ID: 1087291583

View in Genome Browser
Species Human (GRCh38)
Location 11:96326499-96326521
Sequence AACTATCTCGAGTTTAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087291576_1087291583 20 Left 1087291576 11:96326456-96326478 CCCTTCCTTCTTTCTTTTATATC 0: 1
1: 0
2: 24
3: 484
4: 3662
Right 1087291583 11:96326499-96326521 AACTATCTCGAGTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 61
1087291578_1087291583 15 Left 1087291578 11:96326461-96326483 CCTTCTTTCTTTTATATCCCTTT 0: 1
1: 1
2: 9
3: 133
4: 1597
Right 1087291583 11:96326499-96326521 AACTATCTCGAGTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 61
1087291577_1087291583 19 Left 1087291577 11:96326457-96326479 CCTTCCTTCTTTCTTTTATATCC 0: 1
1: 1
2: 26
3: 403
4: 3098
Right 1087291583 11:96326499-96326521 AACTATCTCGAGTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 61
1087291580_1087291583 -3 Left 1087291580 11:96326479-96326501 CCTTTGCTGAAAGTCTTAAAAAC 0: 1
1: 0
2: 2
3: 28
4: 303
Right 1087291583 11:96326499-96326521 AACTATCTCGAGTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 61
1087291579_1087291583 -2 Left 1087291579 11:96326478-96326500 CCCTTTGCTGAAAGTCTTAAAAA 0: 1
1: 0
2: 6
3: 42
4: 457
Right 1087291583 11:96326499-96326521 AACTATCTCGAGTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087291583 Original CRISPR AACTATCTCGAGTTTAGGCT GGG Intronic