGGTCTTCCCCTGGGG - Intergenic
917586850 1:176435735-176435757 CCACTGAATGTCTTGTTATGTGG - Intergenic
920010033 1:202860849-202860871 CCCCTGAATGTCTTTGTCTTGGG - Intergenic
921368000 1:214392994-214393016 CCGCTGAATGTATTCAGCTGAGG + Intronic
922532744 1:226356907-226356929 CCCCTGCCTGCCTTCATCTCTGG + Intergenic
1063197050 10:3753231-3753253 CCCTGGAATGTCTCCATCAGTGG + Intergenic
1063843014 10:10092804-10092826 CCTCTGCATGTTTGCATCTGAGG - Intergenic
1065067746 10:21988733-21988755 CCCCAGAAAGTCTTCTTCAGAGG + Intronic
1067794238 10:49309140-49309162 CACCTGAAGGACTTCAACTGAGG + Intronic
1068437953 10:57016026-57016048 CCCCAGAATGTCTTCAGGTACGG - Intergenic
1069089828 10:64186634-64186656 TCCCTAAACTTCTTCATCTGGGG + Intergenic
1070815158 10:79318278-79318300 CCACTGACTGTCTTCATGTAAGG + Intergenic
1072043121 10:91628188-91628210 ACCCTGACTGTCCTCATCTATGG - Intergenic
1072724477 10:97803499-97803521 CTCCTGCCTGCCTTCATCTGAGG - Intergenic
1075486197 10:122823568-122823590 CCCATGAATGATTTCAACTGTGG - Intergenic
1077696230 11:4395308-4395330 CACTTGTATGTCTTCTTCTGAGG + Intergenic
1078674957 11:13401995-13402017 CCCTTGAATGTCTTCTTCTCAGG + Intronic
1080273432 11:30475241-30475263 CGGCTGAATGTCATCTTCTGGGG - Intronic
1080371397 11:31649359-31649381 ACCTTCCATGTCTTCATCTGTGG + Intronic
1080522016 11:33075849-33075871 TCCCTGCATGTCTTCATCATGGG - Intronic
1083112787 11:60428501-60428523 CCCCCTAATGTCTTCATGGGAGG - Intergenic
1083445720 11:62706923-62706945 CCTCTGAAGGACTTTATCTGGGG - Intronic
1085058213 11:73420646-73420668 CCCCTGAATATCTCCTACTGAGG + Intronic
1087287884 11:96285680-96285702 CCCCTGAATGTCTTCATCTGAGG - Intronic
1089299631 11:117490807-117490829 CCCCAGAATCTCTCCATGTGAGG - Intronic
1090071436 11:123547787-123547809 CCCCTTACTGACATCATCTGTGG + Intronic
1094011836 12:25817836-25817858 CCCTTGTATGCCTTCATTTGGGG - Intergenic
1094064371 12:26347723-26347745 CCCCTTGATTTCTTCTTCTGGGG + Intronic
1096438759 12:51620021-51620043 ACACTGAATGTCTTGATCTAGGG - Intronic
1101262110 12:103043978-103044000 CCCCTGAATGCTTTCCCCTGAGG - Intergenic
1101265701 12:103084334-103084356 CCACTGCATGTTTTCAGCTGGGG + Intergenic
1101780910 12:107834397-107834419 CACCTTAGTTTCTTCATCTGAGG + Intergenic
1103848637 12:123916793-123916815 CCCATGAATGCCTTGATCTGAGG - Intronic
1104334563 12:127881164-127881186 CACCCCCATGTCTTCATCTGGGG - Intergenic
1104597459 12:130129655-130129677 CCCCTGAAAGTTTTCATATGTGG + Intergenic
1104673707 12:130698166-130698188 CCCTTGAAAGTCTTTATCTCTGG - Intronic
1104930239 12:132335143-132335165 CCCCTGCATCTCTTCATCTTCGG - Intergenic
1108991415 13:56662467-56662489 CACATGAATGTCTTCTTTTGAGG - Intergenic
1109973043 13:69795375-69795397 CCTGTGAATGTCTAAATCTGTGG + Intronic
1110900752 13:80821170-80821192 CCCCTGTATGTCTTCCTTGGTGG - Intergenic
1111762129 13:92479720-92479742 CCCCTGCCTGGCATCATCTGAGG - Intronic
1112000983 13:95209755-95209777 CCCCAGAATGGCTTCACCTGTGG - Intronic
1113911285 13:113842615-113842637 CCCCAGAGCCTCTTCATCTGAGG - Intronic
1114046305 14:18879636-18879658 AACCAGAATTTCTTCATCTGAGG + Intergenic
1114117906 14:19639814-19639836 AACCAGAATTTCTTCATCTGAGG - Intergenic
1115052741 14:29084396-29084418 CCCCTTTATCTCTTCTTCTGTGG - Intergenic
1116037924 14:39650743-39650765 CCCCTCAATGGCATCATATGTGG - Intergenic
1118456576 14:65950273-65950295 CCCCTGAAAGTCTTGAGCAGGGG + Intergenic
1119656947 14:76423982-76424004 CCCCTGGCTGTCTTCAGCAGAGG + Intronic
1120900088 14:89568133-89568155 CTCCTAAATGTCAGCATCTGAGG + Intronic
1122806619 14:104263137-104263159 CCCCTCACTGTCTACATGTGGGG - Intergenic
1124388145 15:29226836-29226858 CCACTGACTGTCTTAACCTGTGG + Intronic
1124556953 15:30735177-30735199 CACCTAAATGTCTTCTTTTGAGG - Intronic
1126424907 15:48516742-48516764 CCACTGGATGTCTTCAACGGGGG + Intronic
1128719872 15:69940476-69940498 CCCCAGAGGGGCTTCATCTGTGG - Intergenic
1129896769 15:79114233-79114255 CCCTTGAACCTCTTCATCTTGGG - Intergenic
1131572235 15:93550962-93550984 CACGTAACTGTCTTCATCTGGGG - Intergenic
1137407273 16:48199491-48199513 CCCTTGAATATTTTCATCTATGG - Intronic
1138589506 16:57992084-57992106 AGCCTCAATGTCCTCATCTGTGG - Intergenic
1139365719 16:66432332-66432354 CCCAGGAAGGTCTTCATGTGAGG - Intronic
1140720417 16:77766476-77766498 CCCCTGAAATTTTGCATCTGAGG - Intergenic
1142046206 16:87926834-87926856 ACCCTGAGTGGCTTCAGCTGGGG + Exonic
1147442256 17:40454344-40454366 CCCCTGGATTTCACCATCTGTGG + Intronic
1150370264 17:64631402-64631424 CCCCTGCATTTCTTCATTTTAGG - Intronic
1151055411 17:71025433-71025455 CCACTGAATGGATTCATTTGAGG + Intergenic
1152669008 17:81590289-81590311 CTCCAGAATGACTTCATGTGGGG + Intronic
1153700502 18:7688553-7688575 CTCCTGAAGGCCATCATCTGGGG - Intronic
1156655266 18:39277733-39277755 CCCCTAAAGATCTTCTTCTGTGG - Intergenic
1158111288 18:53943591-53943613 CCCCAGAATGTATTCATGTATGG + Intergenic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1165672172 19:37688723-37688745 TCCCTGAATGTTTGCATCTCAGG - Intronic
1166835299 19:45664079-45664101 CCCCTCACTGCCTTCCTCTGTGG + Intergenic
1167773703 19:51541197-51541219 CCCCTGTCTCTCCTCATCTGTGG + Intergenic
925325015 2:3012098-3012120 CCCCTGCATGTCCACATCTCTGG + Intergenic
925833632 2:7920623-7920645 CAGCTGAAAGTCTCCATCTGGGG + Intergenic
926250204 2:11151377-11151399 CCCCTGACTCTCTTCAACAGAGG - Intergenic
927018201 2:18990285-18990307 CCCCAGAATGTCTTCATATGAGG - Intergenic
927653262 2:24924943-24924965 CCCCTCCATGGCTGCATCTGGGG + Intergenic
929248107 2:39724361-39724383 TCCCTGACTGTCTTGATGTGTGG + Intergenic
929686387 2:44038813-44038835 ACCCAGCATGTCTTCATCTGGGG - Intergenic
931535416 2:63270969-63270991 CCCCTGAATGTCCACATCACTGG + Intronic
932401090 2:71481664-71481686 CCTCTGAATTTCTGGATCTGTGG + Intronic
932888708 2:75571376-75571398 CCTCTGTATGCCTTCATTTGAGG - Intergenic
934778227 2:96952295-96952317 TCCCAGAATGTCTTCATCCCGGG - Intronic
937224557 2:120360780-120360802 CACCTGAGTTTCTTCATCTGTGG - Intergenic
937314265 2:120921114-120921136 CCTCTGAATGTTTCCATCGGGGG + Intronic
938109597 2:128554960-128554982 CAACTGAGTGTCTTCATTTGGGG + Intergenic
940712009 2:157173823-157173845 CTGCGGAATGTCTTCCTCTGTGG - Intergenic
942249309 2:174034100-174034122 CCCCTGGATGTCTCCATTTGGGG - Intergenic
942654949 2:178205390-178205412 CTCCTCACTGTCATCATCTGGGG - Intronic
943525647 2:189013937-189013959 CACCTGAAGGTCTCAATCTGGGG + Intergenic
945907633 2:215613229-215613251 CCCCTGCATGTCCTCATCACTGG - Intergenic
947621740 2:231595176-231595198 CACCTGCATGCCTTCATGTGCGG + Intergenic
947904856 2:233753600-233753622 CCCCAAAAGGTCTTCATTTGGGG + Intronic
1170517740 20:17149245-17149267 CCTCTCAATGTCTGCTTCTGGGG - Intergenic
1172332525 20:34085330-34085352 TCCCTGGATGACTTCATCCGTGG + Intronic
1172998770 20:39090751-39090773 CTCCTGGATGGCTTCTTCTGGGG + Intergenic
1174543505 20:51307728-51307750 CCCCAAAATTTCTTCATGTGGGG + Intergenic
1175857687 20:62131419-62131441 CCCCAGAAGGTCTTCCTCAGCGG - Exonic
1178246112 21:30954307-30954329 CCATTGAATGTCTTTAGCTGAGG + Intergenic
1178475666 21:32935079-32935101 CCACTGAAGTTCTTCAACTGAGG - Intergenic
1179246231 21:39636540-39636562 CCTGTGAATGCCATCATCTGGGG - Intronic
1180464841 22:15602272-15602294 AACCAGAATTTCTTCATCTGAGG + Intergenic
1181975446 22:26726052-26726074 CAACTCAGTGTCTTCATCTGAGG - Intergenic
1182042393 22:27248631-27248653 CCCTTGAGTGTCTTTATCTGGGG - Intergenic
1184642243 22:45878911-45878933 CCCCAGAAAGTTCTCATCTGTGG + Intergenic
952168929 3:30783751-30783773 CCCCTGGATTTTTTCATCTGTGG - Intronic
953665299 3:44921848-44921870 GCCCTGAATTTCTGCAGCTGAGG - Intronic
955105389 3:55892927-55892949 CCCCTTAATGCCATCATCTTGGG - Intronic
955336757 3:58093203-58093225 CCCGTGCACCTCTTCATCTGGGG - Intronic
957772768 3:84715812-84715834 CACTTGAATGTCTTCTTTTGAGG - Intergenic
959540669 3:107534200-107534222 CCTCTGAATTACTTAATCTGTGG - Intronic
960697276 3:120408442-120408464 ACCCAGTATTTCTTCATCTGCGG + Intronic
961104189 3:124227352-124227374 CCCCTCAATGTCATCATCATTGG - Intronic
962092945 3:132264106-132264128 TGCGTGAATGTCTTCATCTTTGG - Intronic
964480807 3:157136689-157136711 AGCCTGAGTTTCTTCATCTGTGG - Intergenic
964768738 3:160202912-160202934 CCCCTGAATGGCTTGAACTTAGG - Intergenic
965867158 3:173217819-173217841 CCACTGAATGTCTTCCCCAGAGG - Intergenic
966281361 3:178233771-178233793 TCCATGAATGCTTTCATCTGAGG - Intergenic
968963742 4:3759007-3759029 CCCCAGCCTGTCTCCATCTGTGG - Intergenic
970103243 4:12549513-12549535 TCTCTGAATTTCTTCATGTGAGG - Intergenic
975740062 4:77421012-77421034 ACCCTGCATGTCTTCACCTGAGG - Intronic
977290992 4:95164023-95164045 CACCTCATTGTATTCATCTGTGG - Exonic
978730112 4:112015991-112016013 CCGCTAAATGTCTTCAGCTGAGG - Intergenic
980171821 4:129298492-129298514 CCCCTGACTTTCTTGATCTAAGG - Intergenic
980370727 4:131866443-131866465 CGCATAAATGTCTTCTTCTGAGG + Intergenic
982017740 4:151172275-151172297 CCTCTGAATGCCTTGACCTGTGG - Intronic
983256290 4:165404332-165404354 GAACTGGATGTCTTCATCTGAGG + Intronic
984132495 4:175895950-175895972 ATCCTGAATCTCTCCATCTGTGG + Intronic
984192438 4:176621785-176621807 CCCCAGAATGTTCTCAGCTGAGG + Intergenic
987642836 5:20633871-20633893 CCACTGAATCTCACCATCTGGGG + Intergenic
988821343 5:34889400-34889422 ACCCTGAATGTGTTCACCAGCGG + Intronic
988976042 5:36516661-36516683 CCCCCGAGTGTCTTAATATGTGG - Intergenic
991113903 5:62931289-62931311 TCTCTGAATTTCTTCCTCTGGGG - Intergenic
997659845 5:135580927-135580949 TCCCTTAATGGTTTCATCTGAGG + Intergenic
998063368 5:139136677-139136699 TGCCTCTATGTCTTCATCTGTGG - Intronic
999112750 5:149136463-149136485 CCCGTGAATTTGTTCATCTTGGG - Intergenic
999705419 5:154268473-154268495 CCCTTGAATGTTGTCATTTGGGG - Intronic
1001822371 5:174720433-174720455 CGCCTGGACGACTTCATCTGTGG + Intergenic
1004900796 6:20192057-20192079 CACTTGAGTGGCTTCATCTGTGG - Intronic
1005410420 6:25539447-25539469 TGTCTTAATGTCTTCATCTGGGG - Intronic
1007637170 6:43306490-43306512 CCAGTGAATGTCTTCATATGGGG + Exonic
1008217203 6:48807239-48807261 TCCCTCAATTTCTCCATCTGAGG + Intergenic
1013725526 6:113091090-113091112 CACCTAAATCTCTTTATCTGAGG + Intergenic
1016828068 6:148406263-148406285 CCTCTGAAGGACTTCATTTGGGG + Intronic
1016897700 6:149069628-149069650 TCCCTGAATGCCTTCCTCTATGG - Intronic
1018913955 6:168121413-168121435 ACCATGGGTGTCTTCATCTGTGG + Intergenic
1019777154 7:2918608-2918630 CCCCTGAATTTCAGCCTCTGAGG - Intronic
1022269494 7:28792630-28792652 CCCCTGCATGTCTACATTCGAGG - Intronic
1022601218 7:31762039-31762061 TTCCTAAATGTCTTCATCTGAGG - Intronic
1022792301 7:33701290-33701312 CTCCTGGATGGATTCATCTGGGG - Intergenic
1026402715 7:70031594-70031616 CCCCTGAACGTGCTCATTTGAGG + Intronic
1026463647 7:70635474-70635496 GCCTTGAAGGGCTTCATCTGAGG + Intronic
1027052846 7:75030679-75030701 CCCTTGAATCTCTTGCTCTGGGG - Intronic
1027053093 7:75031974-75031996 CCCTTGAATCTCTTGCTCTGGGG - Intronic
1028301966 7:89211127-89211149 CACATGAATGTCTTCTTTTGAGG + Intronic
1029480617 7:100810355-100810377 CGCCTGAATGTCTTGATTTCTGG - Intronic
1030085343 7:105811028-105811050 CCCGTAACTTTCTTCATCTGTGG - Intronic
1033957370 7:146867807-146867829 TGCATGAATGTCTTCATTTGAGG + Intronic
1034038389 7:147849449-147849471 CTCCAGACTGTCCTCATCTGAGG + Intronic
1036342845 8:7931947-7931969 CCCCTGAATCTCCACATCTCTGG - Intronic
1039433693 8:37545392-37545414 CCCCTGAAAGTCTCCCTCTCAGG + Intergenic
1039500090 8:38009787-38009809 CCCCTGAATTCCTTCTTCTGAGG + Intergenic
1040410038 8:47144750-47144772 TTTCTGCATGTCTTCATCTGTGG - Intergenic
1043105561 8:76105646-76105668 TCCCTGATTTTCTTCATTTGTGG + Intergenic
1048276987 8:133074006-133074028 CCTCAGAATGTCCTCATTTGGGG - Intronic
1053288627 9:36865609-36865631 CTCCTGATTATCTTCATTTGCGG - Intronic
1056512188 9:87316620-87316642 ACCCTCAATTTCTTCATATGTGG + Intergenic
1062722578 9:138052055-138052077 CTCCTGCCTGTCTGCATCTGTGG + Intronic
1186204089 X:7183052-7183074 CACCTGAATCTCTGCCTCTGTGG - Intergenic
1187098279 X:16168679-16168701 ACCCTGAATGTCCAAATCTGAGG + Intronic
1187674637 X:21703565-21703587 CTGCTGAATGTATGCATCTGTGG - Intergenic
1189217563 X:39339661-39339683 CTCCTGAATCTCAGCATCTGAGG + Intergenic
1189356391 X:40313017-40313039 TCCCTGCATTTCTTCATCTGGGG - Intergenic
1189666830 X:43364704-43364726 CCCCTGAACGTCTCCTTTTGAGG - Intergenic
1190729527 X:53216168-53216190 CTTCTCAATGTCTTCCTCTGTGG + Exonic
1195869947 X:109475340-109475362 CACCCAAATGTCTTCATCTGAGG + Exonic
1196722531 X:118868429-118868451 CCCCTGTATGTTTTCATTTCAGG + Intergenic
1196882034 X:120207320-120207342 CCCCAGAATGTCTTCAGGTATGG - Intergenic
1199185246 X:144908983-144909005 ACCCTGAGTGTGTTCTTCTGTGG - Intergenic
1200935800 Y:8737237-8737259 TCACTGACTGTCTTCATCTCAGG + Intergenic
1200964468 Y:9023690-9023712 ACCCTGAAAGTCTTGATCTTAGG + Intergenic
1201292578 Y:12435746-12435768 TACATGAATGTCTTCATCTTTGG + Intergenic
1201667888 Y:16479539-16479561 ACCCTGAATTCCTTCATGTGTGG + Intergenic
1202148634 Y:21825122-21825144 ACCCTGAAAGTCTTGATCTTAGG - Intergenic