ID: 1087291579

View in Genome Browser
Species Human (GRCh38)
Location 11:96326478-96326500
Sequence TTTTTAAGACTTTCAGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 457}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087291579_1087291581 -7 Left 1087291579 11:96326478-96326500 CCCTTTGCTGAAAGTCTTAAAAA 0: 1
1: 0
2: 6
3: 42
4: 457
Right 1087291581 11:96326494-96326516 TTAAAAACTATCTCGAGTTTAGG 0: 1
1: 0
2: 0
3: 17
4: 184
1087291579_1087291584 3 Left 1087291579 11:96326478-96326500 CCCTTTGCTGAAAGTCTTAAAAA 0: 1
1: 0
2: 6
3: 42
4: 457
Right 1087291584 11:96326504-96326526 TCTCGAGTTTAGGCTGGGTGCGG 0: 1
1: 0
2: 3
3: 39
4: 401
1087291579_1087291582 -3 Left 1087291579 11:96326478-96326500 CCCTTTGCTGAAAGTCTTAAAAA 0: 1
1: 0
2: 6
3: 42
4: 457
Right 1087291582 11:96326498-96326520 AAACTATCTCGAGTTTAGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1087291579_1087291585 6 Left 1087291579 11:96326478-96326500 CCCTTTGCTGAAAGTCTTAAAAA 0: 1
1: 0
2: 6
3: 42
4: 457
Right 1087291585 11:96326507-96326529 CGAGTTTAGGCTGGGTGCGGTGG 0: 1
1: 1
2: 99
3: 808
4: 4897
1087291579_1087291583 -2 Left 1087291579 11:96326478-96326500 CCCTTTGCTGAAAGTCTTAAAAA 0: 1
1: 0
2: 6
3: 42
4: 457
Right 1087291583 11:96326499-96326521 AACTATCTCGAGTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087291579 Original CRISPR TTTTTAAGACTTTCAGCAAA GGG (reversed) Intronic