ID: 1087291576

View in Genome Browser
Species Human (GRCh38)
Location 11:96326456-96326478
Sequence GATATAAAAGAAAGAAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4171
Summary {0: 1, 1: 0, 2: 24, 3: 484, 4: 3662}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087291576_1087291585 28 Left 1087291576 11:96326456-96326478 CCCTTCCTTCTTTCTTTTATATC 0: 1
1: 0
2: 24
3: 484
4: 3662
Right 1087291585 11:96326507-96326529 CGAGTTTAGGCTGGGTGCGGTGG 0: 1
1: 1
2: 99
3: 808
4: 4897
1087291576_1087291583 20 Left 1087291576 11:96326456-96326478 CCCTTCCTTCTTTCTTTTATATC 0: 1
1: 0
2: 24
3: 484
4: 3662
Right 1087291583 11:96326499-96326521 AACTATCTCGAGTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 61
1087291576_1087291584 25 Left 1087291576 11:96326456-96326478 CCCTTCCTTCTTTCTTTTATATC 0: 1
1: 0
2: 24
3: 484
4: 3662
Right 1087291584 11:96326504-96326526 TCTCGAGTTTAGGCTGGGTGCGG 0: 1
1: 0
2: 3
3: 39
4: 401
1087291576_1087291581 15 Left 1087291576 11:96326456-96326478 CCCTTCCTTCTTTCTTTTATATC 0: 1
1: 0
2: 24
3: 484
4: 3662
Right 1087291581 11:96326494-96326516 TTAAAAACTATCTCGAGTTTAGG 0: 1
1: 0
2: 0
3: 17
4: 184
1087291576_1087291582 19 Left 1087291576 11:96326456-96326478 CCCTTCCTTCTTTCTTTTATATC 0: 1
1: 0
2: 24
3: 484
4: 3662
Right 1087291582 11:96326498-96326520 AAACTATCTCGAGTTTAGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087291576 Original CRISPR GATATAAAAGAAAGAAGGAA GGG (reversed) Intronic