ID: 1087290154

View in Genome Browser
Species Human (GRCh38)
Location 11:96312295-96312317
Sequence GAAAACTCCAAAGCCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087290152_1087290154 9 Left 1087290152 11:96312263-96312285 CCTTTCTCAATCAAGTTTATCAT 0: 1
1: 0
2: 1
3: 23
4: 270
Right 1087290154 11:96312295-96312317 GAAAACTCCAAAGCCAAAACAGG 0: 1
1: 0
2: 0
3: 31
4: 264
1087290150_1087290154 14 Left 1087290150 11:96312258-96312280 CCCTGCCTTTCTCAATCAAGTTT 0: 1
1: 0
2: 5
3: 30
4: 347
Right 1087290154 11:96312295-96312317 GAAAACTCCAAAGCCAAAACAGG 0: 1
1: 0
2: 0
3: 31
4: 264
1087290151_1087290154 13 Left 1087290151 11:96312259-96312281 CCTGCCTTTCTCAATCAAGTTTA 0: 1
1: 0
2: 5
3: 24
4: 256
Right 1087290154 11:96312295-96312317 GAAAACTCCAAAGCCAAAACAGG 0: 1
1: 0
2: 0
3: 31
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087290154 Original CRISPR GAAAACTCCAAAGCCAAAAC AGG Intronic
900520410 1:3102650-3102672 GATAACTGCAAAGCCAGAAAGGG - Intronic
901144727 1:7057216-7057238 GAGAAACCCAAAGGCAAAACTGG - Intronic
902929636 1:19721843-19721865 GAAAAGTCCAGGGCCAAACCTGG + Intronic
902961628 1:19967644-19967666 GAACACCCCAAAACCCAAACAGG - Intergenic
905107404 1:35572733-35572755 GAAAACTTCCAAGCCAAGCCAGG - Intergenic
906054475 1:42904327-42904349 GAAAACTTCTAGGCCTAAACAGG - Intergenic
908450523 1:64250507-64250529 GAAAACTACAAATCAAGAACTGG + Intronic
910102230 1:83590317-83590339 GAAAAATCCAAAACCTGAACAGG - Intergenic
912563784 1:110570365-110570387 CAAAATTCCAAGGCCAAGACAGG - Intergenic
912660819 1:111528913-111528935 GAAAATTCCAAAGAATAAACAGG - Intronic
912976311 1:114334100-114334122 AAAATCTCCAATGCCAATACTGG + Intergenic
913037781 1:114989191-114989213 AAAAACCCCAAAAACAAAACAGG + Intronic
913548506 1:119894037-119894059 GAAGAATCTAAAGCAAAAACTGG - Exonic
915500250 1:156311059-156311081 GAAAAATCCAAGGCCATGACTGG - Exonic
916423035 1:164653933-164653955 GAAAACTCCAAAGAAGGAACAGG - Intronic
917275528 1:173327297-173327319 GAAAACTGGAAAGCTGAAACTGG + Intergenic
917466474 1:175281738-175281760 GAGCTCTCAAAAGCCAAAACTGG + Intergenic
917610474 1:176684106-176684128 GAAAACCCCACAGCCAAAAAAGG + Intronic
917923291 1:179768561-179768583 GACCACACCAAAGCCAAAGCTGG - Intronic
918244228 1:182644866-182644888 GAGAACTCCAAAGCCTCAAATGG - Intergenic
919133722 1:193482747-193482769 AAAGTTTCCAAAGCCAAAACGGG - Intergenic
919333547 1:196203432-196203454 TAACACACCAAAGCAAAAACAGG + Intergenic
919748381 1:201022430-201022452 GAAAAACCCAAAGCAAAAACTGG + Intronic
919978359 1:202627433-202627455 AGAAACCCCAAAGCCAAAAGAGG + Intronic
920566477 1:206977662-206977684 GAAAACTCCCATGCCAAAGTAGG - Intergenic
923294133 1:232576642-232576664 GACATGTCAAAAGCCAAAACAGG + Intergenic
923358107 1:233181032-233181054 GAAAACTCCAAAGAAAGAAGAGG - Intronic
1063183044 10:3623340-3623362 GAAACCTCCAAAGCCACACAGGG + Intergenic
1063627138 10:7700715-7700737 TAAAAGTCCAAAGTCAAAGCTGG - Intergenic
1064494167 10:15890086-15890108 GAGGGCTCCAAAGCCAAAAGAGG - Intergenic
1065648872 10:27866408-27866430 GTAAATTCAAAAGCAAAAACAGG + Intronic
1066021283 10:31305671-31305693 GATAATTTCAAAGACAAAACTGG + Intergenic
1066399187 10:35058222-35058244 CAAAACTCCTATGCCAAAACAGG + Intronic
1067973039 10:50992787-50992809 GCAGACTCCAAAGCCATTACTGG + Intronic
1068193305 10:53682727-53682749 GAAAATTCCACACCCAAAAGCGG + Intergenic
1070062831 10:73001802-73001824 GAAAACCACAAGGCAAAAACAGG - Intergenic
1070394507 10:76000532-76000554 AAAATCTCCAAAGATAAAACAGG - Intronic
1072762681 10:98070078-98070100 GAAAGCCCCAGAGCAAAAACAGG - Intergenic
1074272858 10:111972102-111972124 GGAAGCTCCAAAACCAAACCAGG + Intergenic
1074557599 10:114506198-114506220 GAATACTACACAGCCAAAAACGG - Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1078710498 11:13786463-13786485 GAGAACTGAAAAGCCAAAAGGGG + Intergenic
1079439380 11:20495017-20495039 GAAAAAACAAAACCCAAAACTGG - Intronic
1081114164 11:39177471-39177493 GAAAACTCTAGCCCCAAAACGGG + Intergenic
1085115492 11:73927949-73927971 GAAACTTTCAATGCCAAAACTGG + Intergenic
1087290154 11:96312295-96312317 GAAAACTCCAAAGCCAAAACAGG + Intronic
1087307200 11:96501366-96501388 GAAAACCCAAAAGCCAAAAAGGG + Intronic
1087507479 11:99044312-99044334 GAAAATTCCAAATTCACAACTGG - Intronic
1087562357 11:99806506-99806528 GAAAATTCAAAAGACAAAATAGG + Intronic
1087906653 11:103705103-103705125 GAAAACACAAAAACAAAAACCGG + Intergenic
1088243441 11:107793702-107793724 GAAGAGTCCAAAGCCCAAAGAGG + Intronic
1088552699 11:111029841-111029863 GAACACACCAAACCCAAAGCTGG + Intergenic
1088951398 11:114574313-114574335 GAATAATCCAAACCCAAACCTGG + Intronic
1089019940 11:115203033-115203055 GAAAACTAAAAGGCCAAAATAGG + Intronic
1089674288 11:120079675-120079697 GAAAACTCCCAAGAGAAACCAGG + Intergenic
1091747249 12:3000200-3000222 GAAAACTCCCAAGATAAATCTGG - Intronic
1092936359 12:13367670-13367692 GAGAACTCTGAAGCCAGAACCGG + Intergenic
1095574424 12:43718892-43718914 CCAAACCCCAAAGCAAAAACAGG + Intergenic
1097345459 12:58487162-58487184 GAAAAGTTCAAAGCCAAAGCAGG - Intergenic
1097502756 12:60426567-60426589 GAAAACTCAATAGCAAAAATGGG - Intergenic
1097993629 12:65863412-65863434 TAAAACTGTTAAGCCAAAACAGG + Intronic
1098453619 12:70648170-70648192 GAAGAATCCAAAACCAAAAAAGG - Intronic
1098850552 12:75591163-75591185 AAAAAATCCAAATCCAAACCTGG + Intergenic
1099104608 12:78483120-78483142 GGGATCTCCAAAGCCAAAAGGGG + Intergenic
1099653768 12:85463047-85463069 AAAAACTGCTAAGCCAAAATTGG - Intergenic
1104203366 12:126613857-126613879 GATAACTCTAGAGCCAAAAAAGG - Intergenic
1108474370 13:50799050-50799072 GAAACCTCAAAAGCCAGAACAGG + Intronic
1108742554 13:53353690-53353712 GAAAACCCCACAGCCTATACAGG + Intergenic
1109437149 13:62318426-62318448 GAAAACACCTAAGACAAAATAGG - Intergenic
1111718327 13:91909842-91909864 GAAACCTACAAAACCAGAACTGG - Intronic
1111912963 13:94332195-94332217 GAAGAAACCAAAGCCAAAAAAGG - Intronic
1112080446 13:95964024-95964046 TGAATATCCAAAGCCAAAACTGG + Intronic
1112137712 13:96600998-96601020 GAAACCTTCCAAGCCAAAAGGGG - Intronic
1113231266 13:108215884-108215906 GAAAACTCCCAAGAGAGAACAGG + Intronic
1113756763 13:112817764-112817786 GCAAACTGCAAAGCCACAAAAGG - Intronic
1115057401 14:29146718-29146740 GAAAACTGTAAAGCCAAAAATGG - Intergenic
1115815339 14:37157694-37157716 GAACAAACCAAACCCAAAACTGG + Intronic
1115980223 14:39043436-39043458 GATAACTCCTAAGCCTAAATGGG + Intronic
1116975385 14:51110078-51110100 GAAAGCATCAAAGCCAATACTGG - Intergenic
1116976520 14:51122518-51122540 GAAAAAGAAAAAGCCAAAACTGG + Intergenic
1118939206 14:70317112-70317134 AGAAACTCCAAAGCCAATGCTGG - Intergenic
1119313571 14:73672109-73672131 GTAACCTCCCAAGACAAAACAGG + Intronic
1121435926 14:93919379-93919401 GAAGACCCCACAGCCAAAAGGGG - Intronic
1122183814 14:99973961-99973983 AATAACTCCAAAGCGAAGACTGG - Intronic
1122321067 14:100856176-100856198 GAACACTCCATAGGCAAACCTGG + Intergenic
1123803146 15:23842625-23842647 GAAAACCCCAATGACAAAGCTGG - Intergenic
1125347696 15:38734635-38734657 GAAATCTCTAAGGGCAAAACTGG + Intergenic
1125515866 15:40320820-40320842 GAACTTTCCAAAGCCAAAAAGGG + Intergenic
1125971897 15:43918469-43918491 GAAAATTCCAAAGACAGAAAAGG - Intronic
1126136813 15:45400694-45400716 GGAATAACCAAAGCCAAAACAGG - Intronic
1126568424 15:50124950-50124972 GAATGCTCCACAGCCAAAACTGG + Intronic
1127004560 15:54551746-54551768 AAAAACTCAAAAGCCAATAATGG - Intronic
1127276920 15:57454369-57454391 GAAAACACCTAAGCCCAAAGAGG - Intronic
1130619158 15:85443276-85443298 ATAAACACCAAAGCTAAAACAGG - Intronic
1130727386 15:86453362-86453384 GGAAACTTCAAATCCAATACAGG + Intronic
1131050438 15:89343868-89343890 CAAAACTGGAAAGCCACAACAGG - Intergenic
1131960992 15:97790057-97790079 GAAAATCCCAAAGCCAGAAAAGG + Intergenic
1132559352 16:586279-586301 GAAAATTCCAGAGCCAAAATGGG - Intergenic
1134365876 16:13578780-13578802 GAGAAGTCCAAAGCCACAAGGGG - Intergenic
1136081263 16:27854024-27854046 GAAATCTCCAAAGCCAAATTGGG - Intronic
1136126241 16:28183491-28183513 GGAAGCTCCAAAACCAAATCCGG + Intronic
1137839642 16:51628437-51628459 AAAAACTGCAAATCCAATACAGG + Intergenic
1138696687 16:58820344-58820366 GAAAAAACCAAAGCCATAAATGG + Intergenic
1138736328 16:59254312-59254334 GAAAAATACAAAGTGAAAACAGG - Intergenic
1138798170 16:59994498-59994520 GGAAACTCCCAAGCCAAACCAGG + Intergenic
1139609988 16:68049092-68049114 GAAACATCCAAAAACAAAACTGG - Intronic
1139795280 16:69477987-69478009 GAAAACTCCAAAGAAATCACTGG + Intergenic
1141364022 16:83425596-83425618 GAAAGCTCCAAAGGCAACAGTGG - Intronic
1141836470 16:86543462-86543484 GAAAAGACCAAAGCCAAATCTGG + Intronic
1143115074 17:4577475-4577497 GAAAACTGCAAAGCCAGGAGGGG - Intergenic
1144592860 17:16539541-16539563 GGAGGCTCCAAAGCCAAAAGAGG - Intergenic
1147499400 17:40948417-40948439 TAAAACCCCAAAACCAAAACTGG - Intergenic
1147940692 17:44045565-44045587 GAAAACACAAAAAACAAAACTGG - Intronic
1149056395 17:52371637-52371659 GAAAAGTGCACAGCCAAGACTGG - Intergenic
1149176357 17:53876569-53876591 GAAAAATCCAAAGAAAAAAATGG - Intergenic
1156905395 18:42346559-42346581 GAAAACACCAAAGCAAAATCTGG - Intergenic
1157387457 18:47270220-47270242 GAAAGCTGCAAAGACAAAGCGGG - Intergenic
1159531416 18:69660561-69660583 GATACCTCCATAACCAAAACTGG + Intronic
1159579278 18:70217140-70217162 AATATCTCCAAAGCCAACACAGG + Intergenic
1162193757 19:8967549-8967571 GCAAGCTCCAAAGACAAAAGTGG - Intronic
1165934151 19:39378994-39379016 GAAGCCTCTAAAGCCAACACTGG - Intronic
925576559 2:5366596-5366618 GAAAACACCAAGGCCCAGACAGG + Intergenic
929676332 2:43935002-43935024 GAAAACCACAAAGCTAAAATGGG + Intronic
929762599 2:44818444-44818466 GAAAACTCAAGAGCAAAAGCTGG - Intergenic
930861107 2:56073526-56073548 AAAAACACCAAAGCAAAAATTGG - Intergenic
931402594 2:61944738-61944760 GAAAACTCCATAAAGAAAACAGG + Intronic
931732777 2:65167706-65167728 GAAAAATCCAAAGGAAAAATAGG - Intergenic
931939820 2:67239845-67239867 GAAGACTCCTAAGACAAAACTGG - Intergenic
933033355 2:77360829-77360851 GAAAATTACAAAGTAAAAACAGG - Intronic
933188815 2:79310096-79310118 GAAAACTCAAAAGAATAAACAGG - Intronic
933548959 2:83749992-83750014 GAAAAGTCCAAAGCCAACAAAGG + Intergenic
933793122 2:85899446-85899468 GAAAACACTAAAACAAAAACTGG - Intergenic
934313251 2:91890639-91890661 GCAGAATCCAAAACCAAAACAGG + Intergenic
934907230 2:98215985-98216007 GAAAATTCAAAAGCAAAAAATGG - Intronic
935309895 2:101773169-101773191 GAAAACATCAAAACCAGAACAGG - Intronic
935398535 2:102636612-102636634 GCAAACAGCAAAGCCAAAATTGG + Intronic
935854548 2:107259890-107259912 GCAAAGTACAAAGCCAAACCAGG - Intergenic
936684886 2:114816190-114816212 GAACATTCCAAAGACAAAAAAGG - Intronic
936851369 2:116902265-116902287 GAAGAAACCAAAGCCAAAATTGG - Intergenic
937492997 2:122389119-122389141 GAAAACACCAAAGGCAAAGTTGG + Intergenic
940009177 2:149037220-149037242 TAAACCTCCAAGGCCAAAATGGG - Intergenic
940062610 2:149588944-149588966 GAAATCTCAATAGCCAAAGCTGG - Intergenic
940903922 2:159151646-159151668 GCAATCTCCAAAGTGAAAACTGG - Intronic
948739775 2:240037101-240037123 AAACAAACCAAAGCCAAAACTGG - Intergenic
1168950014 20:1791087-1791109 GAAAGCTCCAGAGCCAAGAGAGG + Intergenic
1170604387 20:17864615-17864637 CAAAACTCCAAAGAAAAAAAAGG + Intergenic
1171067354 20:22031281-22031303 GAAAACTTCAAAGGCACAAAGGG - Intergenic
1171080821 20:22181696-22181718 GAAATCCCAATAGCCAAAACTGG - Intergenic
1171297288 20:24029253-24029275 GAAAACTTCAAAGCCAGAGCTGG - Intergenic
1171469721 20:25360728-25360750 GAAAAGTCCAAAACCAGCACAGG + Intronic
1172471614 20:35201942-35201964 GAAAAATCCACAGTCATAACTGG + Intergenic
1172471684 20:35202732-35202754 GAAAAATCCACAGTCATAACTGG + Intergenic
1173958902 20:47056196-47056218 AAAAACTCCAAACCCACACCCGG - Intronic
1175045746 20:56103461-56103483 GAAAAGTCCAAGGGTAAAACTGG - Intergenic
1176067332 20:63205058-63205080 GAAAACTAAAAATCCAAAAACGG - Intronic
1180676825 22:17592238-17592260 GAAAACTTCTAGGCCTAAACAGG + Exonic
1181805999 22:25374773-25374795 GGAAGCTGCAAAGACAAAACAGG - Intronic
1182672155 22:32005444-32005466 GAAATCTGGAAAGCCAGAACCGG - Intergenic
949264155 3:2137774-2137796 GAAAAGGACAAAGCCAAAGCGGG + Intronic
949694289 3:6676306-6676328 GAAATATCCAAAGCCAAACAAGG + Intergenic
950100924 3:10356274-10356296 GAAAACACCGAAGCCCAAAGGGG - Intronic
950199434 3:11032834-11032856 AAAAACCCCAAACCCCAAACTGG - Intronic
951058703 3:18178974-18178996 CAAAAATCCAAAGCCAAGACTGG + Intronic
955570215 3:60296556-60296578 GAAAACCACATATCCAAAACAGG - Intronic
956211239 3:66803809-66803831 GAAAACTGAAAAGGCAAAAAAGG - Intergenic
956226584 3:66965943-66965965 GAAAACTCTAAAGCTCTAACAGG + Intergenic
957657505 3:83099695-83099717 GAAAGCTTCAAAACCAAAAAAGG + Intergenic
957657509 3:83099785-83099807 GAAAGCTTCAAAACCAAAAAAGG + Intergenic
957732116 3:84151881-84151903 GCAAAGTCCACAGCCAAAAATGG + Intergenic
958461339 3:94400494-94400516 TTAAACTCCAAAGCCATATCTGG + Intergenic
959712911 3:109402523-109402545 GAAAAATTAAAAGCCAAAACAGG - Intergenic
961048815 3:123728991-123729013 AAAAACTTCAAAGGAAAAACTGG + Intronic
961617620 3:128195491-128195513 GGACACTCCAAAGCCAAACTTGG + Intronic
963337760 3:143996700-143996722 CAAAACTCCAAAAGAAAAACAGG + Intronic
963388545 3:144628226-144628248 GAATATTCTAAAGCCAGAACAGG - Intergenic
964834897 3:160927292-160927314 GACAACTTCAAAGACACAACTGG - Intronic
965701345 3:171461215-171461237 GGTAACTCCAAAGCCAACACTGG + Intergenic
967306397 3:188063745-188063767 GAAAACTCAGAAGCAAAAGCAGG + Intergenic
967697242 3:192546522-192546544 GAATACACCAAAACCACAACTGG + Intronic
970064191 4:12072825-12072847 GAAAACTCCAAACACCAAAAAGG - Intergenic
971121459 4:23709731-23709753 GAAAAGGGCAAAGCCAAATCAGG - Intergenic
973926324 4:55742191-55742213 GAAAACTACTCAGCCAAAAAAGG + Intergenic
974193980 4:58546653-58546675 AAAAACTGCAAAGCTAAAAAAGG - Intergenic
975227073 4:71885692-71885714 AAAGACTACAAAACCAAAACAGG + Intergenic
975441352 4:74414148-74414170 GAAAAATCCAAATCCAAATGAGG - Intergenic
977024673 4:91802292-91802314 GACATGTCAAAAGCCAAAACAGG + Intergenic
977853927 4:101864945-101864967 GAAAACCACAAAACCAAAAAAGG - Intronic
978103309 4:104870577-104870599 GAGAACTCAAAAGCCATACCAGG - Intergenic
978719284 4:111888207-111888229 TAAGATTCCAAAGCCAAGACTGG + Intergenic
980368445 4:131837388-131837410 CAAAACTACAAACTCAAAACTGG - Intergenic
980841212 4:138263908-138263930 GAAGACTTCAAAGCAAAAACTGG - Intergenic
981061055 4:140426509-140426531 CAAAACTCCAAACTGAAAACAGG + Intronic
981746972 4:148061717-148061739 GAAAGCTCTAAAACCAAAAGTGG - Intronic
983094717 4:163548107-163548129 CAATAAACCAAAGCCAAAACAGG - Intronic
983358285 4:166693874-166693896 GACAACTTCAAAGACAAATCAGG - Intergenic
984034984 4:174655461-174655483 GAAAACTCTAATGAAAAAACAGG - Intronic
984106848 4:175558347-175558369 TAAAACTCCAAGGAGAAAACAGG - Intergenic
984496306 4:180502254-180502276 GAAATCTCCAAACAGAAAACTGG - Intergenic
985185584 4:187311710-187311732 AGAATGTCCAAAGCCAAAACAGG - Intergenic
987898513 5:23980356-23980378 GAACACACTAAAGCCAAAGCAGG + Intronic
987899289 5:23990089-23990111 GAAAACTGCAAAGCAAAATCTGG - Intronic
988408106 5:30850373-30850395 ATAAACTCCAAACTCAAAACAGG + Intergenic
989555945 5:42794746-42794768 AAAAACACCAAAGACAAAAGGGG + Intronic
990960190 5:61385883-61385905 GAAAACCCCACATCCAAAGCTGG - Intronic
992057474 5:73005236-73005258 AAAAACTACAAAGAGAAAACTGG - Intronic
993807467 5:92429680-92429702 GAGAACTGCAAGGCCAAAAGGGG - Intergenic
995260509 5:110098618-110098640 GAAAATCTGAAAGCCAAAACTGG - Intergenic
999178572 5:149652149-149652171 GAAAACTCCAGATTCAAATCTGG - Intergenic
999514930 5:152291585-152291607 GACATGTCCAAAGCCAAGACAGG + Intergenic
999639434 5:153657381-153657403 GAAAATTGCAAAGACAGAACAGG - Intronic
1000872092 5:166589434-166589456 GCAAACACAAAACCCAAAACTGG + Intergenic
1004068106 6:12270314-12270336 GAACAAACCAAAGCCAAAATTGG - Intergenic
1004207460 6:13605637-13605659 GAAAACGACAAAACCAAAACTGG - Intronic
1005319275 6:24636221-24636243 AGAAAAACCAAAGCCAAAACAGG + Intronic
1005492917 6:26363163-26363185 TAAAACTCCAACTCCACAACAGG + Intergenic
1006268120 6:32942275-32942297 GAATACTCCACAGACAAAAAAGG - Intronic
1006882511 6:37352675-37352697 GAAAACTGAAAAGACAAAAGGGG + Intergenic
1008851852 6:56031940-56031962 GACAACTCCAAAGTTAACACAGG - Intergenic
1008967217 6:57324901-57324923 AAAAACTCTAGAACCAAAACTGG - Intronic
1009268981 6:61594342-61594364 GAAAACTCCAATTAGAAAACAGG - Intergenic
1012308514 6:97690588-97690610 GAAAATACCAGACCCAAAACAGG + Intergenic
1012423943 6:99094168-99094190 GAAAACACCATAGACACAACAGG + Intergenic
1013715622 6:112957482-112957504 GACAACACAAAAGCCAAACCTGG - Intergenic
1013776540 6:113684713-113684735 GTAAACACGGAAGCCAAAACAGG + Intergenic
1013895147 6:115078971-115078993 CAAAACACCAAAGCCAAGAGAGG + Intergenic
1015576342 6:134675661-134675683 GAAAACACCAAATGAAAAACGGG + Intergenic
1015834959 6:137410468-137410490 GAAAAATCAAATGCCATAACTGG + Intergenic
1018513417 6:164551676-164551698 GGAAACACCAAAGCCAAGAATGG + Intergenic
1020178877 7:5905842-5905864 AAAAACTCCAAAATAAAAACAGG - Intronic
1020304056 7:6819188-6819210 AAAAACTCCAAAATAAAAACAGG + Intronic
1020794725 7:12665597-12665619 GAAAACTCCAAGGCCACATGTGG - Intergenic
1021368931 7:19817223-19817245 GATAACTCCAAAGTTAACACAGG - Intergenic
1021446465 7:20739044-20739066 GAATATTCCAAAGCCAAATCGGG + Exonic
1021453101 7:20799748-20799770 GAAAACTACAAGGCTCAAACTGG - Intergenic
1023517654 7:41017985-41018007 GAAAACTTAAAAGCCACAATGGG + Intergenic
1024364525 7:48505872-48505894 AACAACTCCAAAACCAAAATTGG + Intronic
1024836265 7:53522473-53522495 GAAAAACCCAAAGACAACACTGG + Intergenic
1026061135 7:67027546-67027568 GAAAAATCAAAAGGCAAAACAGG + Intronic
1026426515 7:70299785-70299807 GAAAATCCCTAAGCCAAACCTGG - Intronic
1026717224 7:72799846-72799868 GGAAAATCAAAAGGCAAAACAGG - Intronic
1028725968 7:94088494-94088516 GAAAATAGGAAAGCCAAAACTGG + Intergenic
1028999058 7:97133925-97133947 CAAAAACCCAAGGCCAAAACTGG + Intronic
1029614643 7:101648607-101648629 GTAAACTCCAAATCCCAAAAAGG + Intergenic
1030094850 7:105889382-105889404 AAAAACCTAAAAGCCAAAACTGG - Intronic
1033439074 7:141362357-141362379 GTACACTTCAAAGCCAAAACAGG - Intronic
1035465727 7:159075422-159075444 GGAGACTTCAAAGCCAAAACTGG - Intronic
1035583813 8:756930-756952 GAAAACTCGAGAGCCAGAAAGGG - Intergenic
1036924865 8:12894503-12894525 GGGGACTCCAAAGCCAAAAGAGG - Intergenic
1037299227 8:17433919-17433941 GAAAACTGCAAATCTAATACAGG + Intergenic
1039633693 8:39140273-39140295 GACAAACCCACAGCCAAAACGGG - Intronic
1041608915 8:59820157-59820179 AAAAAATCAAAAGCTAAAACTGG - Intergenic
1042843891 8:73151047-73151069 GAAAAATCGAAAGCAAAAACTGG + Intergenic
1043225671 8:77727082-77727104 GATAACTCCAAAGAGAAAACAGG + Intergenic
1043341197 8:79241510-79241532 GACAACTCAAGAGCCAAAATTGG - Intergenic
1043858494 8:85288744-85288766 GAAAAGTCCAAAGGTAAAGCTGG + Intergenic
1043921650 8:85990131-85990153 GAAAACACCAACCCCAGAACTGG - Intronic
1046459965 8:114520545-114520567 GAAAACTCGAAAGATAAAAAAGG - Intergenic
1046708957 8:117487730-117487752 GAAAACTCAAAAGCCCAGAGTGG + Intergenic
1047591349 8:126330335-126330357 GAAAACCCCAAACACAGAACAGG - Intergenic
1047826729 8:128584437-128584459 GAAAACTCCAAAATCAAACTAGG + Intergenic
1048071694 8:131028162-131028184 GAAAAACCCATAGCAAAAACAGG + Intronic
1051946812 9:22579210-22579232 GAAAACCCCAAAACCAAAGAAGG - Intergenic
1053632811 9:39963103-39963125 CAAAACTACAAACTCAAAACTGG - Intergenic
1053772947 9:41500430-41500452 CAAAACTACAAACTCAAAACTGG + Intergenic
1054211077 9:62287594-62287616 CAAAACTACAAACTCAAAACTGG + Intergenic
1054313904 9:63561257-63561279 CAAAACTACAAACTCAAAACTGG - Intergenic
1055282465 9:74690325-74690347 GAAAATTCGAAAGCCTAAAAGGG + Exonic
1055897332 9:81193417-81193439 GAAAAATCAGAAGCAAAAACAGG - Intergenic
1056027826 9:82518488-82518510 GAAAATTACAAAGCTACAACAGG + Intergenic
1056440677 9:86618002-86618024 GAAAGGTCCAAAGCAAAAAAAGG - Intergenic
1056791884 9:89631301-89631323 GCAAACTCCAAACTCCAAACTGG + Intergenic
1060089619 9:120731419-120731441 AAAAACTCTAAAGCCAAATGAGG + Intergenic
1061968352 9:134029172-134029194 GCAAACTCCAGAGGCAAATCTGG + Intergenic
1186373449 X:8970337-8970359 GAAGATTCCAAAGCCAGATCTGG + Intergenic
1186771211 X:12819775-12819797 TAAAACTCCACTGCCAAGACCGG - Intronic
1187497471 X:19808035-19808057 GAAAGCCCCAAAGCCAAGAGAGG - Intronic
1187702332 X:21974674-21974696 GAAAACTCCTATACCAAAAAAGG - Intronic
1188408048 X:29836615-29836637 GAAAACTAGAAATCCATAACAGG - Intronic
1189019873 X:37323756-37323778 AAAAACTTCAAAGAAAAAACTGG + Intergenic
1189768648 X:44398850-44398872 AAAAATTCCAAATCCAAAATAGG - Intergenic
1190036165 X:47026431-47026453 CAAAACTACAAAACCAATACTGG + Intronic
1190812585 X:53898891-53898913 GAAAACACCAAAGACAAATCAGG + Intergenic
1191715191 X:64189627-64189649 GAAACCTCGAAAGCAAAAACTGG + Exonic
1192453051 X:71255044-71255066 GAAAACTCCATAGATAATACAGG - Intronic
1192981486 X:76349265-76349287 GAAAAATCCACAGCTAATACAGG - Intergenic
1193026678 X:76852334-76852356 GAGACCTCCATAGCCAGAACTGG - Intergenic
1193097608 X:77568502-77568524 GAAATCTTCAAGGCCAGAACTGG + Intronic
1193639515 X:83994861-83994883 GATAAATCCAAAGACAAAAAAGG - Intergenic
1193843234 X:86435583-86435605 GGACATTCCAAAGCAAAAACAGG - Intronic
1194211473 X:91074566-91074588 GATAACTACAAAGGCACAACAGG + Intergenic
1196873942 X:120139892-120139914 CAAAACTCAAATGCCAAAAGTGG - Intergenic
1197462216 X:126756599-126756621 TAAAGCTCCAACCCCAAAACAGG + Intergenic
1198385645 X:136126871-136126893 AAAACTTCCAAAGCCTAAACTGG + Intergenic
1200207916 X:154330987-154331009 AACAAAACCAAAGCCAAAACAGG - Intergenic
1201534354 Y:15029570-15029592 CTAAACTCCAAAGCCAACAGAGG - Intergenic
1202581660 Y:26388135-26388157 GAAAACTCCAAACCCTAAGGCGG + Intergenic