ID: 1087292747

View in Genome Browser
Species Human (GRCh38)
Location 11:96338374-96338396
Sequence ATGAAGAAACTGGCTGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 695
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 636}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087292744_1087292747 0 Left 1087292744 11:96338351-96338373 CCCTGAACTTGTACTTGAGCTAA 0: 1
1: 0
2: 1
3: 7
4: 135
Right 1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG 0: 1
1: 0
2: 5
3: 53
4: 636
1087292745_1087292747 -1 Left 1087292745 11:96338352-96338374 CCTGAACTTGTACTTGAGCTAAA 0: 1
1: 0
2: 2
3: 9
4: 133
Right 1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG 0: 1
1: 0
2: 5
3: 53
4: 636
1087292743_1087292747 1 Left 1087292743 11:96338350-96338372 CCCCTGAACTTGTACTTGAGCTA 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG 0: 1
1: 0
2: 5
3: 53
4: 636
1087292740_1087292747 28 Left 1087292740 11:96338323-96338345 CCTGCAGACTCTGCAGCAGCGGG 0: 1
1: 0
2: 4
3: 24
4: 311
Right 1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG 0: 1
1: 0
2: 5
3: 53
4: 636

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087292747 Original CRISPR ATGAAGAAACTGGCTGAGTA AGG Intronic
901095070 1:6671988-6672010 ATAAAAAAACTGGCTGGGTATGG - Intronic
901819208 1:11815683-11815705 ATGCAGAATCTGGCTGGGTGCGG - Intronic
902156071 1:14487539-14487561 ATGAAGAAATTAGCTAAGTAGGG + Intergenic
902229628 1:15019677-15019699 ATGAAGAAACTGGCTGGGCTTGG - Intronic
902357589 1:15916834-15916856 ATGAAGCAGCAGGCTGAGCATGG + Intronic
903024395 1:20417150-20417172 ATGAAGAAGCAGGCTGAGAGAGG - Intergenic
903401416 1:23053539-23053561 ATATAAAAACTGGCTGGGTATGG - Intronic
903984407 1:27215270-27215292 ACAAAAAAATTGGCTGAGTATGG + Intergenic
904202454 1:28829863-28829885 ATTAAAAAATTAGCTGAGTATGG - Intronic
904229322 1:29054692-29054714 ATAAAAAAACTAGCTGGGTATGG + Intronic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
904518011 1:31071937-31071959 ATGAGAAAACTGGCTGGGCATGG + Intergenic
905236149 1:36550685-36550707 AAAAATAAACTGGCTGGGTATGG + Intergenic
905407005 1:37740593-37740615 ATAAAGCAACTGGCTGGGCACGG - Intronic
905553755 1:38865510-38865532 AAGAAAAAACTGGCTGGGTGAGG + Intronic
905738865 1:40351926-40351948 CTTAAGAATCTGGCTGGGTACGG - Intronic
906619492 1:47263906-47263928 ATACAGAAACTAGCTGAGCATGG - Intronic
906674216 1:47681517-47681539 ATGAGGAAACTGGCTCAGAAAGG - Intergenic
906689639 1:47784130-47784152 ATGAGGAAACAGGCTCAGTGAGG + Intronic
906808830 1:48805789-48805811 ATGAGGAAACAGGCTGAGAGAGG - Intronic
907747369 1:57226711-57226733 GTGAGGAAACAGGCTGAGAAAGG + Intronic
907789326 1:57646591-57646613 ATGAAAAAATTAGCTGGGTATGG + Intronic
907844124 1:58188197-58188219 ATGCAAAAACTGGCTGAGTATGG - Intronic
908225742 1:62054205-62054227 AAGAAGAAATTAGCTGAGTGTGG + Intronic
908273896 1:62449172-62449194 ATAAAGAAACTGGCCGGGCATGG - Intronic
909104200 1:71388839-71388861 ATAAAAAAACTGGGTGCGTAAGG + Intergenic
909286560 1:73827115-73827137 AAAAAGAAACTGGCTGGGCACGG + Intergenic
909338855 1:74509068-74509090 AAGAAGAAAGTGTCTGAATAAGG - Intronic
909738571 1:78998654-78998676 TTTAAGAAACTGGCTGGGTGCGG - Intronic
909763027 1:79317197-79317219 ACAAAGAAACTGGCTTAGCAAGG + Intergenic
910262132 1:85303069-85303091 ATGAAGAAACTGGCCAAGCAGGG + Intergenic
910284543 1:85539300-85539322 ATACAGAAATTAGCTGAGTATGG - Intronic
910509996 1:87992786-87992808 ATACAGAAATTGGCTGGGTACGG + Intergenic
910881046 1:91922648-91922670 ATGAAAAAATTAGCTGAGCATGG - Intergenic
912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG + Intronic
912491300 1:110064225-110064247 ATGATGGGACTGGCTGCGTAGGG - Intronic
912772484 1:112477347-112477369 ATGAAGATGCTGTCTGAGTTGGG - Intronic
913445131 1:118943059-118943081 ATGAAGAAATTGGCTCAGAAAGG - Intronic
914205478 1:145523408-145523430 ATACAGAAATTAGCTGAGTATGG + Intergenic
914447147 1:147759727-147759749 ATGAAGAAACAGACTCAGTGAGG - Intronic
914937844 1:151995392-151995414 ATGAAGAAATCAGATGAGTAGGG - Intergenic
915614755 1:157028874-157028896 ATGGAGAAACTGGCTGGGCGTGG + Intronic
917106861 1:171501052-171501074 ATAAATAAACTAGCTGGGTATGG - Intronic
917363164 1:174199445-174199467 ATACAGAAATTGGCTGAGTGTGG - Intronic
917408172 1:174731260-174731282 ATCAAGATACTGGCTGGGTGCGG - Intronic
917470308 1:175320982-175321004 ATGAAGAAACTGGCCCAGAGAGG + Exonic
918038078 1:180894775-180894797 CTGAAGAAACTGGATGGGTTAGG + Intergenic
918063835 1:181086079-181086101 ATGAAGAAACTGGCAGGGCATGG - Intergenic
918341068 1:183568320-183568342 ATGAAAAAATTAGCTGAGTGTGG - Intronic
918346571 1:183612633-183612655 ACGAAGAAACAGGCTCAGAAAGG + Intergenic
918627809 1:186678666-186678688 ATGAAAGGAATGGCTGAGTATGG + Intronic
919561876 1:199131332-199131354 ATGAAGAAACATGCTCAGTGAGG + Intergenic
919629848 1:199949766-199949788 ATGAAAAAATTAGCTGGGTACGG + Intergenic
919961641 1:202476046-202476068 ATGCAAAAACTAGCTGAGTGTGG + Intronic
920157086 1:203962107-203962129 ATAAATAAATTAGCTGAGTATGG + Intergenic
920360760 1:205414578-205414600 ATAAAAAAACTGGCTGGGTGTGG - Intronic
920954554 1:210606148-210606170 ATGAAGAAATAGGCTGGGTGTGG - Intronic
921292947 1:213675719-213675741 ATGCAAAAATTAGCTGAGTATGG + Intergenic
922519743 1:226238873-226238895 ATGAAGATATTGGCTTGGTATGG + Intronic
922740376 1:228011001-228011023 GTGCAGACACTGGCTGAGCAGGG - Intronic
922862177 1:228828672-228828694 AAGAGGAAACTGGCTGGGTGTGG + Intergenic
923008430 1:230069868-230069890 GTGCAGAAACTGGCTAAATATGG - Intronic
923093189 1:230754872-230754894 ATGGAGAAGCTGGGTGGGTAGGG + Intronic
923249507 1:232166987-232167009 AGGAAGAAACTGGCAAGGTAAGG + Intergenic
923296584 1:232600495-232600517 ATGAGGAAACTGGGTTACTAGGG + Intergenic
923366657 1:233268336-233268358 ATAAAAAATCTGGCTGAGTGAGG + Intronic
923610506 1:235488391-235488413 ATGATGAAATAGGCTGGGTATGG + Intronic
923982804 1:239344395-239344417 ATGAATAAACTGACTGACTTAGG + Intergenic
1062776982 10:159170-159192 AATAAGGAACTGGCTGAATACGG - Intronic
1063630620 10:7730528-7730550 ATTAAGATACAGGCTGAGTGTGG + Intronic
1064420456 10:15186297-15186319 AGAAAGAAACTGGCTGGGCATGG - Intergenic
1064893354 10:20205806-20205828 ATGAGGAAACAGGCTTAGAAAGG + Intronic
1065784030 10:29196441-29196463 TTGGAGAAAGTGGCTGAGAAGGG - Intergenic
1066192226 10:33066582-33066604 ATGTAGAAAGTGGCTGGGTGTGG - Intergenic
1066297442 10:34067247-34067269 ATGAGGAAGTGGGCTGAGTAGGG - Intergenic
1067122784 10:43488965-43488987 ATGAAAAAATTAGCTGGGTATGG + Intergenic
1067144474 10:43684419-43684441 CATAAGAAATTGGCTGAGTATGG - Intergenic
1068029823 10:51692629-51692651 ATGTAAAAATTAGCTGAGTATGG - Intronic
1068092577 10:52450730-52450752 AAGAAGAAAGTTACTGAGTATGG - Intergenic
1068759247 10:60689459-60689481 ATGAATGAACTGGCTGGGTGCGG + Intronic
1068826429 10:61445229-61445251 ATTAAGAGACTGTCTGAGAATGG + Intronic
1068886004 10:62097852-62097874 CTAAAGTGACTGGCTGAGTATGG + Intergenic
1070261490 10:74860475-74860497 ATGAAGAAACAGGCCAAATAAGG + Intronic
1070297336 10:75173901-75173923 ATGAGGAAACTGGCTTAGAGAGG - Intronic
1070686610 10:78489412-78489434 ATCAAGATATTGGCAGAGTAGGG + Intergenic
1071120373 10:82269911-82269933 ATGAAGCACATGGCTGAGTTAGG - Intronic
1071745205 10:88410719-88410741 ATGAAGAAACTCACTGACTTGGG - Intronic
1071745347 10:88412371-88412393 ATGAAGAAACTCACTGACTTGGG + Intronic
1072143732 10:92614508-92614530 ATTAAGAAACTGGCTTTTTAAGG - Intronic
1072271660 10:93783023-93783045 ACCTTGAAACTGGCTGAGTAAGG - Intronic
1072349993 10:94547317-94547339 ATGAAGAAACTGAGGGAGAAGGG + Intronic
1072576383 10:96704425-96704447 ATGCAGAATCTGGCTGGGTGCGG + Intronic
1073082300 10:100867929-100867951 ATGAGGAAACGGGCTCAGTGAGG + Intergenic
1073134091 10:101210277-101210299 ATGAGGAAACTGGCTTAGCGAGG + Intergenic
1073359916 10:102889966-102889988 AAAATGAAACTGGCTGTGTACGG - Intronic
1075010982 10:118869928-118869950 ATATAGAAATTGGCTGAGCATGG + Intergenic
1075601177 10:123770613-123770635 AAGAAGAAAGTGGCTGAGGTGGG - Intronic
1076311510 10:129511083-129511105 ATGAAGCACGTGGCTGAGTCTGG - Intronic
1076825724 10:132966946-132966968 ATAAAAAAACTAGCTGAGTGTGG - Intergenic
1077633942 11:3829168-3829190 GTTAAGAAACCTGCTGAGTAAGG + Intronic
1077790335 11:5432362-5432384 ATCTAGTAACTGGCTGAGTATGG - Intronic
1078089790 11:8257802-8257824 ATAAATAAACTGGCAGAGTGAGG + Intronic
1078992434 11:16663476-16663498 ATGCAAAAATTAGCTGAGTATGG - Intronic
1079071992 11:17355239-17355261 ATGAAAAAATTAGCTGAGCATGG + Intronic
1079940381 11:26672942-26672964 ATCTAAAAACTGGATGAGTAAGG - Intronic
1080461868 11:32461655-32461677 ATGTAGTAACTGGCTGGGCATGG + Intergenic
1080561055 11:33463117-33463139 AAGAAAAAGCTGGCTGAGCATGG - Intergenic
1081248442 11:40798797-40798819 ATGCAAAAACTAGCTGAGTATGG - Intronic
1081592641 11:44435495-44435517 AAGAAGATACTGGCTGGGCACGG - Intergenic
1081903087 11:46646617-46646639 ATAAAGAAACTAGCTGGGCATGG - Intronic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083705688 11:64512736-64512758 ATTAAAAAATTGGCTGGGTATGG + Intergenic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084141938 11:67237789-67237811 ATTAAGAAATTAGCTGAGCATGG + Intronic
1084285110 11:68126011-68126033 ATGAGGAAAGTGGCTTAGAAAGG - Intergenic
1084912354 11:72401037-72401059 ATGAAGAAACAGGCTGTCCATGG + Intronic
1084996230 11:72981823-72981845 ATTAAGAAATTAGCTGGGTATGG + Intronic
1085017987 11:73187931-73187953 ATGCAGATCCTGGCTGAGTGTGG - Intergenic
1085279681 11:75321656-75321678 ATGAAGAAACAAGTTGAGTGAGG - Intronic
1085362849 11:75907667-75907689 ATAAAGAAATTGGCTGGGCATGG - Intronic
1085363302 11:75912673-75912695 ATGAACAATCTGTCTGAGTAGGG - Intronic
1085436609 11:76510062-76510084 ATTAATAAACTGGCTGTGTTTGG + Intronic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1086122153 11:83315463-83315485 AAAAAAAAACTGGCTGAGTATGG - Intergenic
1087020041 11:93592868-93592890 ATGAAAACACTAGCTGGGTATGG + Intergenic
1087050750 11:93884150-93884172 ATGAAGGGGCTGGCTGGGTATGG + Intergenic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087854595 11:103076585-103076607 ATGAGGAAACAGGCTGAAAACGG - Intronic
1088260148 11:107936053-107936075 ATACAAAAACTAGCTGAGTATGG - Intronic
1088864874 11:113838145-113838167 ATGGAGAAGATAGCTGAGTAAGG - Intronic
1089247888 11:117135923-117135945 ATGAGGAAACTGGCTGGGTGTGG + Intergenic
1089258825 11:117208638-117208660 ATGAGGAAACTGGCTGGGTGTGG - Intronic
1089445839 11:118551516-118551538 ATTAAAAAAATGGCTGAGTGTGG + Intronic
1090123102 11:124053991-124054013 AAGAAAAAACTAGCTGAGTGTGG - Intergenic
1090399419 11:126439524-126439546 ATGCAGATACTGGCTGGGCATGG + Intronic
1090694365 11:129222830-129222852 ATGCAGATTCTGACTGAGTATGG + Intronic
1091064123 11:132492555-132492577 AGGAAGAAACAGGTTGAGAAGGG + Intronic
1091258170 11:134209898-134209920 ATGCAAAAATTGGCTGAGTGTGG + Intronic
1092609390 12:10155314-10155336 ATGCAAAAATTTGCTGAGTATGG + Intergenic
1094600400 12:31903964-31903986 AAGAAGAAACAAGCTGGGTATGG - Intergenic
1095817273 12:46438305-46438327 ATGAGGAAACTGGCTCAGAGAGG + Intergenic
1096055080 12:48643923-48643945 ATACACAAACTGGCTGGGTATGG - Intergenic
1096221543 12:49832079-49832101 ATGAAAAAATTAGCTGGGTATGG - Intergenic
1096382234 12:51168638-51168660 ATAAAAAAATTAGCTGAGTATGG - Intronic
1097342709 12:58457073-58457095 ATGAAAAATCTGGCAGAGTGTGG + Intergenic
1097363713 12:58687081-58687103 AAGATCAAACTGGCTGTGTATGG - Intronic
1098099493 12:66999067-66999089 ATGAAGAAAATGTCTGAATGTGG - Intergenic
1099266816 12:80457359-80457381 ATGAGAAAACTGGCTGAGAGAGG - Intronic
1099602315 12:84756749-84756771 ATGAGGAAACTGGATGATGATGG - Intergenic
1099755124 12:86836368-86836390 ATTAATAAACTGGCTGATTTAGG + Intronic
1099804210 12:87497544-87497566 ATTTAAAAACTGGCTGAGCATGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100198848 12:92277350-92277372 ATTAAAAAACTAGCTGAGCATGG + Intergenic
1100470693 12:94890244-94890266 ATGCAGAAACCGGCTGGGTGTGG + Intergenic
1100882492 12:99034469-99034491 ATGCAAAAACTAGCTGAGCATGG - Intronic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101802243 12:108032659-108032681 ATGAAAAAATTAGCTGAGTATGG - Intergenic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101905397 12:108821087-108821109 ACGAAGAATCTGGCTGAGTATGG + Intronic
1101915803 12:108894869-108894891 ATAAAAAAATTGGCTGAGCATGG - Intronic
1101918454 12:108913939-108913961 ATGAAGAAATGGGCTGGGCATGG - Intronic
1102052091 12:109870032-109870054 ATGAGGAAACTTGCCGAGTGCGG - Intronic
1102302968 12:111784156-111784178 GTTAAAAAACTAGCTGAGTATGG + Intronic
1103096723 12:118137975-118137997 CTGAAGAAACTGGCTGGGTGTGG - Intronic
1103208474 12:119149190-119149212 ATGCAAAAACTAGCTGAGTGTGG + Intronic
1103374975 12:120448482-120448504 ATGCAAAAACTAGCTGAGTGTGG - Intronic
1103569521 12:121835527-121835549 ATAAAAAAACTAGCTGGGTATGG - Intergenic
1103731290 12:123029296-123029318 ATAAAGAAACTGGCTGTGCATGG + Intronic
1103996812 12:124835413-124835435 ATGAAAAAATTAGCTGAGTATGG - Intronic
1104359075 12:128115133-128115155 ATGAAGAAATGGGCTGGGTGTGG - Intergenic
1105283242 13:18982211-18982233 AGGAAGAAATTGGCTGGGTGGGG - Intergenic
1105311944 13:19219927-19219949 ATGAAGAAACGTGCTCAGAAAGG - Intergenic
1105506722 13:21016568-21016590 AGGAATGAACTGGCTGAGCATGG - Intronic
1105932817 13:25068576-25068598 TTGAAAAAAATGGCAGAGTATGG + Intergenic
1106301246 13:28468156-28468178 ATGAGGAAACTGGTTCAGAAAGG - Intronic
1106313113 13:28570934-28570956 ATAAAGAATCTGGCTGGGCACGG - Intergenic
1106643922 13:31613066-31613088 ATGAAACAAAAGGCTGAGTAAGG - Intergenic
1106720989 13:32434386-32434408 ATGAAAAAACTGGCCGGGCACGG - Intronic
1107408217 13:40135110-40135132 AAGAAAAAATTAGCTGAGTATGG + Intergenic
1107895186 13:44955007-44955029 AGGAAGAAAGTGGGTCAGTAAGG - Intronic
1108393899 13:49974432-49974454 ATGGAGAAACAGGCCGGGTACGG - Intergenic
1109066230 13:57696229-57696251 ATGAAAATACTGGCTAACTAAGG + Intronic
1109447772 13:62466709-62466731 ATGAAGAAATCGGCTGGGTAAGG + Intergenic
1109762688 13:66850361-66850383 ATGCAGAAACTAGCTGGGCATGG + Intronic
1109990419 13:70047600-70047622 ATGAAAATACTGGCTTAGAAAGG - Intronic
1110370726 13:74737385-74737407 GTCAAGAAGCTGGCTGAGTGGGG + Intergenic
1110815393 13:79855130-79855152 ATGAAGACACCGGAAGAGTAAGG - Intergenic
1111941020 13:94606933-94606955 ATGAGCAAACTGGCAGAGAAAGG - Intronic
1112008945 13:95277955-95277977 ATGAAGAAACTAGCTCAGATTGG + Intronic
1112034205 13:95482684-95482706 ATGAATAAACTGGCTGGGCGCGG + Intronic
1112313676 13:98342406-98342428 ATAAACAAACTGGCTGGGTACGG + Intronic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1113126697 13:106987194-106987216 TGGAACAAGCTGGCTGAGTAAGG + Intergenic
1114508978 14:23240953-23240975 ATGAAGAGACTGGCTCAGAGAGG + Intronic
1115669393 14:35592071-35592093 ATAAAGAAACTGCCTGAGACTGG - Intronic
1116919268 14:50555572-50555594 ATGAAGGAACTGGCTGGCCACGG - Intronic
1117265329 14:54080390-54080412 ATGAAACAACCGGCTGGGTACGG - Intergenic
1117456443 14:55901948-55901970 ATGAAGAAACTGGGAGAAGAGGG + Intergenic
1118594182 14:67423359-67423381 ATGAAGAAGCTGGCTGTGGAGGG - Intergenic
1118621514 14:67618669-67618691 AAGAAGAAACTGGCTGCACATGG - Intergenic
1118850297 14:69577914-69577936 ATGTAGAAATTGGCTGGGCACGG + Intergenic
1119044179 14:71302927-71302949 ATAAAGAAACTGGCCAGGTATGG - Intergenic
1119089062 14:71763419-71763441 AAGAGGAAACTGGCTGTGCAGGG - Intergenic
1119386625 14:74261410-74261432 AGGAAGGAACAGGCTGAGTTGGG - Exonic
1119455397 14:74751187-74751209 AGAAAGAAACTGGCTGAGACAGG + Intergenic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119790453 14:77345275-77345297 ATGAGGAAACTGGCTGGGCCCGG - Intronic
1119792793 14:77367982-77368004 GTGAACAAACTGGCTGGGTGCGG - Intronic
1120218105 14:81702539-81702561 GTTAAGAAACTGGAAGAGTAAGG + Intergenic
1120648167 14:87098083-87098105 ATGAAATTACAGGCTGAGTAAGG - Intergenic
1120919638 14:89743117-89743139 ATTAAGAATCTGGCTGGGTTTGG - Intergenic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121615646 14:95311809-95311831 ATGAAGAAGGTGGCAGAGGATGG - Intronic
1121904542 14:97727656-97727678 ATGATGGAATGGGCTGAGTATGG + Intergenic
1121973253 14:98378744-98378766 AGGAAGAAACTGGATGAATTAGG + Intergenic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1122806033 14:104257677-104257699 ATGAGGAAACTACCTGAGTTGGG + Intergenic
1123710653 15:22984719-22984741 AAAAAGTAACTGGCTGTGTATGG + Intronic
1123714810 15:23019986-23020008 ATGAGGAAATTGGCTGGGCATGG + Intronic
1123990771 15:25681761-25681783 AAGATGAAACTGGCTGGGTGCGG + Intronic
1124379737 15:29155467-29155489 ATGAAGAAACGACCTGAGTCTGG - Intronic
1124681804 15:31738345-31738367 GTGAAGAATTTGGCTGAGGATGG + Intronic
1125049941 15:35284963-35284985 ATGAAAAAATTAGCTGAGCATGG - Intronic
1125676617 15:41505518-41505540 ATGGCGAAACTTGCTGAGTGGGG + Exonic
1125740981 15:41964445-41964467 ATGAATAAATTGGCTGGGTGTGG + Intronic
1125881834 15:43202055-43202077 ATGAGGAAACTTACTGAGGAGGG - Intronic
1125952148 15:43761275-43761297 AGGAGGAAACTGGGTGACTAGGG + Intronic
1126407619 15:48337433-48337455 ATGAGGAAACAGGCTCAGAAAGG - Intronic
1126499714 15:49332029-49332051 ATGAGGAAACAGGCTGAGATAGG + Intronic
1126731002 15:51682129-51682151 ATGAATAGACTGTCTGAGAAAGG - Intronic
1126771600 15:52062315-52062337 ATTCAAATACTGGCTGAGTACGG - Intronic
1126820403 15:52497464-52497486 AAGAAGAAATTGGCTGGGTGCGG + Intronic
1126992091 15:54389882-54389904 ATGCAGAAACTAGCTGGGCATGG - Intronic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127828977 15:62733104-62733126 CTGAAGAACCTGGCTGGTTAGGG + Intronic
1127836274 15:62793621-62793643 ATGAAGAAACATTCAGAGTATGG - Intronic
1128465133 15:67904241-67904263 ATGCAGAAATTGGCTGGGCATGG - Intergenic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1128655702 15:69460280-69460302 ATAAAGAAACTGGCCGGGCATGG - Intergenic
1129083564 15:73064618-73064640 ATTAAGAAACTAGCTGGGCATGG - Intronic
1129127366 15:73454282-73454304 ATGAAGAAACATGATGACTAAGG + Intronic
1130551894 15:84894796-84894818 ATGAGGAAACAGGCTCAGTGAGG + Intronic
1130660027 15:85824059-85824081 ATGAAGAAACAGGCTGATGGAGG + Intergenic
1130983664 15:88830286-88830308 ATAAAGAAACGGGCTGGGGAAGG - Intronic
1131045785 15:89314354-89314376 ATCTAGAAAATGGCTGAGGAGGG - Intronic
1131371994 15:91890285-91890307 AAGATGAAAATGGATGAGTATGG - Intronic
1131477535 15:92753034-92753056 ATGAAGAATCTTGCTGGGCATGG + Intronic
1131815925 15:96221261-96221283 ATGGAGAGACTGGATGAGTGAGG - Intergenic
1131964954 15:97832190-97832212 ATGAAGAAACTGGGAGAGTGGGG + Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133781544 16:8942701-8942723 ATACAGAAACTAGCTGAGTGTGG - Intronic
1134591578 16:15458559-15458581 ATGAAAAAATTAGCTGAGTATGG + Intronic
1134901021 16:17938050-17938072 AAGAACAAATAGGCTGAGTAGGG - Intergenic
1135398632 16:22150109-22150131 ATGAAGACACAGGCTGGGTGCGG + Intronic
1135823817 16:25708421-25708443 ATGAAGAAATTGGTTCAGAATGG - Intronic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1137770684 16:51013792-51013814 AAGTAGCACCTGGCTGAGTAGGG - Intergenic
1138159779 16:54742171-54742193 ATGAAGAACTTCTCTGAGTAAGG + Intergenic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138555344 16:57767826-57767848 ATAAAAAAACTAGCTGAGTGTGG - Intronic
1139387278 16:66580748-66580770 ATGAGGAAACAGGCTGGGAATGG - Intronic
1139387671 16:66584322-66584344 ATAAAGATACTGGCTGGGTGTGG - Intronic
1139605169 16:68013110-68013132 AGGAAGAAAGAGGCTGGGTATGG + Intronic
1139747860 16:69088954-69088976 GGGAAAAAACTGGCTGGGTATGG - Intergenic
1139826137 16:69758706-69758728 ATGAAAAAACTAGCTGGGCATGG - Intergenic
1140968878 16:79993845-79993867 GTGAAGAAAGTGCCTGAGGATGG + Intergenic
1141530087 16:84640392-84640414 CTGCAGGAACTGGCTCAGTAGGG - Intergenic
1141710525 16:85696338-85696360 ATCAAAAAATTGGCTGGGTATGG - Intronic
1141819311 16:86434138-86434160 AAGAAAAAACTTGCTGCGTATGG + Intergenic
1142912261 17:3104373-3104395 ATGAAGAAACGGGATGAACAGGG + Intergenic
1143019953 17:3912202-3912224 ATGAAGACACAGGAGGAGTAAGG - Intronic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143604356 17:7973226-7973248 ATGCAAAAATTAGCTGAGTATGG + Intergenic
1144395361 17:14837913-14837935 ATGAAGAAACAGACTAAGTGAGG - Intergenic
1144565511 17:16355806-16355828 ATGAAGAACATGGCTGGGCATGG + Intergenic
1144583808 17:16475754-16475776 TTGTAGAAACGGGCTGAGCACGG + Intronic
1144746674 17:17620581-17620603 AAGAAGAAATTGGCTGGGCATGG + Intergenic
1145008464 17:19352174-19352196 ATGAAAAAACAGGCTAAGTGGGG - Intronic
1145102168 17:20086382-20086404 GTGAAGAGGCTGGCTGAGGAGGG - Intronic
1145225640 17:21125939-21125961 ATGAATAAACTGGCTCTGGAAGG + Intronic
1145840219 17:27988414-27988436 AGCTAGAAAGTGGCTGAGTAGGG - Intergenic
1146537556 17:33666318-33666340 ATTAAGAAACGGGCAGAGTTTGG + Intronic
1146610243 17:34298653-34298675 AGGAAGAAAAAGGCTGAGCATGG - Intergenic
1146634083 17:34491318-34491340 ATCTAGAAAATGGGTGAGTAGGG - Intergenic
1146772752 17:35583909-35583931 TTGAAAAAATTGGCTGAGTTTGG + Intronic
1146774944 17:35605538-35605560 CTAAAGAAACTGGCTGGGCACGG - Intronic
1146937414 17:36820903-36820925 ATGAAGAAACTGGTGCAGGAGGG - Intergenic
1146981459 17:37165829-37165851 ATGCAAAAATTGGCCGAGTATGG - Intronic
1147223594 17:38956295-38956317 ATGAAAAAATTGGCTGGGCAAGG + Intronic
1147335018 17:39722345-39722367 ATAAAAAAACTAGCTGAGTGTGG + Intronic
1147404928 17:40204495-40204517 ATAAAAAAACTAGCCGAGTATGG - Intergenic
1147846186 17:43405437-43405459 ATGAAGAAACTGGCTGGGCACGG + Intergenic
1148642133 17:49195606-49195628 ATACACAAATTGGCTGAGTATGG + Intergenic
1148645304 17:49216752-49216774 ATGTAGAAAATGTCTGAGTCGGG - Intronic
1149357875 17:55862452-55862474 ATGAAGAAACTGAGTCAGTTTGG + Intergenic
1149403874 17:56327157-56327179 ATGAAGAAACCAAGTGAGTATGG - Intronic
1149518822 17:57302939-57302961 AGGTAGAAACTGGCCGAGTGAGG + Intronic
1150740206 17:67773253-67773275 AAGAAGAAACTGGCAAAGTGGGG + Intergenic
1151916456 17:77121713-77121735 ATGAGGAAACGGGCTCAGAATGG + Intronic
1152050452 17:77970851-77970873 ATGAAAAAATTAGCTGAGCATGG + Intergenic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1152171962 17:78757101-78757123 ATGAAAAAATTAGCTGGGTATGG - Intronic
1153247711 18:3089737-3089759 ATGAAGAAATAGGCTTAGGAAGG + Intronic
1153842950 18:9023475-9023497 CAAAAAAAACTGGCTGAGTATGG - Intergenic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1155707602 18:28836747-28836769 ATGAAAAAACTGGCCAAGCATGG + Intergenic
1155906060 18:31452725-31452747 ATGAAGAAACTGAAAGATTAAGG + Intronic
1155955068 18:31949917-31949939 ATTAAAAAAATGGCTGAGTGTGG - Intronic
1156823373 18:41399639-41399661 ATGATGAAATTGGCAGACTAAGG + Intergenic
1156870383 18:41938821-41938843 ATCTAGAAAGTGGCTGGGTATGG + Intergenic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1157662975 18:49461513-49461535 GTGAGGAAACTGGCTGAGAGAGG - Intergenic
1157732249 18:50014256-50014278 ATGGAGAAAATGGATGAGAAAGG + Intronic
1157884271 18:51351327-51351349 ATGAAGAAGCTGGCTGGGCATGG - Intergenic
1158109948 18:53929767-53929789 ATGAACAAGCTGTGTGAGTATGG + Intergenic
1159374136 18:67569708-67569730 ATAAAGATACTTTCTGAGTATGG + Intergenic
1161373491 19:3926928-3926950 ATGACAAAAGTGGCTGGGTACGG + Exonic
1161440182 19:4286897-4286919 ATTAAGAAAGGGGCTGGGTAAGG + Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1163098917 19:15081833-15081855 TGGAAGAAACTGGCTCATTAAGG - Intergenic
1163195210 19:15714539-15714561 AAGAAATAACTGGCTGGGTATGG + Intergenic
1163288795 19:16365214-16365236 ATTAAGAAACAGGCTGAGGGGGG - Intronic
1163606502 19:18278756-18278778 ATGAAGAAACTTGGAGAGAATGG - Intergenic
1163785187 19:19271295-19271317 AGGAAGAAACAGCCTGAGCAAGG - Intronic
1165411130 19:35662335-35662357 AACAAAAAACTAGCTGAGTATGG - Intergenic
1165930998 19:39358538-39358560 ATGAGGAAACTGGCTGGGTGCGG - Intronic
1167580763 19:50340864-50340886 ATAGAAAAACTAGCTGAGTATGG - Intronic
1167616572 19:50537723-50537745 AAGAAGAAACTGACAAAGTATGG + Intronic
1167777549 19:51570511-51570533 ATTAAAAAAATGGCTGATTATGG - Intergenic
1167941857 19:52953882-52953904 ATAAAAAAATTGGCTGAGCATGG + Intronic
1168050589 19:53826776-53826798 ATGGAGATAATGCCTGAGTAAGG + Intergenic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
925014569 2:512470-512492 CAGAAGAAACTGGCTGGGCATGG - Intergenic
925702234 2:6650402-6650424 ATGAAAAAAGAGGCTGAGAAGGG + Intergenic
925995103 2:9286104-9286126 AAGAAGATACTGGCTGGGCACGG + Intronic
926283260 2:11467095-11467117 ATTAAGTAACTGGCTTAATAAGG - Intergenic
926606320 2:14902285-14902307 ATGCAAAAATTAGCTGAGTATGG - Intergenic
927561017 2:24073791-24073813 TTGAGGAAACTGGTTGAGAAGGG - Intronic
927835519 2:26395236-26395258 ATGAAGAAACTATCTGATAAAGG - Exonic
927946170 2:27136614-27136636 ATAAAAAAATTAGCTGAGTATGG - Intergenic
928474437 2:31611985-31612007 AAGGATAAACTGGCTGAGTGTGG + Intergenic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
929188076 2:39115726-39115748 AGGAACAAACTGGCTGGGTGTGG - Intronic
929471105 2:42193839-42193861 ATAAAGATACTAGCTGGGTATGG - Intronic
929536180 2:42785704-42785726 TAGAAGAAATTAGCTGAGTATGG + Intronic
929671084 2:43876799-43876821 ATGAAGAGACTGTGTGAATATGG + Intronic
929671123 2:43877012-43877034 ATGAAGAAACTGTGTGAATATGG + Intronic
929902958 2:46021744-46021766 ATGAGGAAACTGGCTTTGTTTGG - Intronic
929922590 2:46183009-46183031 ATGAGGAAACTGGCTCAGAGAGG - Intronic
929988470 2:46762845-46762867 ATGAAGAAAATGAATGAGAATGG - Exonic
930090225 2:47526439-47526461 ACAAAGAAACTGGCTGAGCCTGG + Intronic
930663481 2:54079089-54079111 ATGAAGAGACTGTCTCAGTGAGG + Intronic
931034039 2:58216470-58216492 ATGAGGAAACTGGCTTAATTTGG - Intronic
931442693 2:62302553-62302575 AGCAAGAAACAGGCTGAGTGCGG - Intergenic
931474023 2:62570194-62570216 ATGAAGAAACTGGCTCTGAGGGG - Intergenic
932684261 2:73854695-73854717 AAAAACAAACAGGCTGAGTATGG + Intronic
932880774 2:75499942-75499964 ACAAAGAAAATGGCTGTGTAAGG - Intronic
933066019 2:77797402-77797424 AACAAGAAACTGGCTTAATATGG - Intergenic
933182787 2:79245950-79245972 ATGAAGAAGCAGGCTGGGTTTGG - Intronic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
937077391 2:119117166-119117188 AGGAAGAAATTGACTAAGTAAGG + Intergenic
938044883 2:128109510-128109532 TTGTTGAAACTGGCTGAGTGTGG - Intronic
938232111 2:129669888-129669910 AGGAAGGAACCGGCTGAGAATGG + Intergenic
938724191 2:134092307-134092329 ATGAAGGCACTGGGTGAGGAGGG - Intergenic
941473983 2:165925443-165925465 ATAAAGAAACAGCCTTAGTAAGG - Intronic
941848837 2:170158931-170158953 ATGAGAAAACTGGCTTAGGAAGG - Intergenic
942075604 2:172354636-172354658 CTGAAGAGAGGGGCTGAGTATGG - Intergenic
942741732 2:179188480-179188502 ATACAAAAATTGGCTGAGTATGG + Intronic
943147814 2:184067252-184067274 CTGAAGAAACTATTTGAGTATGG + Intergenic
943520266 2:188940768-188940790 AAGAAGAAACTGGTTGATAAAGG + Intergenic
943636900 2:190317067-190317089 ATAAAAAAACTAGCTGGGTATGG - Intronic
943646357 2:190410765-190410787 ATGAAAAAAATGGCTGGGCAAGG + Intronic
945610532 2:211995741-211995763 CTGAAGGAACTGGGTGTGTAAGG - Intronic
945801296 2:214434601-214434623 ATGAGGAAATGGGCTGAGAAAGG - Intronic
947166473 2:227267454-227267476 ATGAAAAAATGGACTGAGTAGGG - Intronic
947507095 2:230716141-230716163 ATGAAGTAAGATGCTGAGTAAGG + Intronic
947588114 2:231369581-231369603 AAAAAGAAACTGGCTGAGCATGG - Intronic
949081272 2:242101818-242101840 ATAAAGAAACAGGCTGGGCACGG - Intergenic
1168862206 20:1053687-1053709 AGGAGGAAACAGGCTGAGGAGGG - Intergenic
1169151184 20:3290942-3290964 ATGAAAAAATTAGCTGGGTATGG - Intronic
1169780243 20:9301699-9301721 AATAAGAAACTGGCAGAGTTAGG - Intronic
1170170512 20:13405844-13405866 AGGAGGAAACTGGCTGGGCATGG - Intronic
1170326777 20:15164603-15164625 AAGAAGTAACAGGCTGGGTATGG + Intronic
1170513538 20:17104343-17104365 CTCAAGAAACTGGGAGAGTAGGG - Intergenic
1170923936 20:20705359-20705381 ATGAAGAAATTAGCTGGGTATGG - Intronic
1171723689 20:28594777-28594799 ATTAAGAAATTAGCTGGGTATGG + Intergenic
1171754365 20:29088292-29088314 ATTAAGAAATTAGCTGGGTATGG - Intergenic
1171859656 20:30385159-30385181 ATTAAGAAATTAGCTGGGTATGG - Intronic
1172558538 20:35865343-35865365 ATGAAAAAATTGGCTGAGAGTGG + Intronic
1172963148 20:38812916-38812938 ATGCAGAAACTGACTCAGTAGGG + Intronic
1173139948 20:40473104-40473126 ATGAATAAGATGGATGAGTAAGG - Intergenic
1173832000 20:46095840-46095862 ATGAAAAAACTAGCTGGGTATGG + Intergenic
1173943281 20:46930375-46930397 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1174010640 20:47446902-47446924 ATAAATAAAATGGCTGAGCATGG + Intergenic
1174462686 20:50694010-50694032 AGAAAGAAACAGGCTGAGCATGG + Intergenic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174674966 20:52344857-52344879 ATGAAGTAACTGGCTGAGACGGG + Intergenic
1174717349 20:52773725-52773747 ATAGAGAAATTGGCTGGGTATGG - Intergenic
1175326510 20:58132809-58132831 ATGTTGAAATTAGCTGAGTATGG + Intergenic
1175477162 20:59284964-59284986 ATGAGGACACTGGCTCAGAAGGG - Intergenic
1175655536 20:60766523-60766545 ATGCAGAAATTGGCTGGGAAAGG + Intergenic
1175911688 20:62408112-62408134 AGGATGAAACTGGCTCAGTGAGG + Intergenic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1176672807 21:9750510-9750532 ATGAAGAAACTGCATGGGCAAGG - Intergenic
1177777843 21:25589251-25589273 ATGTTGAAACTGGCTGTTTAAGG - Intronic
1178079305 21:29046436-29046458 ATGACGAAATTGGCTGGGCATGG - Intronic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1180297249 22:10953456-10953478 ATTAAGAAATTAGCTGGGTATGG + Intergenic
1180411185 22:12610354-12610376 ATTAAGAAATTAGCTGGGTATGG - Intergenic
1181715502 22:24724415-24724437 ATGAAAAAATTAGCTGAGCATGG - Intronic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1181850396 22:25745576-25745598 ATTATGAAACTGGATGAGTCAGG - Intronic
1182365590 22:29776812-29776834 ATAAAGGAACTGGCTGAGAGAGG - Intergenic
1182742197 22:32576096-32576118 ATGAAGCAATGGCCTGAGTATGG + Intronic
1183207661 22:36430848-36430870 TTGAAGAAACTGGCTGAGCACGG - Intergenic
1183591117 22:38779833-38779855 AAGAAGAAACTGGCTGAGGCGGG + Intronic
1184203204 22:42983332-42983354 AAAAAGAAACTGGCTGGGTGTGG + Intronic
1184527353 22:45032911-45032933 ATAAAAAAACTGGCTGGGTGTGG - Intergenic
1184981414 22:48098349-48098371 ATGATGAAAATGGCTGAATGAGG + Intergenic
949319314 3:2791239-2791261 ATGAGGAAACTGACTGGGCATGG + Intronic
949820065 3:8106535-8106557 ATGCAGAAATTAGCTGAGCATGG + Intergenic
949889621 3:8724064-8724086 AAAAAGAAATTAGCTGAGTATGG + Intronic
949981900 3:9507367-9507389 ATGAAGGAACTTGCTCAGTGTGG - Intronic
950041880 3:9924955-9924977 AAAAAAAAACTAGCTGAGTATGG - Intronic
950177861 3:10888390-10888412 AGGAAGAATCTGACTGAGGATGG + Intronic
950805038 3:15594248-15594270 ATATAAAAACTAGCTGAGTATGG + Intronic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951975387 3:28501668-28501690 ATGAGGAAACTTTCTGGGTAAGG - Intronic
952772398 3:37014158-37014180 TTGAAAACACTGACTGAGTAGGG + Intronic
953411661 3:42693636-42693658 ATGCAAAAACTGGCAGAGTGGGG - Exonic
953563961 3:44015242-44015264 ATTAAGAAACTGGCTCAGAGAGG + Intergenic
953961948 3:47273312-47273334 ATGAGGAAACAGGCTCAGTGTGG + Intronic
954269065 3:49493197-49493219 ATGAAAAAATTGGCTGAGTGTGG - Intronic
954937887 3:54343572-54343594 ATGAAGAAATTAGCTGGGTGTGG - Intronic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
956302239 3:67784831-67784853 ATGAGGAAACAGGCTTAGAAAGG + Intergenic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
957475492 3:80717058-80717080 ATAAAGAAATTTGCTGAGTGTGG - Intergenic
957608052 3:82429830-82429852 ATCAAGTAACTGGCTGGGCACGG - Intergenic
958806828 3:98821755-98821777 ATGCAGACACTGGCTGGGCACGG + Intronic
958927418 3:100173890-100173912 ACAAAGAAACAGGCTGAGAAGGG - Intronic
959053688 3:101548781-101548803 ATGAAAAAACTAGCTGAGCATGG - Intergenic
959099643 3:101995804-101995826 GTGAAGAATGTGGCTGAGTGTGG + Intergenic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
959999452 3:112715384-112715406 TTGAATAAACAGACTGAGTAAGG + Intergenic
960579556 3:119264582-119264604 AAGAAGAAATAGGCTGAGCACGG + Intergenic
960883677 3:122372529-122372551 ATCAAGAAAATGGCTGGGCACGG + Intronic
961767650 3:129224289-129224311 ATGCAAAAATTGGCTGAGCATGG + Intergenic
962102014 3:132352486-132352508 ATGAAGAAATTGGCTGGGCGTGG - Intronic
963938477 3:151077887-151077909 GAGTAGAGACTGGCTGAGTAAGG - Intergenic
964589640 3:158346154-158346176 AAGAGGAAATTGGCAGAGTATGG + Intronic
964799807 3:160543621-160543643 TTGAAAAAATTGGCTGGGTATGG - Intronic
965056583 3:163724708-163724730 AAGAACAAACTGGCTGGGCATGG - Intergenic
965769102 3:172162132-172162154 ATACAGAAACTGGCTGGGCATGG - Intronic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
967173967 3:186846016-186846038 ATGAGGAAACTGACAGATTAAGG - Intronic
967388876 3:188936171-188936193 ATGCAAAAATTAGCTGAGTACGG - Intergenic
967533075 3:190571358-190571380 ATTAAAAAAATAGCTGAGTATGG + Intronic
969986150 4:11213124-11213146 ATGAAAAAACTAGCTGGGCATGG - Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970220811 4:13808806-13808828 ATGAAGCAGCTGGCTTGGTAAGG - Intergenic
970232359 4:13923847-13923869 ATGAAAAAACTGGCATAGCATGG - Intergenic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
970486946 4:16534328-16534350 ATGAACAAGATGGCTTAGTAGGG + Intronic
971321464 4:25609343-25609365 AATAATAAACTGGCTGAGCATGG + Intergenic
972032782 4:34482994-34483016 ATGAAGAAACTGAGTGAATTTGG + Intergenic
972145080 4:36013940-36013962 AAGTAGCAACTGGCTGAGCACGG + Intronic
972157487 4:36182200-36182222 ATGCAGAAACTGGCCGGGCATGG + Intronic
972309163 4:37864003-37864025 ATGAAGATATTGGCTAGGTATGG + Intergenic
972343537 4:38173792-38173814 TTGAAGACAGTGGCTGAGCATGG + Intergenic
972682166 4:41316731-41316753 ATGAAAAAACTGGCCGGGTGTGG + Intergenic
974034619 4:56807033-56807055 AAGAAGAAACAGGCTGGGCACGG + Intergenic
974067213 4:57089777-57089799 AGGCAGAAATTTGCTGAGTATGG + Intronic
974092232 4:57323112-57323134 ATCAAGGCACTGGCTGAGGAGGG + Intergenic
974327025 4:60426599-60426621 ATGAAGAGACTGGCTAAACAAGG + Intergenic
975485110 4:74927149-74927171 AAGGAGAAAATGGCTGGGTATGG - Intergenic
975781021 4:77839853-77839875 ATGAAAGAACTGGCTGGGAAAGG + Intergenic
976440019 4:85062281-85062303 ATGAAGAAATTGGTTCGGTAGGG + Intergenic
976670130 4:87643138-87643160 ATGAATAAACTGGCCAGGTACGG + Intergenic
977758927 4:100707091-100707113 TTGAGTAAAATGGCTGAGTATGG + Intronic
977915077 4:102583131-102583153 CTGAAGAAACTAGCTGGGCATGG - Intronic
978740640 4:112134012-112134034 ATGAATAAACTGACTGGGTGAGG + Intergenic
979613665 4:122717683-122717705 ATTAAGAAACTAGCTGGGCACGG - Intergenic
979616545 4:122748900-122748922 ATGAGGAAATTGGCTTAGCATGG + Intergenic
979688340 4:123536321-123536343 ATGAGGAAATTGGGTGAGTCCGG + Intergenic
979718688 4:123872318-123872340 ATGAAGAAAGTGGCAGGTTAAGG - Intergenic
979865751 4:125751153-125751175 ATGGAGAAAGTGGCAGAGAATGG - Intergenic
979870200 4:125809764-125809786 ATGCAAAAATTAGCTGAGTATGG + Intergenic
979979415 4:127236194-127236216 ATGATGCAAATGGCTGAGAAGGG + Intergenic
981326644 4:143456041-143456063 ATGAAGAAACTAGATTTGTAAGG + Intronic
981712804 4:147725627-147725649 ATGCAGAAATTAGCTGAGTGTGG - Intergenic
982233389 4:153229964-153229986 CTGAATGAACTGGCTGAATAAGG - Intronic
982256706 4:153458101-153458123 ATGAAGAAAAAGGCTAGGTATGG + Intergenic
982257338 4:153463739-153463761 ATGAAGAAAAAGGCTAGGTATGG + Intergenic
982465271 4:155722780-155722802 ATGAAGAAACAGTTTGGGTAAGG + Intronic
982593547 4:157348392-157348414 ATTTAGAAACTAGCTGAGCATGG - Intronic
983260623 4:165452682-165452704 ATGAAGGTACAGGCTGAGTTAGG - Intronic
983589271 4:169389764-169389786 ATGAAGAAATGGGCTGGGCATGG - Intergenic
985401908 4:189601315-189601337 ATGAAGAAACTGCATGGGCAAGG + Intergenic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
987357145 5:17073854-17073876 ATTAAGAAACTAGCTGCGCATGG + Intronic
987811162 5:22838110-22838132 ATGAAGAAAATGGCAAAGCAAGG - Intronic
988650497 5:33143899-33143921 ATGAAGAAACAAGTTGAGAAAGG + Intergenic
989546129 5:42675994-42676016 AGGAAGAAATTGGCTGGGTATGG + Intronic
989788550 5:45362889-45362911 TTCAAGAAACTGGTTGAGAAAGG - Intronic
990146428 5:52766136-52766158 ATAAAAAAGCTGGCTGAGCATGG + Intergenic
990220850 5:53586811-53586833 AGGAAGAAACAGGCTGGGCACGG - Intronic
990446324 5:55897138-55897160 ATAAAGAAACAGGCTGGGCATGG - Intronic
991349211 5:65703413-65703435 ATGAATAAACTGGACGAGTGTGG + Intronic
991607823 5:68420917-68420939 ATGTAAAAACCGGCTGAGTCCGG - Intergenic
992154016 5:73936856-73936878 ATGAACAAAGTGGCTGGGCATGG - Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992510241 5:77425633-77425655 ATGAAGAAATAGGCTCAGCAAGG - Intronic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
993301666 5:86219395-86219417 AAAAAGTAACTGGCTGGGTACGG + Intergenic
993489040 5:88523806-88523828 ATGAAGAAATTAGCTGGGCATGG - Intergenic
993644512 5:90445811-90445833 AGGAAGAAACTGGAAGAGGAGGG + Intergenic
994084087 5:95739705-95739727 ATAAAAAAACTGGCTGGGTGTGG - Intronic
995286863 5:110399246-110399268 ATAAAGATACTTCCTGAGTAAGG + Intronic
995572346 5:113493647-113493669 TTGAAGAAAAAAGCTGAGTAAGG - Intergenic
995967596 5:117927755-117927777 AAGAAGAAACTGTCTCAGTGTGG + Intergenic
996294492 5:121895468-121895490 ATCAATAAACTGGCTCTGTAGGG + Intergenic
996494682 5:124140239-124140261 GTGAAGAAACTGCCTGAGGCTGG + Intergenic
997177491 5:131794640-131794662 TTGAAGGAACTGGCTGGGTGTGG + Intronic
997257767 5:132442435-132442457 AGGCAGAAAATGGCTGAGAAAGG + Intronic
997290516 5:132730174-132730196 AAGAAAAAACTGGCTGGGCACGG + Intronic
997359377 5:133284887-133284909 GGGAAGAGACAGGCTGAGTAGGG + Intronic
997421635 5:133773291-133773313 ATCAAGACAGTGGCTGAGCAGGG - Intergenic
997716006 5:136043613-136043635 ATGATGAAATTGGCTGAGGATGG + Intronic
997767870 5:136523430-136523452 ATGATGAAACTTCCTCAGTACGG + Intergenic
997908646 5:137845913-137845935 ATGGAGAAGCTGTCTGAGAAAGG + Intergenic
998619814 5:143781449-143781471 ATGAAAAGACTGGCCGGGTATGG - Intergenic
998930361 5:147174562-147174584 AAGAAGAAACAGGCTTAGAAAGG + Intergenic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
1000116584 5:158159702-158159724 ATGAAGAAACTGCCCAAGGAAGG - Intergenic
1000315551 5:160087084-160087106 ATGGAGACACTGGCCGAGCACGG + Intronic
1000334709 5:160233582-160233604 GTGAAGAAACTGGCCGGGCACGG + Intronic
1001139280 5:169130135-169130157 ACTAAGAAACTGGCTGGGCACGG - Intronic
1001370800 5:171198829-171198851 CTGAAGAAACAGGCAGAGAAAGG - Intronic
1002148140 5:177202532-177202554 ATAAAAATACTGGCTGAGGATGG - Intronic
1002214726 5:177622277-177622299 ATAAAAAAATTAGCTGAGTATGG + Intergenic
1004327355 6:14687591-14687613 ATACAAAAACTAGCTGAGTATGG - Intergenic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1005334618 6:24781923-24781945 ATGAAAAAATTAGCTGAGCATGG + Intronic
1006439043 6:34041959-34041981 ATGAAGAAACTAACTGGGCATGG + Intronic
1006671216 6:35730960-35730982 ACGAAGAAACTGGCTCAGAGAGG - Intergenic
1006875824 6:37295258-37295280 ATAAAAAAATTGGCTGGGTATGG - Intronic
1007177259 6:39905491-39905513 ATGAAGACACTGTGTGGGTAGGG - Exonic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008252225 6:49254221-49254243 ATGAAGAAACTGGCCGGGCGCGG + Intergenic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1009029500 6:58039367-58039389 ATGAAGAAAATAGCTGGGTGTGG - Intergenic
1009205036 6:60790758-60790780 ATGAAGAAAATAGCTGGGTGTGG - Intergenic
1009314889 6:62205708-62205730 AGGAGGAAACTTGCTGAGAAAGG - Intronic
1009370324 6:62892996-62893018 ATAAAGAAACTACCTGAGAATGG + Intergenic
1010161987 6:72867645-72867667 CTGGAGATTCTGGCTGAGTATGG + Intronic
1010406287 6:75509603-75509625 ATAAAGACAATGGCAGAGTATGG + Intergenic
1012627289 6:101419671-101419693 AGGAAGAAACAGGCTGAGAGAGG + Intronic
1012677997 6:102141385-102141407 ATGAAGAAAGCTGCTGAATAGGG - Intergenic
1012733663 6:102911562-102911584 ATGAAGAAACTACCTGAGACTGG - Intergenic
1013148832 6:107424605-107424627 CTGAAGATACAGGCTGTGTAAGG + Intronic
1013245683 6:108284892-108284914 AAAAAGAAACTGGCTGGGCACGG + Intergenic
1013885811 6:114964742-114964764 AAGAATAAACTGGCTGGGTACGG - Intergenic
1014104300 6:117545778-117545800 GTGAAAAGACTGGCTGAATAGGG - Intronic
1015634432 6:135261907-135261929 ATGAAGAAACTAGGTGATTGTGG - Intergenic
1015879590 6:137857757-137857779 ATGAAGAAACGGCCTCAGTGAGG - Intergenic
1016133803 6:140512484-140512506 AAGAAAAAACTGGCTGGGCATGG + Intergenic
1016170724 6:141012435-141012457 ATGAAGAAACTACCTGAGTTGGG + Intergenic
1016348802 6:143145312-143145334 ATGAAAATACTGGCTGGGCATGG - Intronic
1016805580 6:148208819-148208841 ATATAGAAACTGACTGAATACGG + Intergenic
1018535558 6:164815102-164815124 ATGAAGATACTGCCTGAGCCTGG + Intergenic
1018621593 6:165734209-165734231 ATGAAGATACTGTATGAGTTTGG - Intronic
1019364003 7:622008-622030 GTGAAGAGACTGGCTGAGATCGG - Intronic
1020131173 7:5559300-5559322 ATGAGGAAACTGGTTGGGCACGG + Intronic
1020446730 7:8276666-8276688 ATGAAAAAACTGGCTTAGAGAGG - Intergenic
1020736878 7:11961260-11961282 ATGAAGAATCTGGTAGAGAAGGG + Intergenic
1020894233 7:13919207-13919229 ATGAAGAAACTGGAGGCATAAGG + Intronic
1021324843 7:19254181-19254203 GTGAGGAAAATGGCTGAGAAAGG - Intergenic
1021446180 7:20736115-20736137 AGAAAGAAACTTACTGAGTAAGG + Intronic
1021737158 7:23651037-23651059 ATAAAGAAAGTGGCTGGGTGTGG + Intergenic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1023127133 7:36965468-36965490 CTGGAGAAAATGGCTCAGTAAGG + Intronic
1023305009 7:38816897-38816919 ATGAAGAAATTAGCTGCGTGTGG - Intronic
1024097480 7:45994655-45994677 AAGCAGAAAATGGCAGAGTAGGG + Intergenic
1024925135 7:54604598-54604620 ACGAATAAACAGGCTGATTAAGG - Intergenic
1025002018 7:55324096-55324118 AAAAAGAAACTGGCTGGGTGCGG - Intergenic
1025805637 7:64830611-64830633 ATGAAGATACAGGCTGGGCATGG - Intronic
1026211846 7:68312846-68312868 ATGAAAAAATTAGCTGAGTATGG - Intergenic
1026444748 7:70474405-70474427 GAGAAGAAACTGGATGAGTCTGG - Intronic
1026553287 7:71385774-71385796 ATCAAGAAATTGGCTGGGTGCGG + Intronic
1027035719 7:74923773-74923795 ATGAAGAAATTAGCTGGGTGTGG - Intergenic
1027208543 7:76124362-76124384 ATGAATAATCTGGCTGGGCATGG + Intergenic
1027355250 7:77348011-77348033 AATAAGAAACTGGATGGGTATGG + Intronic
1029127632 7:98305711-98305733 ATGAGGAAACTGGCCGGGCACGG - Intronic
1029247579 7:99213764-99213786 ATGAAAACATTAGCTGAGTATGG - Intergenic
1030296532 7:107934467-107934489 AGGAAGAAACAGGCTCAGTTAGG + Intronic
1030369285 7:108678794-108678816 ATGAAAAACCTGGCTGAGGCAGG - Intergenic
1030874175 7:114792820-114792842 ATAAAAAAATTGGCTGAGCATGG + Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032324664 7:130916015-130916037 ATGATGAAACTGGCTTAGCGAGG - Intergenic
1032345521 7:131112959-131112981 ATGAATAAAGTGGCAGAGTTGGG - Intronic
1032879956 7:136078180-136078202 ATGCAAAAATTGGCTGAGCATGG + Intergenic
1033179742 7:139164320-139164342 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1033472197 7:141660213-141660235 ATGAAGAAGCTGGCAAGGTAGGG + Exonic
1034077631 7:148247942-148247964 CTGAAGAAAGAGGCTGAGCATGG - Intronic
1034187529 7:149190452-149190474 ACAAAAAAATTGGCTGAGTATGG + Intergenic
1034341393 7:150358776-150358798 ATGAACAATATAGCTGAGTAGGG + Intergenic
1035920635 8:3672189-3672211 TTGATGAAATTGACTGAGTATGG + Intronic
1036383830 8:8260633-8260655 AAAAAGAAACAGGCTGATTACGG + Intergenic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1036718152 8:11146333-11146355 AAGAAAAAACTGGCTAAGTGTGG + Intronic
1037865149 8:22437422-22437444 CTCAAGAAACAGGCAGAGTACGG + Intergenic
1038705226 8:29887087-29887109 ATGGAGGCACTGGATGAGTAAGG + Intergenic
1039279876 8:35972637-35972659 ATGAAGACACTGGCAGAGATAGG + Intergenic
1039558075 8:38491089-38491111 ATGAAGAAACTGGCTGGGTGTGG - Intergenic
1039635430 8:39159560-39159582 AGGAAGAAAGAGGCTGAGGAAGG - Intronic
1039817771 8:41110032-41110054 ATGTAGAAACTGGCTGGGTGTGG + Intergenic
1041036841 8:53800211-53800233 ACAAAGACACAGGCTGAGTATGG - Intronic
1041267848 8:56082511-56082533 ATGCAAAAATTAGCTGAGTATGG - Intergenic
1041909162 8:63069577-63069599 ATAAAAAAACTGGCTGAGTGTGG + Intronic
1042282807 8:67072709-67072731 ATGAAAAAACTAGCTGGGGATGG + Intronic
1043936490 8:86148560-86148582 ATGCAGATTCTGGTTGAGTAGGG + Intronic
1044365656 8:91342218-91342240 ATAAAGAAGCTGGCTGAGCACGG - Intronic
1044938821 8:97319592-97319614 ATGAAGAAACAGGCCCAGTGAGG - Intergenic
1045011987 8:97966399-97966421 ATTAAGAAATTAGCTGGGTATGG + Intronic
1045051460 8:98330904-98330926 ATGAGGAAACTGGCTCAGAGAGG + Intergenic
1047486818 8:125338801-125338823 ATGATGAAACTGAATGATTATGG + Intronic
1047608227 8:126495818-126495840 AGGAAGAAACTGAATGAGTTTGG + Intergenic
1048018478 8:130518356-130518378 ATGAGGAAACTGGCTCAGAGAGG - Intergenic
1048106544 8:131417115-131417137 ATGAAGAAAATGCTTAAGTATGG - Intergenic
1048337687 8:133515070-133515092 ATGAAGAAGCTGGCAGAGGGTGG - Intronic
1048701009 8:137089567-137089589 ACAAAAAAACTGGCTGCGTATGG + Intergenic
1049048222 8:140169891-140169913 ATGCAGAAACTAGCTGAGCATGG - Intronic
1049912448 9:282336-282358 ATGAAAAACCTGGCTGATAACGG - Intronic
1050035596 9:1432724-1432746 ATGAAAAAAGTGGCTGGGCACGG + Intergenic
1050163404 9:2740749-2740771 ATTATAAAACTGGCTCAGTAAGG - Intronic
1050512535 9:6411531-6411553 ATTAAAAAACTAGCTGAGCATGG - Intergenic
1051538838 9:18191433-18191455 AAGAAGAAAGTGGCTTAGTGTGG - Intergenic
1052096155 9:24386878-24386900 AATAAGAAACTAGCTGAGTGTGG + Intergenic
1052412256 9:28136908-28136930 ATGAACAAAAAGGCTGAGTAAGG + Intronic
1052509710 9:29400113-29400135 ATGTACATACTGGCTAAGTAAGG - Intergenic
1053725912 9:41000274-41000296 ATTAAGAAATTAGCTGGGTATGG - Intergenic
1055394204 9:75856432-75856454 ATGAGGAAACTGGCTTAGAGAGG - Intergenic
1055738825 9:79363339-79363361 ATTAAGAAGCTGGCTGGGTGCGG + Intergenic
1056000349 9:82209962-82209984 GTGAGAGAACTGGCTGAGTAGGG + Intergenic
1056394244 9:86167118-86167140 ATGTAAAAAGTAGCTGAGTATGG - Intergenic
1056781800 9:89556038-89556060 ATGAAACAGCTGGCTGACTAGGG + Intergenic
1056801355 9:89694276-89694298 ATGCAGAAACTGGATGAACAGGG + Intergenic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058581821 9:106466910-106466932 ATGAAGAAACAGATTAAGTAAGG + Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1058895197 9:109394847-109394869 AGGAAGAAACTGGCCGGGTGTGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1060066045 9:120501971-120501993 ATGAGGAAACAGGCTGAGACAGG + Intronic
1060276128 9:122184159-122184181 ATGAGGAAACAGGCTCAGTGGGG + Intronic
1060403770 9:123362835-123362857 AAGAAGAAACTGGCTGGGCAGGG - Intronic
1060920511 9:127417500-127417522 ATGAAGAAACAGGCCGAGAGGGG - Intergenic
1061106282 9:128533131-128533153 ATGATGAAACAGGCTGGGCATGG + Intronic
1061147536 9:128808676-128808698 ATGAGGAGACTGGCTCAGCAAGG + Exonic
1061588112 9:131581396-131581418 ACAAAGAAACTGGCTGGGTGTGG + Intronic
1061648245 9:132024153-132024175 ATAAAGAAAGTGGCTCAGAAGGG - Intronic
1061818937 9:133212773-133212795 ATGCAAAAACTAGCTGAGTGTGG + Intergenic
1202804269 9_KI270720v1_random:36404-36426 ATTAAGAAATTAGCTGGGTATGG + Intergenic
1203448899 Un_GL000219v1:91701-91723 ATTAAGAAATTAGCTGGGTATGG + Intergenic
1186067168 X:5778450-5778472 ATAAAGAAACCAGCTGAGTGTGG + Intergenic
1186448321 X:9651181-9651203 ACGAAAAAACTAGCTGAGTGTGG - Intronic
1186773442 X:12839999-12840021 ACTAAGTAACTGGCTTAGTAAGG + Intergenic
1186777872 X:12883631-12883653 AGCAAGAAACTGACTGATTAAGG + Intronic
1187855023 X:23628567-23628589 ATGCAGAAACTGGCTGGGCGCGG + Intergenic
1188517191 X:31000148-31000170 ATAAAGAATCTGGCTGGGTACGG - Intergenic
1188853249 X:35158160-35158182 ATAAAGGATTTGGCTGAGTAAGG - Intergenic
1189091751 X:38090817-38090839 TTTTAGAAACTGGCTGAGCAAGG - Intronic
1190989484 X:55531318-55531340 ATGAAGAAACTTGATGATGAAGG - Intergenic
1192106171 X:68319578-68319600 ATGCAAAAATTGGCTGAGTGTGG + Intronic
1192787301 X:74347712-74347734 ATGAGAAGACTGGCTGAGTGTGG - Intergenic
1193091303 X:77496180-77496202 ATGAAAAAACTGGCAGGGCACGG + Intergenic
1193384455 X:80854285-80854307 ATGAAGAAAGAGGCTGGGCATGG - Intergenic
1194074188 X:89368257-89368279 ATGATTAAACTGGCTAAATAGGG + Intergenic
1195386611 X:104319458-104319480 ATGAAGAAATTAGCTGGGCATGG + Intergenic
1196211931 X:113005557-113005579 AAGAATGAACTGACTGAGTATGG + Intergenic
1196464130 X:115956286-115956308 ATGAAGAAACTGCCTAGTTAAGG + Intergenic
1197870751 X:131060132-131060154 ATGAAGAAACTGGGGAAGTTTGG - Intronic
1198212209 X:134526828-134526850 ATGGAGACTCTGGCTGAGTGCGG - Intergenic
1198426724 X:136528248-136528270 ATTAAAAAATTAGCTGAGTATGG - Intergenic
1198519983 X:137442618-137442640 ATGAAGATGCTGGCAGATTAGGG - Intergenic
1198641878 X:138765112-138765134 ATGAAGAAAGAGGCTCAGTGAGG - Intronic
1199802855 X:151268566-151268588 ATGAAGAGAGGGGCTGAGAATGG + Intergenic
1200241827 X:154500199-154500221 GTGAAGAAGCTGGCTGGGCACGG + Intergenic
1200729580 Y:6719784-6719806 ATGATTAAACTGGCTAAATAGGG + Intergenic
1201385311 Y:13434354-13434376 ATGCAAAAATTAGCTGAGTATGG - Intronic
1201949193 Y:19545021-19545043 ATTAAAATACTGGCTGAGCATGG + Intergenic
1202296798 Y:23366953-23366975 ATGCAAAAACTAGCTGAGTGTGG + Intergenic
1202574009 Y:26303644-26303666 ATGCAAAAACTAGCTGAGTGTGG - Intergenic