ID: 1087291254

View in Genome Browser
Species Human (GRCh38)
Location 11:96322952-96322974
Sequence CAGATTCTCCAGGGGTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087291254 Original CRISPR CAGATTCTCCAGGGGTTCCA AGG (reversed) Intronic
900340841 1:2188379-2188401 GAGACTCTCCGGGGGCTCCAGGG - Intronic
900370184 1:2328815-2328837 CACATTCTCCGGGTGTTCCATGG - Intronic
900989605 1:6092290-6092312 CAGATCCTCCAGGGAGCCCAGGG + Intronic
901349063 1:8576194-8576216 CTTATTCTCCAGTGGTTCTAGGG + Intronic
901954946 1:12777313-12777335 CAGGTTCTCCAGGGCGGCCATGG - Exonic
901975199 1:12938912-12938934 CAGGTTCTCCAGGGTGGCCATGG + Exonic
901982802 1:13050045-13050067 CAGGTTCTCCAGGGTGGCCATGG + Intronic
901986220 1:13077293-13077315 CAGGTTCTCCAGGGTGGCCATGG - Exonic
901995592 1:13149474-13149496 CAGGTTCTCCAGGGTGGCCATGG + Intergenic
901999287 1:13178873-13178895 CAGGTTCTCCAGGGTGGCCATGG - Intergenic
902009976 1:13262852-13262874 CAGGTTCTCCAGGGTGGCCATGG - Exonic
903342052 1:22660800-22660822 CTGCTTTTCCAGGGCTTCCAGGG + Exonic
905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG + Exonic
905712635 1:40119532-40119554 CAGACTCTGTAGGGCTTCCAAGG - Intergenic
906610200 1:47196447-47196469 CAGACTGCCCAAGGGTTCCATGG + Intergenic
906665162 1:47616236-47616258 CAGATTCACCAAGGGTCTCAAGG + Intergenic
908459152 1:64332501-64332523 CACAAATTCCAGGGGTTCCATGG + Intergenic
908492894 1:64664022-64664044 CAGATTCTCCATGTGGCCCACGG - Intronic
911753448 1:101525236-101525258 CTGATTCTTCAGGGGCTCGAAGG + Intergenic
915570982 1:156744895-156744917 CAGAAACTCCAGGGCTTTCAGGG - Intronic
919062621 1:192652855-192652877 CTGATTCTCCAAGGGTTCTCAGG + Intronic
919560871 1:199116558-199116580 TAGTTTCTCCAGGGTTACCAAGG - Intergenic
919880211 1:201896028-201896050 CAGCTGCTCCAGGGGTGCCCTGG - Intergenic
919880214 1:201896037-201896059 CAGATTCTCCAGCTGCTCCAGGG - Intergenic
922461466 1:225817178-225817200 CTGAGTCTCCAGGGGTCCCTGGG + Intronic
923495954 1:234524999-234525021 TAGATTCTCAAAGGGATCCAGGG + Intergenic
1065612485 10:27485879-27485901 CTGATTTTCCTTGGGTTCCATGG + Intergenic
1067175818 10:43944735-43944757 CAGACACTCCTGGGGTGCCAGGG + Intergenic
1070856689 10:79612373-79612395 CACACTCTCCAGGGATACCAGGG - Exonic
1072788299 10:98299641-98299663 AAGATAATCCCGGGGTTCCAGGG - Intergenic
1073510380 10:104039102-104039124 CAGGTGATCCAGGTGTTCCAGGG - Exonic
1073800112 10:107032466-107032488 CAGAAACTCTAGGAGTTCCAGGG - Intronic
1074208122 10:111302120-111302142 CAGATTCACAAGGGGAGCCAGGG - Intergenic
1075323685 10:121512691-121512713 CACATTCACCAGTGGTTCCAAGG - Intronic
1075522961 10:123154879-123154901 CAGAGTCCCCAGGGGTCCCGCGG - Intronic
1079218030 11:18532418-18532440 CAGATACTCCATTGGTTCCAAGG + Exonic
1079260590 11:18875579-18875601 CAGCTTCTCCAGATGTTTCATGG - Intergenic
1079521925 11:21338522-21338544 CAGAGTTTCCAGGGTTTCCAGGG + Intronic
1083711573 11:64553011-64553033 CAGATTCTTCCAGGGTTTCAGGG + Intergenic
1085667317 11:78426272-78426294 CAACTTTTCCATGGGTTCCACGG - Intergenic
1085947042 11:81284688-81284710 CACATACCCCTGGGGTTCCAGGG + Intergenic
1087015787 11:93553321-93553343 CAGATTCTCAAAGGGGTCTATGG + Intergenic
1087199505 11:95331474-95331496 CAGAATCTACAGTAGTTCCAAGG + Intergenic
1087291254 11:96322952-96322974 CAGATTCTCCAGGGGTTCCAAGG - Intronic
1087518056 11:99191499-99191521 AAGATTCTCCAGGGGTTGTATGG - Intronic
1088727963 11:112656245-112656267 CAGATTCCCCAGGGTCTGCAAGG - Intergenic
1091334319 11:134755006-134755028 CAGATGCTCCATGGTTTCCGGGG - Intergenic
1091748524 12:3008423-3008445 CAGATCCTGCAGGGGTTTCCAGG + Intronic
1091906516 12:4193944-4193966 CAGCTTCTCCAGGTCCTCCACGG + Intergenic
1094069374 12:26396091-26396113 CAGATCCTTCAGGCTTTCCAAGG - Intronic
1095498576 12:42811796-42811818 CACATCCTCCAGGGGAACCAGGG - Intergenic
1095943428 12:47740512-47740534 CAGAGGCTCCAGGGGACCCAGGG + Intronic
1096591751 12:52664700-52664722 AAGATTCTCCTGAGGTTGCATGG - Intergenic
1102914198 12:116740614-116740636 CAGATTCCCCATGTGTTACATGG - Intronic
1103743770 12:123108536-123108558 CAGCTTCTCCAGGGGTCACTCGG - Intronic
1103833530 12:123799955-123799977 CAGATTTTCCAGTGTTTCAAGGG + Intronic
1104087291 12:125487570-125487592 GAGATCTTCCAGGGTTTCCATGG - Intronic
1104828418 12:131731277-131731299 CAGAATCTGCAGAGGTTCCAGGG + Intronic
1104954184 12:132456443-132456465 CTGAGTCCCCAGGGCTTCCACGG - Intergenic
1111482056 13:88842514-88842536 CAGATTTTCTAGGGGTTCAGGGG + Intergenic
1111877814 13:93918714-93918736 CAGATTCTCCAGATGTTCGCAGG - Intronic
1112369038 13:98778690-98778712 CTCATTCTCCAAGGATTCCAGGG - Intergenic
1112468748 13:99668895-99668917 CAGATTCACTAGGGGCTCCAGGG + Intronic
1114334254 14:21671571-21671593 CACATTTTCCAAGGCTTCCAGGG - Intergenic
1114397009 14:22373111-22373133 CAGATGCTCCACGGGTTCACTGG + Intergenic
1117052619 14:51876790-51876812 CAAATTCGCAAGGGGTTCTAGGG - Intronic
1119030434 14:71188111-71188133 CAGCTTCTCCAGAGGCTGCAGGG + Intergenic
1123778506 15:23603365-23603387 CATATCCTGCTGGGGTTCCAGGG - Intronic
1123965838 15:25456439-25456461 CAGATTCTCCAAAGCTTCAAAGG + Intergenic
1125800699 15:42444201-42444223 CAGATTCTACAGGGATTACAAGG - Exonic
1126537940 15:49787695-49787717 CAGATTCTACAGGGATTAAAAGG - Intergenic
1128271055 15:66310162-66310184 CAGATTCTGTAAGGGTTCCCAGG + Intronic
1129061619 15:72864842-72864864 CACATTCTCCACATGTTCCATGG - Intergenic
1131039687 15:89252357-89252379 CAGATTCTCCAGGGTTTTCCAGG - Intronic
1132466613 16:80313-80335 CTGGTTCTCCAGAGGCTCCAAGG + Intronic
1132777672 16:1604758-1604780 CAGACTCGCCAGAGGTTCCGGGG + Intronic
1133926592 16:10197817-10197839 CAGATTCTCTGTGGGGTCCAGGG - Intergenic
1134039096 16:11054136-11054158 AAGGTTCTCAAGGGGCTCCAAGG - Intronic
1135835180 16:25818998-25819020 CAGATTCTACAGGGCCTGCATGG + Intronic
1136063624 16:27743908-27743930 CAAAGCCTCCAGGAGTTCCAAGG + Intronic
1136236879 16:28919795-28919817 CTGCTTCTCCAGGGAGTCCAGGG + Exonic
1136557215 16:31014488-31014510 CTGGTTCTCCAGTGGCTCCACGG + Intergenic
1142113835 16:88346191-88346213 CCGATTCTCCAGTGGTTTCCAGG + Intergenic
1142984988 17:3690234-3690256 CAGAGGCTCCAGGGGACCCAAGG - Intronic
1144246614 17:13372532-13372554 CAGGATATCCAGGGGCTCCAGGG - Intergenic
1145983996 17:29032115-29032137 CAGCTTCTCCAGAGGTCCCTAGG + Intronic
1147055343 17:37829925-37829947 CAAATTCCCCAGGGGTCCTAGGG - Intergenic
1148907902 17:50922900-50922922 CAGAGTCTCCAGGGGCCCCCTGG - Intergenic
1150309681 17:64117808-64117830 AAAATTCTGCAGGGGTTGCAGGG - Intronic
1150347020 17:64412095-64412117 CGGATTCCCCAGGGGTTACGGGG - Intronic
1151674535 17:75590753-75590775 GAGAATCTCCAGGGGTGCCAGGG - Intergenic
1152614472 17:81331459-81331481 CAGGCTCTCCCGGGGGTCCAAGG - Intergenic
1152927787 17:83095532-83095554 CTCAGCCTCCAGGGGTTCCAGGG + Intergenic
1203162262 17_GL000205v2_random:63178-63200 GAGATTCTCCCTGGGTTCGAAGG + Intergenic
1159890925 18:73952513-73952535 CCCATTCTCCAGGGGTTTGAAGG - Intergenic
1160134702 18:76262373-76262395 CAGGCTCTCAAGGGGTTCCTGGG + Intergenic
1160802487 19:976823-976845 CAGAGTCTGTAGGGGGTCCATGG + Intergenic
1161280612 19:3443635-3443657 CAGAGTCTCTTGGGGGTCCATGG + Intronic
1161294888 19:3514568-3514590 CAGAGTCTCTTGGGGGTCCATGG - Intronic
1161340033 19:3736310-3736332 CAGATTCTGCAGGTGCTCCGGGG + Exonic
1161581239 19:5082210-5082232 CAGCGGCTCCAGGGGCTCCAGGG - Intronic
1162523855 19:11196732-11196754 CCCATTCCCCAGGGGTCCCATGG - Intronic
1163308209 19:16495951-16495973 CAGAGTCGCCACGGGGTCCACGG - Intronic
1168016984 19:53581755-53581777 CAGATTCTCCAGGGGTGGTGGGG + Intergenic
1168116036 19:54221835-54221857 CAGAATCTCCAGGGGGTCACTGG + Exonic
1168119018 19:54241583-54241605 CAGAATCTCCAGGGGGTCACTGG + Exonic
1168185526 19:54697485-54697507 CAGAATCTCCAGGGGGTCACTGG - Intronic
924968495 2:100873-100895 CAGATTCTCAAGGGGCTTCTGGG + Intergenic
925148420 2:1598646-1598668 CAGAACCTCCAGGTGTTCCCTGG + Intergenic
925284307 2:2705895-2705917 TGGATTATCCAGGGGGTCCAAGG + Intergenic
928342502 2:30456733-30456755 CATATTTTCCATGGGTCCCAAGG + Intronic
930866319 2:56125626-56125648 CAGAAGCCCCAGGGGTTCCAGGG + Intergenic
930946557 2:57083700-57083722 CAGAAACTTCAGGGGTTCAAAGG + Intergenic
931089858 2:58874107-58874129 GATATTCTCCAGGTGGTCCATGG + Intergenic
933169742 2:79111794-79111816 CAAGGTCTCCAGGGCTTCCAAGG + Intergenic
934052588 2:88223031-88223053 CAGACACAGCAGGGGTTCCATGG - Intergenic
937198835 2:120183634-120183656 CAGACTCTCTATGGCTTCCACGG + Intergenic
938985004 2:136566598-136566620 CAGATTCTGCAGGGGGACAATGG + Intergenic
939284265 2:140108909-140108931 CAAATTCTCCTGGGATTCCTTGG - Intergenic
939951931 2:148485864-148485886 CAGAATCTCCAGGCGTTCCAAGG + Exonic
941580232 2:167287997-167288019 CAAATTCTCCAGGTGTTCTAGGG - Intergenic
942216147 2:173720730-173720752 CAGAGACTCTAGGGGATCCATGG + Intergenic
943523644 2:188988604-188988626 CAGGTTCACCAGGGGGTCCTTGG - Exonic
946618451 2:221534612-221534634 CAAATTGACCATGGGTTCCAGGG - Intronic
1171091634 20:22290850-22290872 CAGGGTCTCCAGGTGCTCCAGGG - Intergenic
1172636879 20:36415944-36415966 CTGATTCCCCAGGGGTTGAAGGG + Intronic
1173595764 20:44257722-44257744 CAGATCTCCCAGGGGTTACAGGG + Intronic
1173653448 20:44682512-44682534 CAGATCCTCCAGGGGTCCCCAGG + Intergenic
1175655951 20:60771061-60771083 CAGAATCTCCAGGGGTGGCACGG + Intergenic
1178805326 21:35834522-35834544 CAGAGAGTTCAGGGGTTCCAGGG - Intronic
1179373808 21:40830922-40830944 CAGACTCTCCATGGGATCCCTGG + Intronic
1180091119 21:45534293-45534315 CGGAATCTGCAGGGGTTCCCTGG - Intronic
1180107511 21:45629784-45629806 CAATTTCTCCAGGGGTTCTCTGG + Intergenic
1181764922 22:25084526-25084548 CAGATTCTGCAGGGTGTGCAGGG + Intronic
1182574342 22:31262740-31262762 CAGATTCTCCTTGGTGTCCAGGG - Exonic
1183456852 22:37927577-37927599 CAGGGTTTCCAGGGGTACCAGGG - Exonic
1184886179 22:47345625-47345647 CAGGGGCTCCAGGGGTTCCTTGG + Intergenic
949918859 3:8985816-8985838 CGGGTTCTTCAGGGGCTCCAGGG + Exonic
950256489 3:11510836-11510858 CAAATTATCCAGGGGCACCAAGG - Intronic
950635107 3:14308678-14308700 CAGCTGCTCCAGGGGCTCCTGGG - Intergenic
950810542 3:15646261-15646283 CAGCTCATCCAGGGATTCCAGGG + Intergenic
951420593 3:22479612-22479634 CAGGTTCTCCTGGGTCTCCAGGG + Intergenic
951810561 3:26694456-26694478 TACATTTTCCAGGGGTTCTATGG - Intronic
953568577 3:44053763-44053785 GAGCTTCTCCAGGAGTGCCAGGG + Intergenic
954801674 3:53190606-53190628 CAGAATCTACAGGGCTACCAAGG + Intronic
955765626 3:62341302-62341324 CAGATTCTCCAGAGGAACCATGG + Intergenic
956567115 3:70651585-70651607 TAGATTTTCCAAGGGATCCATGG - Intergenic
957206006 3:77199308-77199330 CAGGTTCTCCTTGGTTTCCAAGG - Intronic
959087185 3:101863903-101863925 CAGAATCTCCAGGATTTTCAGGG + Intergenic
960075565 3:113481143-113481165 CTGATTTTCTAGGGGTTCCTAGG - Intronic
961424552 3:126834932-126834954 CAGACACACCAGGGCTTCCAGGG - Intronic
961864805 3:129945825-129945847 AAGCTTCTCCTGGGGTTGCAGGG + Intergenic
964077166 3:152705892-152705914 CAGACTCTCCAGGGTTAGCAAGG + Intergenic
967990583 3:195127329-195127351 CAGTTCCTCCAGGGGTGCCATGG + Intronic
968465843 4:750389-750411 CAGATTTTCCAGGGGTCCTGGGG + Intronic
968574447 4:1358590-1358612 CAGATACTGCAGTGGTGCCACGG - Intronic
968793968 4:2689777-2689799 CAGCTGCGCCAGGGCTTCCACGG - Intronic
973759705 4:54104532-54104554 AAGGTTCTCCAGGGTTCCCAGGG + Intronic
975434827 4:74339803-74339825 AGGTTTCTCCAGGGGTTCCCAGG + Intergenic
976357327 4:84133366-84133388 CAGATTTTGCAGGCCTTCCAAGG + Intergenic
978586253 4:110278981-110279003 CAGATCCTCTAGAGGTTCAAAGG + Intergenic
979532962 4:121788525-121788547 CAGTGTCTCCAGATGTTCCAGGG - Intergenic
981008173 4:139896974-139896996 CAGATTCTTGAGGTGTTCCATGG + Intronic
985748499 5:1661318-1661340 ACGATTCTTCAGGGGTGCCAAGG + Intergenic
986647529 5:9932330-9932352 CAGAGTCTCCAGGGGTGCAGAGG - Intergenic
987593015 5:19957175-19957197 CAGATTCTCCAGATGCCCCAGGG - Intronic
991356669 5:65775836-65775858 CAAATTCTCCAGGGATACAAAGG + Intronic
992845520 5:80743175-80743197 CTGCTTCTCCAGGGGTGTCAGGG + Intronic
997229821 5:132234220-132234242 CAGCTGCTGCAGTGGTTCCAGGG - Intronic
998598030 5:143554704-143554726 CAGATTCTTAAAGGGGTCCATGG + Intergenic
998671033 5:144354346-144354368 CAGATTCTCAAAGGAGTCCATGG - Intronic
999742367 5:154566051-154566073 CAGAGTCTGCAGGGGTTTGAAGG + Intergenic
1002324029 5:178393943-178393965 CTGATTTTCCAAGGGTGCCAAGG + Intronic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1002905218 6:1442965-1442987 CAGATTCTTCAGGGTGCCCAAGG + Intergenic
1003711153 6:8591819-8591841 CAGAGTCTCCAGGTGTTCTAAGG + Intergenic
1004364064 6:14997293-14997315 CATGTTCTCCAGGGGTTTCCTGG - Intergenic
1006295669 6:33168963-33168985 CACCTTCTCCAGGGGGGCCAGGG + Exonic
1007625924 6:43246473-43246495 CAGATGCTCCAGGAGTTACCAGG - Intronic
1009931355 6:70180328-70180350 CAGGGCCTCCAGGAGTTCCAGGG + Exonic
1011189233 6:84713044-84713066 CAGATCCTCCAGAGGTTCACAGG + Intronic
1011558262 6:88590880-88590902 CAGATACTTCAGGGGTTCTGAGG - Intergenic
1012905875 6:105065039-105065061 GGGATTCTCCAGGGATTCAACGG + Intronic
1013694170 6:112681757-112681779 CAGTTTATCCAGGAGTACCAAGG + Intergenic
1015557997 6:134482731-134482753 CAGTTTCCCCAGGGCTACCAGGG + Intergenic
1016353632 6:143194697-143194719 CAGGTTCTCCAGGGGTACTGGGG - Intronic
1018247866 6:161839581-161839603 CTGACTCTCCTGGGGTTCCAAGG - Intronic
1018919031 6:168158102-168158124 CAGTTTCTCCAGGTTTACCAAGG - Intergenic
1019127512 6:169850815-169850837 CACATTCTCCAGTGGTTGCAGGG - Intergenic
1019198469 6:170296006-170296028 CAGATGATCCGCGGGTTCCAGGG - Intronic
1021811313 7:24404266-24404288 CACATTCTCCAGGGGAACAAAGG + Intergenic
1023557669 7:41439964-41439986 CGCTTTCTCCAGGGATTCCAGGG - Intergenic
1023560660 7:41470251-41470273 CAGAGTCTCCAGGCCTGCCAGGG - Intergenic
1023602358 7:41892500-41892522 CAGGGTCTCCAGGGGTAACAGGG - Intergenic
1023852638 7:44158825-44158847 CAGCCTCTCGAGGGGTTCTAGGG - Intronic
1024063599 7:45716011-45716033 CAAAGTCTCCAGTGGGTCCATGG - Exonic
1024509466 7:50191918-50191940 CAAATTCGGCATGGGTTCCAGGG - Intergenic
1026808193 7:73441037-73441059 CAGGTTCTTGAGGAGTTCCAAGG + Exonic
1031573361 7:123386130-123386152 AATTTTCTCCAGGTGTTCCAGGG - Intergenic
1032089188 7:128902787-128902809 CAGATTCGGCAGGGGTCCCCAGG + Exonic
1032192520 7:129772929-129772951 CAGACACTCCAGAGGCTCCAGGG + Intergenic
1032252524 7:130270474-130270496 CAGATGCTGCAGGTGTGCCAGGG - Intronic
1032269772 7:130393914-130393936 CAGGTGCTCCAGGGCTTCCGAGG - Exonic
1036558803 8:9884188-9884210 CAGCTCCTCCAGGGTTCCCAGGG - Intergenic
1038790540 8:30664393-30664415 CAGAATCTCCAGTGCTTCCCTGG - Intergenic
1040798998 8:51320835-51320857 CAGATGTTAGAGGGGTTCCAAGG - Exonic
1044509608 8:93059324-93059346 CAGAGTCTCCAAGGGTTGCCTGG + Intergenic
1045760015 8:105594036-105594058 AGTATTCTCCAGGGGTTCCAGGG + Intronic
1046770514 8:118112216-118112238 CAGATTCTCCAGGGCGCCCGGGG - Intergenic
1047458691 8:125040860-125040882 CAGATTCCCAAAGGGGTCCAAGG - Intronic
1048562582 8:135557518-135557540 CAGATGTTCCAGTGGTTCGAGGG + Exonic
1049525190 8:143121841-143121863 GAGAGGATCCAGGGGTTCCAGGG - Intergenic
1049627921 8:143634563-143634585 GTGATTCTCCAGGGGCTCCCCGG - Intergenic
1049659510 8:143813487-143813509 CAGGTTCTCCCGGAGCTCCAGGG + Exonic
1049687635 8:143945270-143945292 CAGCCTCTCCTGGGGTCCCAGGG + Intronic
1049907931 9:236118-236140 CAGAGTCTCCAGTGGTACCTTGG - Intronic
1049985070 9:942707-942729 CAGATTTTCCAGAGGTTCGTTGG + Intronic
1050025988 9:1335137-1335159 CAGATTCTGCAGGGGCTGCTGGG - Intergenic
1050866756 9:10510276-10510298 CAGATTGTCGAGGGGGTACATGG - Intronic
1051716750 9:19992856-19992878 CAGATTGTCCTGCGGTTCCCAGG - Intergenic
1053333961 9:37246835-37246857 CACAGTATCCAGAGGTTCCAAGG - Intronic
1054950640 9:70847522-70847544 CAGATGCTCTAGGTCTTCCAGGG - Intronic
1055577859 9:77678032-77678054 CAGAATCTACATGGATTCCAGGG - Intergenic
1056187592 9:84150899-84150921 CAGTTTTTCCAGGGATTCCTGGG + Intergenic
1056365793 9:85903371-85903393 GAGTTTCTCCAGGGGTTCAAAGG - Intergenic
1056931140 9:90878566-90878588 CATATTCTCCTGGTGTTCAATGG - Intronic
1057796987 9:98164844-98164866 CGGATTGTGGAGGGGTTCCAGGG + Intronic
1058714988 9:107715557-107715579 CAAATTCTCCAGAGGCTGCAAGG + Intergenic
1061939863 9:133878165-133878187 CAGATGCTCCGGGTGTACCACGG + Intronic
1062357298 9:136170905-136170927 CAGGATCTGCAGGGGTCCCAGGG - Intergenic
1185918583 X:4063598-4063620 CACTCCCTCCAGGGGTTCCAGGG - Intergenic
1188683034 X:33035052-33035074 CAGATTCTAAAAGGGCTCCATGG + Intronic
1192598182 X:72433636-72433658 GAGATTCTCAAAGGGGTCCATGG + Intronic
1192633163 X:72792316-72792338 CAGAATCCCCAGGGCTCCCAAGG - Intronic
1192648546 X:72928485-72928507 CAGAATCCCCAGGGCTCCCAAGG + Intronic
1196157411 X:112446354-112446376 CACATTCTCAAGGGTCTCCAAGG + Intergenic
1199790584 X:151151815-151151837 CAAATTCTTCAGTGGTGCCAAGG + Intergenic
1201447990 Y:14079418-14079440 CACTCTCTCCAGAGGTTCCAGGG + Intergenic
1201472711 Y:14351693-14351715 GAGCTGCTGCAGGGGTTCCAGGG + Intergenic