ID: 1087290693

View in Genome Browser
Species Human (GRCh38)
Location 11:96317118-96317140
Sequence ACTGAAATGGTGCCTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087290687_1087290693 16 Left 1087290687 11:96317079-96317101 CCACAGATGTTCCTCGGTGTCCT 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1087290693 11:96317118-96317140 ACTGAAATGGTGCCTGTGGAAGG 0: 1
1: 0
2: 2
3: 21
4: 226
1087290690_1087290693 -10 Left 1087290690 11:96317105-96317127 CCTGCTTGCATTCACTGAAATGG 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1087290693 11:96317118-96317140 ACTGAAATGGTGCCTGTGGAAGG 0: 1
1: 0
2: 2
3: 21
4: 226
1087290688_1087290693 5 Left 1087290688 11:96317090-96317112 CCTCGGTGTCCTGTTCCTGCTTG 0: 1
1: 0
2: 1
3: 24
4: 142
Right 1087290693 11:96317118-96317140 ACTGAAATGGTGCCTGTGGAAGG 0: 1
1: 0
2: 2
3: 21
4: 226
1087290685_1087290693 24 Left 1087290685 11:96317071-96317093 CCTGCATTCCACAGATGTTCCTC 0: 1
1: 0
2: 1
3: 26
4: 223
Right 1087290693 11:96317118-96317140 ACTGAAATGGTGCCTGTGGAAGG 0: 1
1: 0
2: 2
3: 21
4: 226
1087290689_1087290693 -4 Left 1087290689 11:96317099-96317121 CCTGTTCCTGCTTGCATTCACTG 0: 1
1: 0
2: 3
3: 24
4: 267
Right 1087290693 11:96317118-96317140 ACTGAAATGGTGCCTGTGGAAGG 0: 1
1: 0
2: 2
3: 21
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087290693 Original CRISPR ACTGAAATGGTGCCTGTGGA AGG Intronic
900124790 1:1064598-1064620 ACGGCCCTGGTGCCTGTGGAGGG - Intergenic
900267270 1:1764324-1764346 GCTGTGATGGTGCCTGGGGATGG - Intronic
900531274 1:3154618-3154640 GCTGGAATGGTGCCCGTGCAGGG - Intronic
900716111 1:4145448-4145470 ACTGACATGCTGTCTGTGGTTGG + Intergenic
903262777 1:22140261-22140283 ACTGAAAAGCTGCCTCTAGAAGG - Intronic
907462960 1:54616160-54616182 ACTGTGATGTTGCCTGTGGAAGG + Exonic
907754863 1:57301658-57301680 AATGAAATGCAGCTTGTGGAAGG - Intronic
911327630 1:96487567-96487589 ACTGAAATGGTGATTCAGGAAGG + Intergenic
912055477 1:105592925-105592947 ACTGAAGTGGGGGCTGTGGATGG - Intergenic
912193101 1:107363714-107363736 TATGAAATGGTGCCTGTTGGTGG - Intronic
913610988 1:120509614-120509636 AGGGCAATGGTGCCTGAGGAAGG + Intergenic
914580202 1:149012625-149012647 AGGGCAATGGTGCCTGAGGAAGG - Exonic
916433444 1:164754570-164754592 ACTGAAAAAGTGACTGTGTAAGG + Intronic
918087761 1:181259937-181259959 AAAGAAATTGTGCCTGTGGATGG - Intergenic
918427451 1:184425207-184425229 ACTGAGATGGTGTATGTGGAAGG + Intronic
920239483 1:204534984-204535006 ATTGCATTGGTGCTTGTGGATGG + Intronic
921750454 1:218786473-218786495 ATTGAATGGTTGCCTGTGGAAGG - Intergenic
922216888 1:223527027-223527049 ACTGAAGTTGTGCCTGGGGTGGG + Intergenic
924728215 1:246689656-246689678 ACTGAAATCTTGCCAGTAGAGGG + Intergenic
1062834730 10:628269-628291 CCAGAAATGGTCCTTGTGGATGG + Intronic
1064679551 10:17796193-17796215 ATAGAAATGGTGCGTGTGGCTGG + Exonic
1065198809 10:23294038-23294060 AATTCAATGGAGCCTGTGGAGGG - Intronic
1067180189 10:43979547-43979569 CCTGAAATGGTGACTGTGGTAGG + Intergenic
1068697365 10:59982204-59982226 ATTAAAATGGTGCCTGGGGCGGG + Intergenic
1069340241 10:67401513-67401535 ACTGGAAAGGTACCTGGGGAAGG + Intronic
1069887048 10:71630417-71630439 ATTCAGATGGGGCCTGTGGAGGG + Intronic
1070159813 10:73859511-73859533 ACTGACATGTTGCCTTTGGTAGG - Intronic
1070313528 10:75290904-75290926 ATTGAAATGGTCCCTTTGTAAGG - Intergenic
1070516666 10:77214447-77214469 GCTGAAAGAGTGTCTGTGGAGGG - Intronic
1070891686 10:79946116-79946138 AATTAAATGATGCCTGTGCAGGG - Intronic
1071481762 10:86069984-86070006 CGTGATATGGTGCCTGTAGAGGG + Intronic
1071816819 10:89240741-89240763 ACTTAAATGCTTCCTGTGGTGGG - Intronic
1073893179 10:108123738-108123760 ACACAAATGGTGGCTGTGGAAGG + Intergenic
1074908966 10:117890077-117890099 AATGAGATGGTCACTGTGGATGG + Intergenic
1075008210 10:118845659-118845681 ACTGAAGTGGTGGCTGGGAAGGG - Intergenic
1075670355 10:124260220-124260242 ACTGCACAGGGGCCTGTGGAGGG - Intergenic
1075867396 10:125736828-125736850 ACTGAAATGTTGCCTCTTCAGGG + Intronic
1078992530 11:16664466-16664488 TCTCAGCTGGTGCCTGTGGAGGG + Intronic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1080747140 11:35118461-35118483 ACTGACAGGGTGATTGTGGAGGG - Intergenic
1081370079 11:42289883-42289905 TCTGAAAGGGTGCTTCTGGAAGG + Intergenic
1081743565 11:45457597-45457619 ACTCAAATGGTCCCTGTGGCTGG - Intergenic
1083956667 11:65987635-65987657 CCTGAACAGGTGCCTGAGGAGGG - Intergenic
1087238459 11:95748391-95748413 ACTGAAATGGTGCCCGGTCATGG - Intergenic
1087290693 11:96317118-96317140 ACTGAAATGGTGCCTGTGGAAGG + Intronic
1091020483 11:132095350-132095372 GATGAAAGGGTTCCTGTGGAGGG - Intronic
1093169416 12:15842926-15842948 ACTAAAATGGTGTCTGTGAGTGG - Intronic
1093603794 12:21064846-21064868 ACTGATATGGAGGCGGTGGAAGG + Intronic
1094566722 12:31605366-31605388 TTAGAAATGATGCCTGTGGAGGG - Intergenic
1095520690 12:43061602-43061624 ATTGAAAGGGAGCCTGTGGAAGG - Intergenic
1096542255 12:52314447-52314469 ACTGGAAAGGGGCCTGTGGCTGG - Exonic
1096604734 12:52756476-52756498 ATTGAAATGGGAACTGTGGAGGG + Intergenic
1097688231 12:62710804-62710826 GCTGAAATGCTGCCTCTGCAAGG - Intronic
1098117935 12:67200324-67200346 ACTGTGATTGTGCCTGTGAATGG - Intergenic
1098157033 12:67609648-67609670 CCTGAAATGGTGCTGGTGGGGGG - Intergenic
1100671790 12:96821390-96821412 ACTGAAATGGTGGGTGTGCCTGG + Intronic
1101321001 12:103673027-103673049 AATGAGATGGTGCATGTGGAAGG + Intronic
1102255889 12:111414774-111414796 GCAGAGACGGTGCCTGTGGAGGG + Intronic
1102350791 12:112190718-112190740 GCTGGCATGGTGCCTGAGGAAGG - Intronic
1103281401 12:119760747-119760769 ACTGAGGTGGTGGCTCTGGATGG - Intronic
1103623012 12:122200356-122200378 ACAGAAGTGCAGCCTGTGGATGG - Intronic
1103744266 12:123111475-123111497 AATGGAATGGTGGCTGGGGATGG + Intronic
1103923842 12:124413089-124413111 ATTGAAATGGAGGCTGTGGTGGG - Intronic
1104046004 12:125163492-125163514 AGTGAAATGGGGCCGGTGCAGGG - Intergenic
1104572319 12:129935802-129935824 ACTGTCATGGTGCCTGATGAGGG + Intergenic
1104702386 12:130917011-130917033 AGTGAAATCGTGTCTCTGGAAGG + Intergenic
1105014364 12:132777155-132777177 TGGGAAATGCTGCCTGTGGAAGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105984680 13:25553783-25553805 TCTGAGGTGGTGTCTGTGGAAGG - Exonic
1107294533 13:38895328-38895350 CCTGAAATAGTGCCTGAGCATGG + Intergenic
1108290434 13:48954941-48954963 GCTGAAAAGGAGGCTGTGGAAGG - Intergenic
1112550724 13:100418083-100418105 ACAGGAGTGGTGTCTGTGGATGG - Intronic
1114131096 14:19793842-19793864 AGTGAATTAGTGCCTGTGAATGG + Intronic
1115148316 14:30253244-30253266 AATGAAATGGTTCATGTGAATGG - Intergenic
1117158540 14:52964644-52964666 GCTGGAATGGTGCCAGTGCATGG - Intergenic
1118473446 14:66095292-66095314 CCTGAAATGGTATCTGTGCAGGG + Intergenic
1202865338 14_GL000225v1_random:113853-113875 ACAGACATGGTGCCTGCGGCCGG + Intergenic
1123574154 15:21649451-21649473 AGTGAATTAGTGCCTGTGGATGG + Intergenic
1123610770 15:22092036-22092058 AGTGAATTAGTGCCTGTGGATGG + Intergenic
1129311623 15:74716447-74716469 ATTGAAATGGGACATGTGGAGGG - Intergenic
1129505812 15:76080543-76080565 TTTGAAATGGTGCCTTTGGCAGG - Intronic
1129875294 15:78971478-78971500 GCGGAAATGTTGCCTTTGGAAGG + Intronic
1202983018 15_KI270727v1_random:383795-383817 AGTGAATTAGTGCCTGTGGATGG + Intergenic
1134828515 16:17304419-17304441 ACAGAAATGCTGTATGTGGATGG + Intronic
1138272611 16:55706783-55706805 GCTGAAATGGTGCCAATGGTAGG + Intergenic
1138922441 16:61548158-61548180 ACTGAATATGTGCCTCTGGAAGG - Intergenic
1140207876 16:72948265-72948287 CCTGAAATGGTGCATCTGGCCGG - Intronic
1142258790 16:89032470-89032492 ACTGAGATGTAGCGTGTGGATGG - Intergenic
1143858612 17:9871523-9871545 AATTAAAGGATGCCTGTGGAAGG - Intronic
1143959382 17:10702343-10702365 ACTGAACTTGTTCCAGTGGAAGG + Intronic
1145716374 17:27027109-27027131 AAGGAAGTGGAGCCTGTGGATGG - Intergenic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1147749232 17:42718392-42718414 AAGGAAATGGTGGCTGGGGATGG + Intronic
1147891402 17:43720031-43720053 ACCGAAGTGGTGGCTGTGGAGGG + Intergenic
1148497792 17:48064252-48064274 ACTGAAGTAAGGCCTGTGGAAGG + Intergenic
1149272474 17:54995238-54995260 GCCCAAATGGTGCCAGTGGAAGG - Intronic
1149521064 17:57318625-57318647 TCTGAAAAGGTGCCTGTTGTGGG + Intronic
1150200675 17:63353888-63353910 ACTGAAATGGTTCTTGTCAAGGG - Intronic
1150451055 17:65269324-65269346 ACGGAATTGGTGTCTGGGGATGG + Intergenic
1151505410 17:74523995-74524017 ACTGGAGTGGTGCCTGAGCAGGG + Intronic
1152363998 17:79844788-79844810 CCTGAAGTGGTCCCTGGGGATGG + Intergenic
1155680162 18:28477732-28477754 AAATAAATGGTGACTGTGGAAGG - Intergenic
1155755413 18:29489051-29489073 ACAGAAATGAGGACTGTGGAAGG - Intergenic
1157370956 18:47111214-47111236 ACTAAACTGATGCCTGTGAAAGG + Intronic
1157512052 18:48282862-48282884 ACTGAAATGGGGCCTGAGGATGG + Intronic
1157631022 18:49095865-49095887 ACTGCAATGGAGTCTGGGGAAGG - Intronic
1158481406 18:57824635-57824657 ACTCAGCTGGTGCCTATGGAGGG - Intergenic
1159642424 18:70879123-70879145 AAAGAAATTGTGCCTTTGGATGG + Intergenic
1160157607 18:76445452-76445474 AGTGAACTGGGGCCTGGGGAAGG - Intronic
1161302802 19:3551182-3551204 ACGCAGACGGTGCCTGTGGAAGG + Exonic
1163178912 19:15584769-15584791 TCTGCAAAGGTGCCTGAGGAGGG - Intergenic
926276583 2:11407844-11407866 AATGAACTGGTACCTGAGGAGGG - Intergenic
926324185 2:11770250-11770272 CCTGACAGGGTGCCTGTGGGTGG + Intronic
927754497 2:25697918-25697940 ACAGAGATGCTGCCTGCGGAAGG + Intergenic
928213140 2:29338880-29338902 ATTGAAATGGAGACTGGGGAAGG - Intronic
930566646 2:53028882-53028904 TGTGAGATGGAGCCTGTGGAGGG + Intergenic
932746500 2:74337983-74338005 CCTGACATGGAGCCTCTGGAGGG + Intronic
932836234 2:75040543-75040565 ACTAAATTGGTGGGTGTGGATGG - Intergenic
935292248 2:101620546-101620568 ACTGAGAGGGTGGCTGGGGAAGG - Intergenic
936729693 2:115365803-115365825 TTTGAAATGATGCTTGTGGATGG - Intronic
937004365 2:118497616-118497638 ACTGAGATGGTGGTGGTGGATGG - Intergenic
942426815 2:175868904-175868926 ACTGAATCGGTGTCTGGGGAGGG + Intergenic
944093826 2:195944460-195944482 ATTGTAATGGTGCTTGTGTAGGG - Intronic
945213637 2:207410369-207410391 AGTGAAATGGTAGCTGTGCAGGG - Intergenic
945557743 2:211300277-211300299 ACTTATACGGTGCCTGTTGATGG - Intergenic
947497747 2:230650788-230650810 ACGGACATGGTGCCTGTGCTGGG + Intergenic
948204187 2:236153565-236153587 ACTGAAATGGTGCAGTTAGATGG - Intergenic
948494007 2:238333519-238333541 ACTGGAACTGTGCCAGTGGAGGG + Intronic
948513953 2:238491225-238491247 ACTGCAATGGTGCCTGCACAGGG + Intergenic
1171096120 20:22333692-22333714 ACTCAAATGGTGCTTTTGAATGG + Intergenic
1172309585 20:33907462-33907484 ACTGTAATGGTAGCTGTGGGAGG + Intergenic
1173127918 20:40357298-40357320 ACTTAAATGGTGCCTATAAATGG - Intergenic
1173941344 20:46913782-46913804 GCTGAAATGGGGACAGTGGAGGG + Intronic
1175733415 20:61369807-61369829 ACTCAAATGGCGCCTCTGCAGGG - Intronic
1176896210 21:14382571-14382593 TCTGAAATGTTGCCTGTAGCTGG - Intronic
1177328455 21:19625495-19625517 GCTGAACTGGTGTCTGTTGAGGG + Intergenic
1177735408 21:25082896-25082918 ACTGATTTGGTTCCTGGGGAGGG + Intergenic
1179456686 21:41505548-41505570 TCTGAAAGGGGGCCTGCGGAGGG - Intronic
1182735554 22:32530167-32530189 ACTAAACAGGTGTCTGTGGAGGG - Intronic
1183001000 22:34859027-34859049 ACAGAAATAGTGACTATGGAGGG - Intergenic
1183741331 22:39670230-39670252 AGTGAGTGGGTGCCTGTGGAGGG + Exonic
1184238488 22:43199341-43199363 ACTGAGACGCTGCCTGCGGATGG + Exonic
949714755 3:6916882-6916904 ACTGAAATGGTGGCTGGGTGGGG + Intronic
949791910 3:7801925-7801947 CCTGTAATGGTGCCTGTGAGCGG - Intergenic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
951727668 3:25777828-25777850 CCTGAAATGGAACCTGGGGAGGG + Intronic
951800934 3:26595474-26595496 ACTGAAATTATACCTGTGTACGG - Intergenic
952009555 3:28884776-28884798 ATTGAAATGGAGCATATGGATGG + Intergenic
953045641 3:39291991-39292013 AATGAAATGGTTCCAGTGAATGG + Intergenic
953854825 3:46493293-46493315 ACTGCCATGGTGCTTGTGGGAGG - Intergenic
954385141 3:50240229-50240251 ACTCTAATGGTGCCTGTGAAGGG + Intronic
954778780 3:53045032-53045054 GCTGAAAAGGAGGCTGTGGAGGG - Intronic
955428075 3:58813203-58813225 ACTGAAAGGTTTCCTGTGGAGGG - Intronic
955693978 3:61617190-61617212 ACTGCAAAGTTGCCTGTAGAAGG + Intronic
956298856 3:67746710-67746732 ACTCAAAAGGTTACTGTGGATGG - Intergenic
957222302 3:77399711-77399733 ATTCACATGGTGCCTGTGTATGG + Intronic
957232731 3:77540844-77540866 ATTGAGATAATGCCTGTGGAGGG + Intronic
958135196 3:89479527-89479549 ACGGAAGTGGTGGCTGTGGAAGG + Exonic
959572631 3:107900937-107900959 ACTAAACTGGTCACTGTGGATGG - Intergenic
965980196 3:174681111-174681133 ACTCAGCTGATGCCTGTGGAGGG + Intronic
969177247 4:5408024-5408046 ACAGATTTGGTGTCTGTGGAGGG - Intronic
969206626 4:5652093-5652115 ACTGAAAAGGTGCCTCTGGCTGG + Intronic
976072676 4:81259686-81259708 ACTGAAGTGGTTTCTGAGGATGG - Intergenic
977638593 4:99329581-99329603 ACAGAACTGGTGCCTGGTGAAGG - Intergenic
980843758 4:138299408-138299430 ATTGAAATCATGACTGTGGAAGG - Intergenic
981720543 4:147797336-147797358 AGTAAAATGGTGGCAGTGGAAGG - Intronic
984602575 4:181745384-181745406 AATGAAATGGTAGCTGTAGACGG + Intergenic
985684069 5:1272526-1272548 TCTGATGTGGTGACTGTGGATGG - Intronic
985684076 5:1272560-1272582 TCTGATGTGGTGACTGTGGATGG - Intronic
985684082 5:1272594-1272616 TCTGATGTGGTGACTGTGGATGG - Intronic
985684117 5:1272772-1272794 TCTGATGTGGTGACTGTGGATGG - Intronic
985684131 5:1272842-1272864 TCTGATGTGGTGACTGTGGATGG - Intronic
985684191 5:1273141-1273163 TCTGATGTGGTGACTGTGGATGG - Intronic
985684219 5:1273283-1273305 TCTGATGTGGTGACTGTGGATGG - Intronic
985684233 5:1273353-1273375 TCTGATGTGGTGACTGTGGATGG - Intronic
985684272 5:1273541-1273563 TCTGATGTGGTGACTGTGGATGG - Intronic
985684279 5:1273575-1273597 TCTGATGTGGTGACTGTGGATGG - Intronic
985684304 5:1273686-1273708 TCTGATGTGGTGACTGTGGATGG - Intronic
985684311 5:1273720-1273742 TCTGATGTGGTGACTGTGGATGG - Intronic
986273887 5:6256985-6257007 TCTGAAATGTTGCCTTAGGATGG - Intergenic
988203233 5:28097171-28097193 AATGAAATGGTGGCTGGGGATGG - Intergenic
990436721 5:55799817-55799839 ACTAAAATGGAGGGTGTGGATGG - Intronic
991941609 5:71858434-71858456 ACGGAAATGGTGACTGGGAAAGG + Intergenic
992710012 5:79442904-79442926 TCAGAAATGGTGGCTCTGGATGG - Intronic
992972656 5:82078659-82078681 AGTGAGATGGAGCCTGTGAATGG + Intronic
994713814 5:103297961-103297983 ACTGAGATGGTGCCAGAGGTGGG + Intergenic
995166543 5:109050632-109050654 AATGATATGGTGCAAGTGGATGG + Intronic
996094745 5:119386664-119386686 ACTGTAATGGTGCCTGTCACTGG + Intronic
997315408 5:132930450-132930472 ACTCAAATGATGCCTCTGGATGG + Intronic
998303844 5:141053232-141053254 ACCAAAGTGGTGGCTGTGGATGG + Exonic
1001254977 5:170176531-170176553 AGTCAAATGGTGGCTGTGGCTGG + Intergenic
1002307711 5:178293595-178293617 ACTGGAGTGGAGCATGTGGAGGG + Intronic
1002525454 5:179813249-179813271 TCTGATAAGGTGGCTGTGGATGG - Intronic
1003937611 6:10991858-10991880 AGTGAAATGGTGACTGTGGAAGG - Intronic
1004916004 6:20332639-20332661 ACTCTACTGGGGCCTGTGGAAGG + Intergenic
1005026482 6:21467241-21467263 AATGCAGTGGTGCCTGGGGAGGG - Intergenic
1006039517 6:31242565-31242587 AGTGAAATTGTGGCTGTAGATGG + Intergenic
1006048382 6:31319188-31319210 AGTGAAATTGTGGCTGTAGATGG + Intronic
1007330807 6:41106628-41106650 TCTGAAATGTTGCATGTGCAAGG + Intergenic
1009045995 6:58237915-58237937 ACCCAGATGGTGCCTGGGGAAGG - Intergenic
1009429098 6:63547078-63547100 GCCAAAATGGTGCCTGTGAAAGG - Intronic
1011489702 6:87878086-87878108 ACTGAAATGGTGATTGTGTTTGG + Intergenic
1013479698 6:110543200-110543222 AGGGCAATGGGGCCTGTGGATGG + Intergenic
1016620463 6:146103537-146103559 ACAGAATCAGTGCCTGTGGAAGG - Intronic
1017598064 6:156050697-156050719 ACTGAAACGGTGTCTGTGGTGGG + Intergenic
1017647630 6:156553643-156553665 ACACATGTGGTGCCTGTGGAGGG - Intergenic
1018606433 6:165602437-165602459 ACTGAAATTGCACATGTGGAAGG - Intronic
1018763394 6:166909919-166909941 AGTGAAATGAGGCCTATGGATGG + Intronic
1019286973 7:228520-228542 ACTGCCATGGGGGCTGTGGAGGG + Exonic
1022196959 7:28077978-28078000 ACTGCAATGATGGCTGTGCATGG + Intronic
1024094595 7:45973885-45973907 ACAGCCACGGTGCCTGTGGACGG - Intergenic
1025910017 7:65820681-65820703 ACTGAAATGGGAACTGTGGGTGG + Intergenic
1027573158 7:79897404-79897426 AATGAAATTGTTCCTGTGCATGG - Intergenic
1029618100 7:101672554-101672576 AGAAAAATGGGGCCTGTGGAAGG - Intergenic
1029970827 7:104787466-104787488 ACAGATATGGTGTCTGAGGAAGG + Intronic
1030222314 7:107109993-107110015 ACTGAAATGGCCACTGAGGAGGG + Intronic
1032079425 7:128851259-128851281 ACTGACATGGCGGCTGTTGATGG - Exonic
1033641338 7:143265145-143265167 CCTGAAAACGTGCCTGGGGAAGG - Exonic
1034836855 7:154360369-154360391 ACTGAAATTGTTGCTGTGAAAGG - Intronic
1035932478 8:3797442-3797464 CCAGAAAAGTTGCCTGTGGAGGG - Intronic
1036645901 8:10611381-10611403 CCTGAATTGGGGCCTGGGGACGG + Exonic
1038032096 8:23651424-23651446 ACTGAAAGGAAGTCTGTGGATGG - Intergenic
1038992640 8:32885743-32885765 AGTAAAATGGTACATGTGGAAGG - Intergenic
1040012520 8:42674308-42674330 ACTCACATGGTGACTGGGGAAGG - Intergenic
1041407265 8:57513658-57513680 TCTGTAAGGTTGCCTGTGGATGG - Intergenic
1042414871 8:68507925-68507947 ATTGAAATGGTGCCTATTCAAGG - Intronic
1043231566 8:77808647-77808669 CCTCAAATGGTGCCTGCAGAAGG + Intergenic
1043332666 8:79137047-79137069 TCTGAAATGGTGTTTCTGGAAGG + Intergenic
1044244658 8:89928494-89928516 AGAGAAATGGTGTCTGGGGAAGG + Intergenic
1046524070 8:115361511-115361533 TCTGGAAAGGTGACTGTGGATGG - Intergenic
1049125502 8:140783428-140783450 AACAAAATGATGCCTGTGGATGG + Intronic
1050755202 9:8994000-8994022 ACTGAATTGGTACATGTGGAAGG + Intronic
1051102499 9:13537071-13537093 ACTGAAATGCTTTCTCTGGAGGG + Intergenic
1051318056 9:15864946-15864968 ACTGAAATGTTCCCTATGTACGG + Intronic
1051748232 9:20315989-20316011 AATGTAACTGTGCCTGTGGAGGG - Intergenic
1052510868 9:29418351-29418373 ATTGAAGAAGTGCCTGTGGATGG + Intergenic
1054462856 9:65474951-65474973 AATGAAAAGTTGCCTCTGGAGGG - Intergenic
1054944119 9:70776400-70776422 AGTGAAATGGTGCTAGTTGATGG - Intronic
1055404219 9:75957599-75957621 GCTGAAATGGTGACTGTAGTAGG + Intronic
1055641063 9:78319407-78319429 CCTGAGATGGTGCCTGGGAAAGG - Intronic
1056810848 9:89762788-89762810 CCAGAAATGGTACCAGTGGAGGG + Intergenic
1060209366 9:121700371-121700393 AGTGGAAAGGTGCCTGTGGCTGG - Intronic
1060792908 9:126497906-126497928 ACTGAAGTACTGCCTGGGGAGGG + Intronic
1061003901 9:127917412-127917434 TCTGAAATGGTGGTTGGGGAGGG + Intergenic
1186089075 X:6024700-6024722 GCTGTCATGGTGCTTGTGGAAGG - Intronic
1186249707 X:7652532-7652554 CCAGAGATGGTGCCTGTGGCTGG - Intergenic
1188308687 X:28589650-28589672 ATTGAAATGATGACTGTGAACGG + Intronic
1193191221 X:78573234-78573256 ACTCAGCTGATGCCTGTGGAGGG - Intergenic
1195134863 X:101894892-101894914 AGTGAGAAGGTGCCTGTGGGGGG + Intronic
1198054732 X:132982602-132982624 ACTGAAATGAAGCCTTTTGAAGG - Intergenic