ID: 1087291583

View in Genome Browser
Species Human (GRCh38)
Location 11:96326499-96326521
Sequence AACTATCTCGAGTTTAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087291579_1087291583 -2 Left 1087291579 11:96326478-96326500 CCCTTTGCTGAAAGTCTTAAAAA 0: 1
1: 0
2: 6
3: 42
4: 457
Right 1087291583 11:96326499-96326521 AACTATCTCGAGTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 61
1087291580_1087291583 -3 Left 1087291580 11:96326479-96326501 CCTTTGCTGAAAGTCTTAAAAAC 0: 1
1: 0
2: 2
3: 28
4: 303
Right 1087291583 11:96326499-96326521 AACTATCTCGAGTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 61
1087291577_1087291583 19 Left 1087291577 11:96326457-96326479 CCTTCCTTCTTTCTTTTATATCC 0: 1
1: 1
2: 26
3: 403
4: 3098
Right 1087291583 11:96326499-96326521 AACTATCTCGAGTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 61
1087291578_1087291583 15 Left 1087291578 11:96326461-96326483 CCTTCTTTCTTTTATATCCCTTT 0: 1
1: 1
2: 9
3: 133
4: 1597
Right 1087291583 11:96326499-96326521 AACTATCTCGAGTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 61
1087291576_1087291583 20 Left 1087291576 11:96326456-96326478 CCCTTCCTTCTTTCTTTTATATC 0: 1
1: 0
2: 24
3: 484
4: 3662
Right 1087291583 11:96326499-96326521 AACTATCTCGAGTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087291583 Original CRISPR AACTATCTCGAGTTTAGGCT GGG Intronic
907645411 1:56237440-56237462 AACTATCTGGAGTTTCGGGGTGG + Intergenic
909408463 1:75320035-75320057 AATTATCTCTTCTTTAGGCTAGG - Intronic
910573431 1:88731575-88731597 AACTTTCTTGATTTTAGTCTTGG - Intronic
919239630 1:194895919-194895941 AAAAATCTCAATTTTAGGCTGGG - Intergenic
923314625 1:232767926-232767948 AAATAACTCTAGTCTAGGCTGGG + Intergenic
1069686649 10:70323209-70323231 CACTAGCTGGAGTTGAGGCTCGG + Intronic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1078487221 11:11734867-11734889 AATTAACTCGTGTTTAGGTTTGG - Intergenic
1087291583 11:96326499-96326521 AACTATCTCGAGTTTAGGCTGGG + Intronic
1088157230 11:106822011-106822033 AAATAACTAGAATTTAGGCTGGG + Intronic
1088890265 11:114038525-114038547 AACTATACCAACTTTAGGCTGGG + Intergenic
1089409460 11:118227690-118227712 AATTACCTCAAGTTTAGACTAGG + Exonic
1091137853 11:133208401-133208423 AACTCTCTGGAGTTTACTCTGGG + Intronic
1093391525 12:18629799-18629821 AAATATCTCGGGTTTATCCTAGG - Intronic
1100163525 12:91890359-91890381 AAGTATCTAGACTTTAGACTTGG + Intergenic
1103656891 12:122478044-122478066 AACAATCTGGAGTTAAGTCTAGG + Intronic
1108399814 13:50028685-50028707 AAATAACTTGAGTTAAGGCTTGG + Intergenic
1110915083 13:81011534-81011556 AGCCATCTCGAGTTTGGGGTGGG + Intergenic
1113237033 13:108288831-108288853 GAGTATCTGGAGGTTAGGCTAGG + Intronic
1113285862 13:108848494-108848516 AACTTTCTTGAGTTTAAGTTTGG - Intronic
1119353090 14:73982368-73982390 AAATATATCTATTTTAGGCTGGG - Intronic
1120463232 14:84823970-84823992 ATCTATCTCGAGTTTCAGTTAGG - Intergenic
1125974217 15:43936800-43936822 ATCTTTCTGGAGTTGAGGCTGGG - Intronic
1128661701 15:69506032-69506054 GACCATCTCAAGTTCAGGCTAGG - Intergenic
1130227273 15:82068862-82068884 AACAGCCTCAAGTTTAGGCTTGG - Intergenic
1134068547 16:11246147-11246169 AACTATCTCAGGTCTAGCCTGGG - Intergenic
1137418437 16:48308334-48308356 AATCAACTCGAGGTTAGGCTAGG + Intronic
1144125653 17:12200321-12200343 AGCTGTCTGGAGTTCAGGCTGGG + Intergenic
1146369310 17:32255190-32255212 CAAAATCTCTAGTTTAGGCTGGG + Intergenic
1160380189 18:78448623-78448645 AACTTTCTCGACTTTAGAATGGG - Intergenic
1167026292 19:46921455-46921477 AAAGATCTCAAGTTTATGCTGGG - Exonic
931969852 2:67573938-67573960 AACTGTCTCTAGTTTTGGCCTGG + Intergenic
934539785 2:95164279-95164301 AACTATCTTGAGGTAAGGCCAGG - Intronic
936383145 2:112005365-112005387 AACTATATAGATTTTAAGCTGGG - Intronic
938426370 2:131193279-131193301 AACTGTCTTCATTTTAGGCTTGG - Intronic
945094719 2:206208243-206208265 AACTATGTTATGTTTAGGCTGGG + Intronic
1174137719 20:48392360-48392382 AACTTTCTCAAGTTGAGACTGGG + Intergenic
1181571451 22:23769756-23769778 AACTCTCTGCAGTTTAGGCCCGG - Intronic
957189826 3:76993111-76993133 AACTTTCGAGATTTTAGGCTGGG - Intronic
968568455 4:1327172-1327194 AACTATCCCGAATGTAGACTGGG - Intronic
981260743 4:142715773-142715795 AACCATCTGCATTTTAGGCTGGG + Intronic
991950882 5:71945896-71945918 GACTGTCTGGAGATTAGGCTTGG + Intergenic
995086168 5:108112285-108112307 AAATATCTGGAGCTTAGGCCTGG + Intronic
998534560 5:142917332-142917354 AAATATCTGAAGTTTAGGCCAGG - Intronic
1002447892 5:179301247-179301269 AAAGATCTCAAGTTTCGGCTGGG - Intronic
1012651221 6:101755526-101755548 AACTCTCTAGAGTCTAGACTAGG - Intronic
1016418811 6:143862284-143862306 AAGTATATCAACTTTAGGCTGGG + Intronic
1022809194 7:33852175-33852197 AGCAATCTCTAGATTAGGCTGGG + Intergenic
1035796320 8:2360488-2360510 AAAGATCTGAAGTTTAGGCTGGG - Intergenic
1038611118 8:29060947-29060969 GACTCTCACGAGTTTACGCTGGG - Intronic
1039320069 8:36419769-36419791 TACTATCAAGAGTTTAGGCCGGG + Intergenic
1043269823 8:78318325-78318347 AATTATCTTCAGTTTGGGCTGGG - Intergenic
1043603980 8:81976901-81976923 AACTATCTCCAGTTTAAGGAAGG - Intergenic
1044138576 8:88618964-88618986 AAAAATTTTGAGTTTAGGCTGGG - Intergenic
1046010921 8:108546104-108546126 AATTATTTCGTGTTTAGACTCGG - Intergenic
1051939101 9:22483296-22483318 AAATATTTTGAGTTTAGACTTGG + Intergenic
1061839541 9:133349882-133349904 AACACTCTTCAGTTTAGGCTTGG - Intronic
1185985993 X:4834407-4834429 AACTTTTTCTAGCTTAGGCTTGG - Intergenic
1186570191 X:10706814-10706836 AACTATCTCTAGTTTAGAAAAGG + Intronic
1186646933 X:11517242-11517264 AAATATCTTAAGCTTAGGCTAGG + Intronic
1194666040 X:96678603-96678625 AACTTTATCTAGTTTAAGCTGGG + Intergenic
1195388131 X:104332918-104332940 AACAATCTGGAGCTCAGGCTGGG + Intergenic