ID: 1087289488

View in Genome Browser
Species Human (GRCh38)
Location 11:96304169-96304191
Sequence CAGTGTACAGATTCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087289484_1087289488 15 Left 1087289484 11:96304131-96304153 CCTACTTCTTGCAAGTCAGTTTC 0: 1
1: 0
2: 1
3: 14
4: 205
Right 1087289488 11:96304169-96304191 CAGTGTACAGATTCTGAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 187
1087289483_1087289488 16 Left 1087289483 11:96304130-96304152 CCCTACTTCTTGCAAGTCAGTTT 0: 1
1: 0
2: 1
3: 16
4: 231
Right 1087289488 11:96304169-96304191 CAGTGTACAGATTCTGAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087289488 Original CRISPR CAGTGTACAGATTCTGAGGA GGG Intronic
900771445 1:4547962-4547984 CAGTGTACAGGTGCAGAAGACGG - Intergenic
904239608 1:29135202-29135224 CAGTGTCAAGGCTCTGAGGAGGG + Intergenic
904703900 1:32376340-32376362 CAGAGTAGAGACTCTGAGGGAGG - Exonic
905389754 1:37628827-37628849 CATTGTACAGATGCTAAGAAAGG - Intronic
906295877 1:44648859-44648881 CAGTGTAAAGTTCCTGAGTATGG - Intronic
906400123 1:45498444-45498466 CAGTCTGCAGCTCCTGAGGAAGG + Intronic
908009110 1:59757584-59757606 CTGTGTCCAGATAGTGAGGAGGG + Intronic
908607416 1:65813605-65813627 CAGTGTAGTTTTTCTGAGGAGGG + Intronic
910664649 1:89711187-89711209 CAGTGTATATTTTCTGAGAAAGG - Intronic
911556000 1:99345419-99345441 CATTGTACAGAATCTGAAAAAGG + Intergenic
912005532 1:104895308-104895330 CAGTGAACAGATTCTTAGGGTGG + Intergenic
914718776 1:150272336-150272358 CAGTGGAAATGTTCTGAGGAAGG - Exonic
915676811 1:157539559-157539581 CAGTGGACAAATTTTGAGGGAGG - Intronic
915686610 1:157640498-157640520 CAGTGGACAAATTTTGAGGGAGG - Intergenic
917496986 1:175549415-175549437 CAGTGTTGAGATTTTTAGGAGGG - Intronic
918169488 1:181982842-181982864 AAGTGTAGAGTTTCTGAGGTGGG - Intergenic
1064773608 10:18751104-18751126 CAGTGTACAGGCCCTGAGGTGGG - Intergenic
1064873217 10:19963289-19963311 AAGAGTACAGATTTTGGGGAGGG + Intronic
1065516420 10:26528497-26528519 CAGTCTAGAGATTTTCAGGAAGG - Intronic
1067429982 10:46236519-46236541 CAGTGTAGAGCTTCTCTGGAGGG - Intergenic
1070961325 10:80502146-80502168 CAGTGTCCAGGCTCTGAGGCAGG + Intronic
1071476710 10:86031865-86031887 CAGTGCAAAGACTCTGAGCAGGG - Intronic
1072485245 10:95848350-95848372 CAGTGTACAAATTGTGAGTTTGG + Intronic
1074543571 10:114385598-114385620 CATTATCCTGATTCTGAGGATGG - Intronic
1075585872 10:123657714-123657736 CAGTGAACAGTACCTGAGGATGG + Intergenic
1075625591 10:123962456-123962478 CAGTGTCCAGATTCCTGGGATGG + Intergenic
1077255212 11:1578575-1578597 CAGTGTACACATTTTCTGGAAGG + Intergenic
1077413083 11:2412523-2412545 CAGGGTTCAGACTCTGACGAGGG + Intronic
1078911608 11:15737883-15737905 CTGGGTACAGAATCTGTGGATGG + Intergenic
1080265440 11:30395909-30395931 CAGTGTAGAGTGTTTGAGGATGG - Intronic
1082216841 11:49581669-49581691 CAGTGTTCACATTCTATGGAAGG - Intergenic
1082731828 11:56807379-56807401 GAGAGCAAAGATTCTGAGGAAGG - Intergenic
1082774222 11:57233643-57233665 CAGTGCAGATATTCTGAAGAAGG + Exonic
1083156688 11:60827783-60827805 CAGTCTGCAGATTCTGACCAAGG - Intergenic
1083370732 11:62177791-62177813 CTGTGTTAAGATTCTGATGAAGG + Intergenic
1083869416 11:65477681-65477703 CAGTGCAGAGATCCTGGGGAGGG - Intergenic
1086904986 11:92408099-92408121 CAGTGTTCAGTTTCTGGTGAGGG + Intronic
1086987869 11:93269627-93269649 CAGAGTATAGATGCTGAGCATGG - Intergenic
1087289488 11:96304169-96304191 CAGTGTACAGATTCTGAGGAGGG + Intronic
1087927044 11:103930651-103930673 CAGTGTAAAGATTTGAAGGAGGG + Intronic
1088162257 11:106886756-106886778 CAGTTTAGAGATTTTGAAGAGGG - Intronic
1088656479 11:112004633-112004655 CAGTGGACTGCTTCTGAGGCAGG + Intronic
1089234745 11:117013883-117013905 AAGTCTCCAGATTCTGAGGGGGG + Intronic
1090550663 11:127816243-127816265 AAGGGTACAGATTATGGGGAAGG - Intergenic
1090932096 11:131307100-131307122 TAAAGTACAGATTCTGATGAAGG + Intergenic
1092071007 12:5631432-5631454 CATTCCACAGAATCTGAGGAAGG - Intronic
1093110283 12:15143945-15143967 AAGTGTAGAGGTTCTGAGGCAGG + Intronic
1099325335 12:81208112-81208134 CACTGTAAAGATTCAGAGGTGGG + Intronic
1101364390 12:104058250-104058272 CAGTGTACAGACTGTGAGTTGGG + Intronic
1101920140 12:108925739-108925761 CAGTGCAAAGATCCTGAGGCAGG - Intronic
1102344681 12:112152066-112152088 CTGGGTAGAGATTTTGAGGAGGG - Exonic
1104512384 12:129392429-129392451 CAGTGTGCAGATTCTGGAAATGG - Intronic
1104583659 12:130029815-130029837 CACTGTACGGATTGTGAGGTCGG + Intergenic
1105807027 13:23958772-23958794 CAATGCACAGATTCAGAGAATGG - Intergenic
1110352062 13:74520414-74520436 CAGCTTACTGATTCTGGGGATGG + Intergenic
1113033192 13:106017173-106017195 CAGAGTAAAAATTCTGAGCAAGG + Intergenic
1114702586 14:24693939-24693961 AAGTTTACAGATTCTGAGGGTGG - Intergenic
1114827114 14:26094471-26094493 CAGTGGACAGAGTCTGAGAAGGG + Intergenic
1116178834 14:41509884-41509906 AAGTGTAAAGATTCAGAGGTGGG + Intergenic
1116278816 14:42874188-42874210 CAGTGAGCAAATTCTGTGGAAGG + Intergenic
1118059135 14:62116721-62116743 CACTTGATAGATTCTGAGGAGGG - Intergenic
1120769761 14:88366175-88366197 CAGTGGACAAATTGTGAGGCAGG + Intergenic
1121176212 14:91892503-91892525 CAGGGCACAGAATCTGAGAAGGG - Intronic
1124225256 15:27887925-27887947 GAGTGGACAGAACCTGAGGAGGG + Intronic
1125204488 15:37137763-37137785 CAGTGTTCAGATACTTAGTATGG + Intergenic
1126912938 15:53434262-53434284 CAGTGTACAGAATCAGAGCTGGG - Intergenic
1130226340 15:82061097-82061119 CAGTGTGCATTTTCTGAGAATGG + Intergenic
1130763977 15:86851632-86851654 CACTCTAGAGACTCTGAGGATGG - Intronic
1130930977 15:88427790-88427812 CAGTGGACAATTTCTCAGGAAGG - Intergenic
1131305863 15:91242612-91242634 CAGTGTGAAGACTCTGAGGTGGG + Intronic
1133595131 16:7283616-7283638 AAGGATACAGCTTCTGAGGACGG - Intronic
1134320712 16:13160176-13160198 AGGTGAACAGATTCTGAGGCAGG + Intronic
1135851921 16:25971628-25971650 AAGAGTACAGATTCTGGGCAGGG + Intronic
1138336868 16:56260319-56260341 GAGTGGACAGAGTCTCAGGATGG + Intronic
1139540401 16:67611000-67611022 CAGTGTACAGATGGTGATGATGG + Exonic
1140754333 16:78054084-78054106 AAGTGTAGTGATTCTGAGCAGGG + Intronic
1141523557 16:84597276-84597298 CAGTGTGCAGATTCTTAGAGTGG - Intronic
1142547348 17:714307-714329 CAGTCCCCAGAATCTGAGGATGG + Intronic
1143829932 17:9643492-9643514 CTGTGCACAGATCATGAGGAAGG - Intergenic
1144763561 17:17721013-17721035 CAGATTCCAGATTCTGGGGATGG - Intronic
1146897765 17:36557708-36557730 TAGTGTAAAGGTTCTGAGGTTGG + Intronic
1146952723 17:36918131-36918153 CAGTGTGCAGAATCTTAGGGAGG - Intergenic
1148231222 17:45936247-45936269 CAGTGGGCAGATTATGAGGAAGG - Intronic
1148816029 17:50328973-50328995 CAGTGCAGAGATGCTGGGGAGGG - Intergenic
1149245970 17:54708272-54708294 CAGTTTACACATTATGAAGATGG + Intergenic
1150430104 17:65108393-65108415 CAGTGGTCTCATTCTGAGGACGG + Intergenic
1150727919 17:67666576-67666598 CCATGGACAGATTTTGAGGAGGG + Intronic
1152113935 17:78373273-78373295 AAATGTAAAGATGCTGAGGAAGG + Intergenic
1152188722 17:78875281-78875303 CAAGGGACAGATGCTGAGGAAGG + Intronic
1153868226 18:9292682-9292704 CAGAGAACAGATCCAGAGGAAGG - Intergenic
1155958062 18:31970574-31970596 CACTTAACAGATTCTGATGATGG - Intergenic
1156041186 18:32824679-32824701 CAGTGTACTGATTTTTAAGATGG + Intergenic
1163223132 19:15935735-15935757 CAGATGAAAGATTCTGAGGAGGG + Intergenic
1165145698 19:33728697-33728719 CAGAGTACAGGTGCTTAGGAGGG + Intronic
1165747353 19:38237826-38237848 GAGTGGACAGAATCTGAGGGTGG + Intergenic
1167762123 19:51456507-51456529 CACTGCACAGTTTCTGCGGAAGG + Intronic
926653486 2:15371791-15371813 CAATGAACAGAGGCTGAGGAGGG + Intronic
927257484 2:21052658-21052680 CAGTGTGCAGATGTTGAAGATGG + Intergenic
929336511 2:40754016-40754038 CAGTGCAAATATTCTGAGGTAGG - Intergenic
931976387 2:67648560-67648582 CAGTGTAGATATGCTAAGGATGG - Intergenic
932196149 2:69785805-69785827 CACTGTCCAGAGGCTGAGGAAGG - Intronic
932315226 2:70776323-70776345 CATTGTTCAGTTTCTGATGAGGG - Intergenic
933083013 2:78017247-78017269 AAGTCTGCAGACTCTGAGGATGG - Intergenic
936077585 2:109411530-109411552 CAGAGACCAGATTCAGAGGATGG + Intronic
938109273 2:128553210-128553232 CAGGGACCAGAATCTGAGGAGGG - Intergenic
938611344 2:132950479-132950501 CAGTTTTCAGACACTGAGGATGG + Intronic
939243828 2:139597080-139597102 CAGTGTACAGAGGCTGAGGCAGG + Intergenic
941844489 2:170119668-170119690 CCGTTTACAGACCCTGAGGAGGG - Intergenic
942941673 2:181626022-181626044 CATTTTACAGATTGTGAGGAAGG + Intronic
946059061 2:216926210-216926232 CAGTGTGCAGAGTTGGAGGAAGG + Intergenic
946952509 2:224892629-224892651 AAGAGTACAGGTTCTGAGGAGGG + Intronic
947783644 2:232794147-232794169 CAGTGTGCAGGTTCTTAAGAAGG - Intronic
1168996363 20:2136100-2136122 CAGGGGACACATTCTGAGGCCGG + Intronic
1174658286 20:52190362-52190384 CAGTGTCAAGATTCTAACGAAGG - Intronic
1175194946 20:57236644-57236666 CAGTGGCCAGATTCAGAGAAAGG + Intronic
1175376190 20:58525612-58525634 AAATGTACAGACTCTGGGGAAGG + Intergenic
1175544815 20:59771376-59771398 CAGTGTGCAGAAGCTGGGGATGG + Intronic
1176377922 21:6095932-6095954 CAGAGTCCAGACTCTAAGGAGGG - Intergenic
1179745552 21:43442316-43442338 CAGAGTCCAGACTCTAAGGAGGG + Intergenic
1181166357 22:20985451-20985473 CAGGGTACAGCTGCAGAGGAAGG + Intronic
1182393331 22:30017917-30017939 CAGGGTACAGCACCTGAGGAGGG - Exonic
1183085796 22:35486249-35486271 CAGGGTTCAGGGTCTGAGGACGG - Intergenic
1185390480 22:50558487-50558509 AAGGGTAGAGATTCTGAGGGAGG + Intronic
950119940 3:10475058-10475080 CACTGAACAGACTCAGAGGAAGG + Intronic
950772322 3:15322457-15322479 AAGTGGACAGGTTCTGGGGAGGG + Intronic
955795912 3:62636860-62636882 CAGAGGACATATTCTGAGGGTGG - Intronic
958715832 3:97779250-97779272 CAGTGCAATGATTCTGAGGAAGG - Intronic
959627515 3:108469477-108469499 CAGTGTACAGTTTCTGAATTTGG - Intronic
959809211 3:110595089-110595111 CAGTGTCCCGAGTCTGAGCAGGG + Intergenic
961175609 3:124832612-124832634 CAGAGAACAGACTCTGTGGAAGG - Intronic
965567204 3:170132628-170132650 CAGTGTTCAGTTTCTGGTGAAGG - Intronic
965865457 3:173199649-173199671 CAGTGTCCTGAGTCTGAGCAGGG + Intergenic
969065701 4:4478786-4478808 CTGTGTTCAGATTTTGAGAAGGG + Intronic
969161682 4:5265194-5265216 CATTGTCCAGATTCTAACGAAGG - Intronic
970372748 4:15424496-15424518 CTGAGTACAGAATCTGAGGCTGG - Intronic
970565129 4:17324487-17324509 CAGCGAACAGATTCTGGGGGTGG - Intergenic
971826226 4:31626416-31626438 CACTTTACAGATTCTGTGTATGG - Intergenic
971975770 4:33684420-33684442 CAGTCTCCAGATGCTGAGGGTGG - Intergenic
973771365 4:54210015-54210037 CAGTGTGCAGATCCAGAGGTGGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977737153 4:100430743-100430765 AATTGTACAGATTCTGGGTATGG - Intronic
978542242 4:109830398-109830420 CATTGCAGTGATTCTGAGGAGGG + Intronic
983294470 4:165848835-165848857 CATTTTACAGATTGTGAAGATGG + Intergenic
983857774 4:172666914-172666936 CAGGAGGCAGATTCTGAGGAGGG + Intronic
985406722 4:189645775-189645797 GAGTGAACAGATGCTAAGGAAGG + Intergenic
985406806 4:189646207-189646229 GGGTGAACAGATGCTGAGGAAGG + Intergenic
985406842 4:189646387-189646409 GGGTGAACAGATGCTGAGGAAGG + Intergenic
992091632 5:73322838-73322860 CAGTGTGCAGTGACTGAGGAAGG + Intergenic
994260792 5:97656251-97656273 CAGTGAGCATATTCAGAGGAAGG + Intergenic
994587055 5:101722171-101722193 CACTGTACAACTTCTGAAGATGG + Intergenic
999143973 5:149380694-149380716 TTGTGAACAGATACTGAGGACGG + Intronic
1000143387 5:158428792-158428814 CAGTGGAGTGAGTCTGAGGAAGG - Intergenic
1000579163 5:163013984-163014006 TAGGGTACAGATTCTAAGAAAGG + Intergenic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1003397250 6:5763952-5763974 CAGAGTCCAAACTCTGAGGAGGG + Intronic
1003491089 6:6622394-6622416 CAATGAACAGATGCTTAGGAAGG - Intronic
1006670262 6:35725969-35725991 CAGGGTACAGAGTGTGAGCAGGG - Intronic
1008358422 6:50585426-50585448 CAGTCAAAAGATACTGAGGAGGG + Intergenic
1009673218 6:66783944-66783966 CAGTGAACAGATACTGAGTAAGG + Intergenic
1012425705 6:99112192-99112214 CAACTTACAGCTTCTGAGGAAGG + Intergenic
1012563599 6:100618066-100618088 TACTTTACAGATTCTGAGAAGGG + Intronic
1016263736 6:142207219-142207241 CAGTGTAGAAATTATGAGGTGGG - Intronic
1016682805 6:146850476-146850498 CAGTGAAGAGAATGTGAGGAGGG + Intergenic
1018167375 6:161110897-161110919 CAGTGGACAGAGACTGAGGATGG - Intronic
1018223705 6:161607188-161607210 CAGTGAACAGGATGTGAGGAAGG - Intronic
1018693689 6:166372174-166372196 CAGTGTTCAGATACTGACAAAGG - Intronic
1019504594 7:1384349-1384371 AGGGGTGCAGATTCTGAGGACGG + Intergenic
1020359183 7:7308788-7308810 CAGTCTACAGAACCTGAGGGTGG + Intergenic
1020801617 7:12739427-12739449 TAGTGTACAGATTCAGATGCAGG - Intergenic
1021165179 7:17330045-17330067 CAGTGTACAGAGTCTGGACAAGG + Exonic
1021415453 7:20378316-20378338 CAATGAACACATGCTGAGGAGGG - Intronic
1024622483 7:51174015-51174037 CAGTGAACAGATGCTAAGAATGG - Intronic
1025546853 7:62185282-62185304 GATTTTACAGATTCTGCGGAGGG - Intergenic
1027707977 7:81558252-81558274 CAGTGTTCAGTTTCTGGTGAGGG + Intergenic
1029820971 7:103146788-103146810 CAGTGTATATATTCTGCTGAAGG + Intronic
1030630886 7:111894541-111894563 CAGGGGACAGTTTCTGAGGGAGG + Intronic
1031070471 7:117155900-117155922 CAGTGTAAAGTTTCTGAGGTGGG - Intronic
1032682907 7:134203756-134203778 CAGTGCAGAGATTCTGAGCAGGG - Intronic
1033661600 7:143406894-143406916 CAGTGAACAGGTTGTGAGGTGGG - Intronic
1035124851 7:156601101-156601123 AAGTGTACAGATAATGAGAAGGG - Intergenic
1037897135 8:22665449-22665471 CGGAGTACAGATGCTGATGAAGG + Intronic
1038373577 8:27015631-27015653 TAGTGTGAGGATTCTGAGGAGGG - Intergenic
1038753471 8:30318086-30318108 AAGTTTACAGATTCTGTGGATGG + Intergenic
1040725835 8:50379984-50380006 CAGAGCACACATGCTGAGGATGG + Intronic
1041817187 8:61987305-61987327 CAATGTTCAGATTCTTAGAAAGG - Intergenic
1043107913 8:76138188-76138210 TGGTGTACAGAAGCTGAGGATGG - Intergenic
1043555020 8:81420859-81420881 CAGTGTACAGTCTTTCAGGATGG - Intergenic
1044870328 8:96613842-96613864 CTGTGAAAAGATTCTGAAGAGGG + Intergenic
1047303077 8:123631502-123631524 AAATGTAAAGATTCTGAGGTGGG + Intergenic
1047757027 8:127926697-127926719 CCGGGGACAGATCCTGAGGAGGG - Intergenic
1048083252 8:131151179-131151201 CAGGGTAGTGAGTCTGAGGATGG + Intergenic
1048703910 8:137128258-137128280 TAGTGTACTGATTTTGCGGAGGG - Intergenic
1048881322 8:138875012-138875034 CAGTGAAGAGACTCTGATGAAGG - Intronic
1058504593 9:105655350-105655372 CAGTGAAAAGGCTCTGAGGAAGG + Intergenic
1060670171 9:125461819-125461841 GAGTGGACAGAGCCTGAGGAAGG + Intronic
1188111162 X:26197497-26197519 CAAGGTAAAGATGCTGAGGAAGG + Intergenic
1188886548 X:35558093-35558115 CAGAGCACACATTCTGAGAATGG - Intergenic
1192082362 X:68060723-68060745 CTGTGTACTGATCCTCAGGATGG + Intronic
1193699224 X:84742452-84742474 CAGAGAACAGAATCTCAGGAGGG + Intergenic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1199856825 X:151766058-151766080 CAGGGGACAGACTTTGAGGAGGG - Intergenic
1200561812 Y:4713518-4713540 CAGTCTACATATTTTGATGATGG + Intergenic
1201266305 Y:12210555-12210577 CAGTGTTGAGTTTCTGAAGAGGG - Intergenic