ID: 1087287950

View in Genome Browser
Species Human (GRCh38)
Location 11:96286369-96286391
Sequence TGCCAGGTTTAATACCTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 2, 2: 3, 3: 43, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087287943_1087287950 29 Left 1087287943 11:96286317-96286339 CCTGTCGGAGGGAGCAGGGGGAG 0: 1
1: 0
2: 1
3: 44
4: 361
Right 1087287950 11:96286369-96286391 TGCCAGGTTTAATACCTAGGTGG 0: 1
1: 2
2: 3
3: 43
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087287950 Original CRISPR TGCCAGGTTTAATACCTAGG TGG Intronic
901294359 1:8148926-8148948 TGCGGGGCTTAATACCTAGGTGG + Intergenic
904300591 1:29550980-29551002 GGCCAGGTTTCAGACCGAGGGGG - Intergenic
904457615 1:30657064-30657086 GGCCAGGTTTCAGACCGAGGGGG + Intergenic
904873376 1:33635578-33635600 TGCCAGGGTTAATAGGTAGAGGG - Intronic
905889925 1:41512727-41512749 TTCCAGGTGTGATACCCAGGAGG + Intronic
905963471 1:42066167-42066189 TGCTGGGCTTAATACCTAGGTGG + Intergenic
906208554 1:43999766-43999788 TGTCATGTTTAATGCCTCGGTGG - Intronic
908623493 1:66013018-66013040 AGCCAGAATTAAAACCTAGGTGG + Intronic
908707122 1:66969910-66969932 TGCCAGCTTTACTAACAAGGAGG - Intronic
908777754 1:67657565-67657587 TGCTGGGCTTAATACTTAGGTGG + Intergenic
911139648 1:94485446-94485468 TGCCATGTTAAATACCGACGAGG - Intronic
912013292 1:104999450-104999472 TGCCTGGTTTAATTCCGACGAGG + Intergenic
914331663 1:146677224-146677246 TGCTGGGTTTAATACTTAGATGG - Intergenic
914693761 1:150055933-150055955 TACTAGGTTTAGTACCCAGGTGG + Intergenic
920562335 1:206947699-206947721 TGTGGGGCTTAATACCTAGGTGG - Intergenic
922034797 1:221837987-221838009 AGCCAGGATTAAAACCAAGGCGG + Intergenic
922377908 1:224987998-224988020 TGCTGGGCTTAATACCTAGGTGG - Intronic
923868630 1:237966542-237966564 TACTAGGCTTAATACCTGGGTGG + Intergenic
1063089291 10:2847973-2847995 AGCTGGGCTTAATACCTAGGTGG - Intergenic
1063731166 10:8698830-8698852 TGCTGGGCTTAATACCTAGGTGG - Intergenic
1067288116 10:44922140-44922162 TGCCAGGTTTCAGATTTAGGCGG - Intronic
1069341185 10:67410402-67410424 TGCTGGGCTTAATACCTGGGTGG + Intronic
1069879476 10:71582873-71582895 CGGCAGCTTTAATACCTCGGTGG + Intronic
1073959831 10:108912810-108912832 AGCCAGGTTTTCTACCTATGTGG + Intergenic
1076610089 10:131720075-131720097 TGCTGGGCTTAATACCTGGGTGG - Intergenic
1078278263 11:9872344-9872366 TGCTGGGCTTAATACCTAGGTGG + Intronic
1078802319 11:14659599-14659621 TACTAGGCTTAATACCTGGGTGG - Intronic
1080337014 11:31209285-31209307 TGCCAGGTATGTTACCTCGGAGG - Intronic
1080360521 11:31508054-31508076 TGCTGGGCTTAATACCGAGGTGG + Intronic
1080919871 11:36698340-36698362 TGCGATGCTTAAAACCTAGGTGG - Intergenic
1081009156 11:37786133-37786155 TGCTGGGCTTAATACCTAGGGGG + Intergenic
1082982955 11:59141058-59141080 TACTAGGCTTAATACCTTGGTGG - Intergenic
1087287950 11:96286369-96286391 TGCCAGGTTTAATACCTAGGTGG + Intronic
1087417760 11:97879823-97879845 TACTAGGCTTAATACCTGGGTGG - Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1088166523 11:106944541-106944563 TACCAGGTTTAATATCTGAGTGG + Intronic
1095370479 12:41461307-41461329 TACTAGGCTTAATACCTGGGTGG - Intronic
1098024295 12:66186545-66186567 TGCTGGGCTTAATACCTAGGTGG - Intergenic
1098034126 12:66284622-66284644 TGTCAGGTTTAATATCTATCAGG - Intergenic
1098794042 12:74865712-74865734 TACTAGGCTGAATACCTAGGTGG + Intergenic
1098979271 12:76937527-76937549 TGCTGGGCTTAAAACCTAGGTGG - Intergenic
1099348212 12:81529869-81529891 TACTAGGCTTAATACCTTGGTGG + Intronic
1100738191 12:97561660-97561682 TGCCTGGTTTAACTCCTTGGTGG + Intergenic
1101045755 12:100804053-100804075 TGCTGGGCTTAATACCCAGGTGG - Intronic
1102771431 12:115480600-115480622 TACTAGGCTTAATACCTGGGTGG - Intergenic
1103515824 12:121507626-121507648 AGCCAAGTTTCATCCCTAGGAGG + Intronic
1107244976 13:38282599-38282621 TACTAGGCTTAATACCTGGGTGG + Intergenic
1108921812 13:55684633-55684655 TGCCAGGTTTATTTCAGAGGTGG - Intergenic
1109692520 13:65911317-65911339 TGCTGGGCTTAAAACCTAGGTGG + Intergenic
1110894407 13:80731360-80731382 TACTAGGCTTAATACCTAGATGG - Intergenic
1111358471 13:87142227-87142249 TGCGGGGCTTAAAACCTAGGTGG + Intergenic
1114372512 14:22105758-22105780 TGCCACTCTTAATACCAAGGAGG + Intergenic
1114759166 14:25292517-25292539 TACCAGGCTTAATACCTGGGTGG + Intergenic
1115870972 14:37802283-37802305 TGCTGGGCTTAATACTTAGGTGG + Intronic
1116101162 14:40438418-40438440 TACTAGGCTTAATACCTGGGTGG + Intergenic
1116358282 14:43959066-43959088 TGCTAGGCTTAATACCTGGCTGG + Intergenic
1120093058 14:80356151-80356173 TGCTGGACTTAATACCTAGGTGG + Intronic
1120283634 14:82469885-82469907 TGCTAGGCTTAGTACCTAGGTGG + Intergenic
1120840631 14:89082133-89082155 TACCAGGCTTAGTACCTGGGTGG - Intergenic
1122710866 14:103656784-103656806 TTTCAGGTTTTAAACCTAGGAGG + Intronic
1123993885 15:25704691-25704713 TGCCATGTTTCATGCCGAGGTGG - Intronic
1125077149 15:35632854-35632876 AGCCAGCTTTAATACCTAATGGG + Intergenic
1126981295 15:54246800-54246822 TGCTGGGCTTAATACCTGGGTGG + Intronic
1127440128 15:58998341-58998363 TACTAGGCTTAATACCTGGGTGG - Intronic
1128347971 15:66866552-66866574 TGCCAGGTTGCATTCCCAGGAGG + Intergenic
1129652377 15:77500269-77500291 TGCAAGGTGTAATAGCTATGTGG - Intergenic
1130515063 15:84620044-84620066 TGCTGGGCTTAATACCTAGGTGG - Intronic
1131896160 15:97032047-97032069 TACTAGGCTTAATACCTGGGTGG + Intergenic
1135346154 16:21690287-21690309 TGCTGGGCTTGATACCTAGGTGG - Intronic
1135952236 16:26925614-26925636 TACTAGGCTTAATACCTGGGTGG + Intergenic
1139070637 16:63377402-63377424 TGCCATGTTTCATACGTAAGTGG + Intergenic
1140001890 16:71033676-71033698 TGCTGGGTTTAATACTTAGATGG + Intronic
1140286402 16:73606674-73606696 TGCTGGGCGTAATACCTAGGTGG - Intergenic
1140494010 16:75367320-75367342 TGCTGGGTTTAATACCTAGGTGG + Intronic
1143730218 17:8878093-8878115 TTCCAGGTTCCATTCCTAGGAGG + Intergenic
1145919538 17:28599927-28599949 TGCAAGTCTTAATACATAGGGGG + Intronic
1146505655 17:33402386-33402408 TGCTGGGCTTAATACCTAGGTGG - Intronic
1149148398 17:53528829-53528851 TACCAGGTTTAATACCTGGGTGG - Intergenic
1150453025 17:65284989-65285011 TACTAGGCTTAATACCTGGGTGG - Intergenic
1150506612 17:65704958-65704980 TCCAAGCTTTAATAACTAGGAGG - Intronic
1150928139 17:69555727-69555749 TGCTGGGCTTAATATCTAGGTGG - Intergenic
1151437407 17:74106418-74106440 TGCTGGGCTTAATATCTAGGTGG + Intergenic
1152909276 17:82989386-82989408 TGCAGGGCTTAATACCTAGGTGG + Intronic
1153136235 18:1920607-1920629 TGCCAAATTTCCTACCTAGGGGG - Intergenic
1164846207 19:31434714-31434736 TGCAGGGCTTAATACCTAGGTGG + Intergenic
1166008712 19:39925596-39925618 AGCCAGGATTCCTACCTAGGCGG - Intronic
930222461 2:48759058-48759080 TGCGGGGTTTAAAACCTAGATGG - Intronic
930883121 2:56294332-56294354 CGCTGGGCTTAATACCTAGGTGG + Intronic
931507118 2:62941205-62941227 TTCCAGGTTAAATGCCTAGAGGG + Intronic
932149664 2:69358349-69358371 TACCAGCTTTACTACCTTGGTGG - Exonic
932984470 2:76708725-76708747 TACTAGGCTTAATACCTGGGTGG - Intergenic
933472647 2:82746594-82746616 TACTAGGCTTAATACCTGGGTGG - Intergenic
935835973 2:107053709-107053731 TGCGAGGCTTAAAACCTAGATGG + Intergenic
936780613 2:116028590-116028612 TTCCCAGTTTATTACCTAGGGGG + Intergenic
937537661 2:122911216-122911238 TGCCATATTTTTTACCTAGGTGG - Intergenic
938311719 2:130294299-130294321 CCCCAGGTCTAAGACCTAGGAGG + Intergenic
938720094 2:134059862-134059884 TGCTGGGCTTAATACCTAGGTGG - Intergenic
939107104 2:137962056-137962078 TACTAGGCTTAATACCTGGGTGG + Intergenic
939108301 2:137975715-137975737 TGTCAGGTTTAGAAACTAGGAGG + Intronic
940579499 2:155559640-155559662 TTCTAGGCTTAATACCTAGGTGG + Intergenic
941537000 2:166736441-166736463 TGCTGGGCTTAGTACCTAGGTGG - Intergenic
941981901 2:171467570-171467592 TTCCAGGTGTAATACTTAGGAGG + Intronic
942373785 2:175314673-175314695 TACTAGGCTTAATACCTGGGTGG - Intergenic
942601182 2:177642790-177642812 TGTCACGTCTAAAACCTAGGCGG - Intronic
947255713 2:228161590-228161612 TGCTGGGCTTAATACCTAGGTGG + Intronic
948251887 2:236536086-236536108 TGCTAGGCCTAATACCTGGGAGG - Intergenic
1171786046 20:29465576-29465598 TGTGGGGCTTAATACCTAGGCGG - Intergenic
1173082974 20:39887334-39887356 TGCTGGGCTTAATAACTAGGTGG - Intergenic
1174924131 20:54738373-54738395 TACTAGGCTTAATACCTGGGTGG + Intergenic
1175004792 20:55670573-55670595 TACTAGGCTTAATACCTGGGTGG - Intergenic
1175321828 20:58093578-58093600 TGCGGGGCTTAATACCTAGGTGG - Intergenic
1177154760 21:17490509-17490531 TCCTGGGCTTAATACCTAGGTGG - Intergenic
1177584593 21:23073969-23073991 TGCTGGGCTTAATACCTAGATGG + Intergenic
1177868580 21:26543232-26543254 CGCCGGGCTTAATACCTAAGTGG + Intronic
1179253254 21:39692059-39692081 TACCATGCTTATTACCTAGGCGG - Intergenic
1179459242 21:41522638-41522660 TGCTGGGCTTAATACCTAGGTGG - Intronic
1179559038 21:42201029-42201051 TGCTGGGCTTAACACCTAGGTGG - Intronic
1181902401 22:26167680-26167702 TACCAGGCTTAATACCTGGTTGG + Intergenic
1183979150 22:41529599-41529621 TGCCACGATTAGAACCTAGGTGG - Intronic
949916178 3:8966391-8966413 TTCTAGGTTTAATGCCTAGAAGG + Intergenic
950223397 3:11213930-11213952 TGGCAGGTTTTCTACCCAGGTGG + Intronic
956040713 3:65142274-65142296 TGCTGGGCTCAATACCTAGGTGG - Intergenic
956400166 3:68870678-68870700 TGCCGGGCTTAAAACCTAGACGG - Intronic
956800961 3:72757873-72757895 TACTAGGCTTAATACCTGGGTGG + Intronic
959118027 3:102200383-102200405 TGCCAAGTTTGATATCTATGAGG - Intronic
959402495 3:105920666-105920688 TGCTGGGCTTAATACCTAGGTGG - Intergenic
959743894 3:109753825-109753847 TGCTAGGTGTAACACCTGGGTGG + Intergenic
960515660 3:118599669-118599691 TGTGGGGCTTAATACCTAGGTGG - Intergenic
960726323 3:120673960-120673982 AGCCAGGATTTATACTTAGGGGG + Intronic
963394108 3:144709926-144709948 TGTCGGGCTTAATACCTGGGTGG + Intergenic
964172819 3:153790877-153790899 TGCTGGGCTTAATACCTAGGTGG - Intergenic
964606171 3:158562589-158562611 TGCTGGGCTTAATACCTAGGTGG + Intergenic
964942568 3:162177181-162177203 TGCTGGGCTTAATACCTAGGTGG + Intergenic
965010274 3:163078910-163078932 TTATATGTTTAATACCTAGGTGG + Intergenic
965265580 3:166538562-166538584 TGGCAGGTGTAATACCAAAGAGG + Intergenic
965415880 3:168391470-168391492 TACAAGGCTTAATACCTGGGTGG + Intergenic
966455105 3:180105874-180105896 TTCTGGGCTTAATACCTAGGTGG + Intergenic
971234378 4:24828129-24828151 TGCCATCTTTAATACTTAGGGGG - Intronic
971577950 4:28301003-28301025 TGCGGGGCTTAATACGTAGGTGG + Intergenic
972136209 4:35897554-35897576 TACTAGGCTTAATACCTGGGTGG + Intergenic
973167425 4:47094658-47094680 TGCTAGGCTTAATACTTGGGTGG + Intronic
973561528 4:52141609-52141631 TACTAGGCTTAATACCTGGGTGG + Intergenic
973617980 4:52698782-52698804 TACTATGTTTATTACCTAGGTGG + Intergenic
974258025 4:59487525-59487547 TGCCAGGTTTTATACCTTGGGGG + Intergenic
974402963 4:61427674-61427696 CGCCAGGTCTGATACCAAGGAGG - Intronic
975219720 4:71800177-71800199 TGCAGGGCTTAATACCTAGAAGG - Intronic
975803656 4:78089851-78089873 TACTAGGTTTAGTACCTGGGTGG - Intronic
977663237 4:99615458-99615480 GGCTATGTTTAATAGCTAGGGGG - Intronic
978318006 4:107461489-107461511 TTCTAGGGTTAATACCTGGGTGG + Intergenic
978895529 4:113882857-113882879 AGCCAGGTTTGAGACCTAGCTGG - Intergenic
979281271 4:118870783-118870805 TGCAGGTCTTAATACCTAGGTGG + Intronic
979281607 4:118874964-118874986 TGCTGGGCTTAATACCTGGGTGG - Intronic
979914471 4:126413254-126413276 TCCTGGGCTTAATACCTAGGTGG + Intergenic
980331751 4:131419455-131419477 TACTAGGCTTAATACCTGGGTGG + Intergenic
980598313 4:134986093-134986115 TGCCATTTTGAATACCTTGGTGG + Intergenic
986459002 5:7950692-7950714 TACTAGGCTTAATACCTGGGTGG - Intergenic
986994141 5:13586885-13586907 TGCTGGGCTTAATACCTCGGTGG - Intergenic
988163110 5:27547097-27547119 TACTAGGTTGAATACCTGGGTGG - Intergenic
989351712 5:40494253-40494275 TGCAGGGCTTAATACCTAGGTGG + Intergenic
989356548 5:40550040-40550062 TGCTGGGCTTAATACCTAGGTGG - Intergenic
990656508 5:57962649-57962671 TGCTGGGCTTAAAACCTAGGTGG + Intergenic
990858500 5:60299493-60299515 TACTGGGCTTAATACCTAGGTGG - Intronic
991275172 5:64838706-64838728 TTTCAGCTTTAATACCTATGGGG - Intronic
993465528 5:88241554-88241576 TGCCTGGTTTTAATCCTAGGTGG + Intronic
993478319 5:88391679-88391701 TGCCAGACTTAATACTTCGGGGG - Intergenic
994236978 5:97374297-97374319 TGCTGGGCTTAATACCTAGGTGG + Intergenic
994592827 5:101793192-101793214 TGCTGGGCTTAATAACTAGGTGG - Intergenic
994610666 5:102034776-102034798 TGCTAGACTTAATACCTAGGGGG - Intergenic
996278347 5:121696372-121696394 TGCCAAGTTTAATACTTGTGAGG + Intergenic
997108591 5:131048893-131048915 TGCAGGGCTTAATAACTAGGTGG + Intergenic
998586356 5:143431546-143431568 TGCGAGGCTTAAAACCTAGGTGG + Intronic
998840616 5:146249898-146249920 TGTTGGGCTTAATACCTAGGTGG - Intronic
998910188 5:146951451-146951473 TACCGGGCTTAATACTTAGGTGG - Intronic
1000426594 5:161098260-161098282 TACTAGGCTTAATACCTGGGTGG + Intergenic
1001516702 5:172360401-172360423 TGCCAGGATTCAAACCAAGGCGG + Intronic
1001760098 5:174200392-174200414 TACTAGGCTTAGTACCTAGGTGG - Intronic
1002088804 5:176792687-176792709 GGCCAGGTTTCCTACCTGGGAGG - Intergenic
1003844301 6:10156847-10156869 TGCTGGGCTGAATACCTAGGTGG - Intronic
1004467272 6:15897743-15897765 TGCTAGGTTGCATTCCTAGGAGG + Intergenic
1004731095 6:18359979-18360001 TCCCAGCTATAATACTTAGGAGG - Intergenic
1005922090 6:30411254-30411276 TGCTAGGCTTAATACCTGGGTGG + Intergenic
1006105602 6:31714399-31714421 TGCCAGCTTTACTACCTTGGAGG + Intronic
1009533546 6:64851846-64851868 TACTAGGCTTAATACCTGGGTGG + Intronic
1010467839 6:76189909-76189931 TTCTGGGCTTAATACCTAGGTGG + Intergenic
1010918590 6:81651996-81652018 TACTAGGCTTAATACCTGGGTGG - Intronic
1010928506 6:81772393-81772415 TGCTGGCCTTAATACCTAGGTGG + Intergenic
1012431619 6:99170201-99170223 AGCCATGTTTTCTACCTAGGTGG + Intergenic
1013283735 6:108662957-108662979 TGGCAGTTTTCATATCTAGGGGG - Intronic
1013915141 6:115328336-115328358 TACTAGGCTTAATACCTGGGTGG - Intergenic
1014328088 6:120024861-120024883 TGCCAGGCTTAATACCTAGGAGG + Intergenic
1015508626 6:134015359-134015381 TGCTGGGCTTAATACCTAGGTGG + Intronic
1015584691 6:134763546-134763568 TGCTGGGCTTAATACGTAGGTGG - Intergenic
1016368973 6:143351681-143351703 TGTGAGGCTTAAAACCTAGGTGG - Intergenic
1016984516 6:149885058-149885080 CTCTAGGTTTAATTCCTAGGAGG - Intronic
1019062737 6:169268092-169268114 TGACAGGCTCAATACCCAGGAGG + Intergenic
1019883160 7:3881198-3881220 TGCTGGGCTTAATACCTAGGTGG - Intronic
1022313567 7:29221563-29221585 TACTGGGCTTAATACCTAGGTGG - Intronic
1026150145 7:67781209-67781231 TGCTGGGCTTAATACCAAGGTGG + Intergenic
1026256202 7:68714107-68714129 TGCTGGGCTTAATACCTAGGTGG - Intergenic
1026259374 7:68741065-68741087 TGCCAGGCTTAATACCTAGGTGG + Intergenic
1026652921 7:72231226-72231248 TGCTGGGCTTAATACCTAAGTGG - Intronic
1027877468 7:83788831-83788853 TACAAGGATTAATACCTGGGTGG + Intergenic
1029332140 7:99867423-99867445 TGTGGGGCTTAATACCTAGGTGG - Intergenic
1030217290 7:107057426-107057448 TGCCAGGTTTAAAAAGTATGAGG - Intronic
1031118571 7:117694782-117694804 TGCTGGGCTTAATACCCAGGTGG + Intronic
1031537606 7:122954484-122954506 CGCTGGGCTTAATACCTAGGTGG - Intergenic
1031745205 7:125487571-125487593 TGATAGGCTTAATACCTGGGTGG + Intergenic
1033304275 7:140212979-140213001 TGCTAGGATTAATACCTAAGTGG - Intergenic
1033840824 7:145371299-145371321 TGAAAGTTTTAATACCTAGTTGG + Intergenic
1035640511 8:1181584-1181606 TACTAGGCTTAATACCTGGGGGG + Intergenic
1037069502 8:14626252-14626274 TGCGGGGCTTAATACCTAGGTGG - Intronic
1037214724 8:16435000-16435022 TGTGGGGCTTAATACCTAGGTGG + Intronic
1037470783 8:19208028-19208050 TGCTACGCTTAATACTTAGGTGG + Intergenic
1037992865 8:23332975-23332997 TGGCAGGTTTTCTACCTTGGTGG + Intronic
1039757664 8:40540597-40540619 CCTCAGGTTTAATACCTAGAAGG - Intronic
1045057181 8:98379138-98379160 TTCAAGGGTTAATACCTAAGAGG + Intergenic
1046436335 8:114194196-114194218 TACTAGGCTTAATACCTAGTGGG + Intergenic
1048333725 8:133488517-133488539 TGCCAGGTTCAAAACCTGGTGGG - Intronic
1049137229 8:140914521-140914543 TGCTAGGCTTAATACCTGGATGG - Intronic
1050041394 9:1497715-1497737 TGCTAGACTTAATACCTGGGTGG - Intergenic
1051288093 9:15516726-15516748 AGCCATGTTTACAACCTAGGGGG + Intergenic
1051415529 9:16835958-16835980 TGCCAGGATTCTTAACTAGGTGG - Intronic
1052568558 9:30190221-30190243 TGCTGGGCTTAGTACCTAGGTGG - Intergenic
1053408035 9:37894712-37894734 TACTAGGCTTAATACCTGGGTGG - Intronic
1053496648 9:38553055-38553077 TGCAGGGTTTAGTACCTTGGCGG - Intronic
1055234606 9:74105392-74105414 TGCTGGGCTTAATACCTAGGTGG + Intergenic
1056838355 9:89976471-89976493 TGCCAGGTTCAAAACCCAAGTGG - Intergenic
1057890508 9:98866643-98866665 TGCCAGGTGCTATAGCTAGGAGG - Intergenic
1058352440 9:104041780-104041802 TACCAGGTTTAATACCTGGATGG - Intergenic
1058948472 9:109880978-109881000 TACTAGGCTTAATACCTGGGTGG - Intronic
1059625184 9:116056458-116056480 TGCCTGGTTTAATATCTAAAAGG - Intergenic
1185799595 X:2998067-2998089 TGCTGGGCTTAATACCTAGGTGG - Intergenic
1185878540 X:3719581-3719603 CACTAGGTTTAATACCTGGGTGG + Intergenic
1186300282 X:8193322-8193344 TACTGGGCTTAATACCTAGGAGG - Intergenic
1189115637 X:38339498-38339520 TACTAGGCTTAGTACCTAGGTGG - Intronic
1189703895 X:43740748-43740770 TCCCAGCTTTAATCCCTAGCAGG + Intronic
1191669186 X:63733306-63733328 TGCCAGGATTTATTGCTAGGTGG + Intronic
1191917119 X:66214402-66214424 TGCCATGTTTAAAACCTAGAAGG - Intronic
1193529348 X:82637501-82637523 TACTAGGCTTAATACCTGGGTGG - Intergenic
1194813888 X:98418801-98418823 GGTCAGGTTTAATAGCTATGTGG + Intergenic
1195588701 X:106598827-106598849 TGCTGGGCTTAATACCTAGGTGG + Intergenic
1196706688 X:118723239-118723261 CTCCAGGTTTTCTACCTAGGAGG - Intergenic
1197976394 X:132170239-132170261 TGCTGAGCTTAATACCTAGGTGG - Intergenic
1197982367 X:132230279-132230301 TGCGGGGCTTAATACCTAGGTGG - Intergenic
1198884167 X:141315698-141315720 TGCTGGGCTTAATACCTGGGTGG - Intergenic
1201292223 Y:12432059-12432081 TGCTGGGCTTAATACCTAGAGGG - Intergenic
1201704573 Y:16922093-16922115 TGCTATGTTTAATACCTAGTAGG - Intergenic