ID: 1087294471

View in Genome Browser
Species Human (GRCh38)
Location 11:96354552-96354574
Sequence ATAGTTCAGCAACTAGTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087294471 Original CRISPR ATAGTTCAGCAACTAGTTAT GGG Intronic
906162618 1:43661761-43661783 ATAATACAGGACCTAGTTATGGG + Intronic
907058699 1:51398378-51398400 ATAAAACAGCAACTAGCTATAGG + Intronic
908637105 1:66179606-66179628 ATCATTCAGCAACTATTGATTGG - Intronic
910200825 1:84696880-84696902 CTTATTCTGCAACTAGTTATTGG - Intergenic
921082240 1:211750927-211750949 ATAATTTAGCAACTATTTAAAGG + Intronic
923096387 1:230778468-230778490 ATAGTACATCAAATAGGTATAGG - Intronic
923319809 1:232820115-232820137 ATAGTTCCTCTACTAGCTATGGG + Intergenic
1064606763 10:17049982-17050004 ATATTTCAACAACTACTTACTGG - Intronic
1065770886 10:29077334-29077356 CTAATTCAGCAAGTATTTATTGG - Intergenic
1073853768 10:107651731-107651753 AAAAATCAGCAGCTAGTTATTGG + Intergenic
1073940493 10:108692485-108692507 ATAATTGAGTTACTAGTTATTGG - Intergenic
1073980358 10:109147036-109147058 TTATTTCTGCAACTAGTTACAGG + Intergenic
1078078293 11:8181295-8181317 AGACTTCAGCAAATATTTATTGG + Intergenic
1078114371 11:8430771-8430793 ATAATTCAACAAATATTTATTGG - Intronic
1081418746 11:42846892-42846914 ATGGTTCGGCAAACAGTTATTGG + Intergenic
1087294471 11:96354552-96354574 ATAGTTCAGCAACTAGTTATGGG + Intronic
1089448205 11:118570892-118570914 ATAGTTCTGGAACTAGATAGAGG - Intronic
1089772240 11:120811885-120811907 GTGGTTCAGCAACTGTTTATAGG + Intronic
1093277106 12:17142797-17142819 ATAGTTTAGCAGCTATTTACAGG - Intergenic
1094386625 12:29901372-29901394 ATTATTCAGCAAATATTTATTGG - Intergenic
1094592164 12:31831910-31831932 AGAGTGCAGCAGCAAGTTATTGG - Intergenic
1094633331 12:32199502-32199524 TTATTTCTGCAACTGGTTATGGG + Intronic
1095522126 12:43079102-43079124 ATGATTCATCAACTATTTATTGG + Intergenic
1097307564 12:58086379-58086401 ATAGTTCAGTAAATATTTGTTGG - Intergenic
1097751148 12:63354407-63354429 AATGTTCAGCTACTAGTTGTAGG + Intergenic
1098260498 12:68665173-68665195 ATGGTACAGCAGGTAGTTATGGG + Exonic
1098624321 12:72644083-72644105 ATGATTCAGCAACAATTTATGGG + Intronic
1100866030 12:98857713-98857735 ATATTTCAAGAACTATTTATGGG + Intronic
1101181271 12:102220899-102220921 TTAGTTCAGAAAATAGTTCTAGG - Intergenic
1106008632 13:25796247-25796269 ATAGTTTTAAAACTAGTTATGGG - Intronic
1106564868 13:30875419-30875441 GTCCTTCAGCAACTAGATATCGG + Intergenic
1107043436 13:35972466-35972488 ATTGATAAGCAAATAGTTATTGG - Intronic
1108399623 13:50026568-50026590 ATAGTTAAGAAACTAGTTTAAGG - Intergenic
1111460663 13:88537365-88537387 ATAGTTTAGAAACTATCTATTGG - Intergenic
1112984556 13:105431818-105431840 ATAATTCAGAAACCATTTATCGG + Intergenic
1116102554 14:40460099-40460121 TGAGTTCAGAAACTTGTTATGGG - Intergenic
1117646548 14:57859190-57859212 AAAATTCAACAACTAGTGATTGG + Intronic
1123737924 15:23203123-23203145 ATATATCAGCAACTATTTTTTGG - Intergenic
1124289133 15:28431792-28431814 ATATATCAGCAACTATTTTTTGG - Intergenic
1124294089 15:28485518-28485540 ATATATCAGCAACTATTTTTTGG + Intergenic
1126670272 15:51109981-51110003 TTAAGTCAGCAAATAGTTATTGG + Intergenic
1129423320 15:75447624-75447646 CTAGTTCCACAACTAGTTTTGGG - Intronic
1129611365 15:77061166-77061188 ATAGCTTAGAAACTAGTTTTTGG + Intronic
1135384596 16:22026114-22026136 ATATTCCAGGAACTAGTTATTGG - Intronic
1135510135 16:23075467-23075489 ATACTTCAGAAAGTAGTTCTAGG - Intronic
1135671089 16:24376192-24376214 TTAATTCAGCAACTGTTTATTGG + Intergenic
1139092437 16:63664760-63664782 ATATTTCAGCAAAAAGTTCTGGG - Intergenic
1150674815 17:67235655-67235677 TCAGTTCAGCAAGTATTTATTGG - Intronic
1151332350 17:73417895-73417917 ATAATTCAGCATCTAATTATTGG + Intronic
1154042548 18:10871181-10871203 ATAGTTCTGCAACTTATTAAGGG + Intronic
1157877065 18:51283557-51283579 ATATTTCAGAAAATAGTTATAGG - Intergenic
1158152623 18:54389451-54389473 ATAGTTCATGAACTAGAAATTGG + Intergenic
1158816851 18:61110357-61110379 ATAGTTCAGAAAATAATTACAGG + Intergenic
1159249296 18:65852997-65853019 AAATTTCAGGAACTAGTTTTAGG + Intronic
927057121 2:19375547-19375569 ATAGTTCAGAAAAGAGTGATGGG + Intergenic
928117332 2:28555682-28555704 TTAGTTCAGCAAATATTTATTGG - Intronic
929766968 2:44852710-44852732 ATAGTTCTGCACCTACTTTTTGG - Intergenic
930567080 2:53034703-53034725 AAAGTTTATCAACCAGTTATGGG + Intergenic
931227233 2:60342003-60342025 ATAGATCGGCATCTAGTTACTGG + Intergenic
933270176 2:80224774-80224796 ATAGTTTAGCAACTAGAGGTAGG - Intronic
935796685 2:106648510-106648532 AAACTTCAGCAACTAAATATTGG + Intergenic
936763521 2:115816068-115816090 TTAATTCAGTAACTATTTATTGG + Intronic
936842056 2:116781971-116781993 TTAATTCAGCAATTAGTTTTAGG - Intergenic
937898603 2:126998048-126998070 ATATTTCTGCAACCAGTTACAGG - Intergenic
939934311 2:148271214-148271236 ATAGTCCAGCCACTAATCATAGG - Intronic
940099974 2:150025699-150025721 ATTATTCAGCAAATAATTATTGG - Intergenic
942216357 2:173723175-173723197 ATAGTTCAACATTTATTTATGGG - Intergenic
943670262 2:190652811-190652833 ATAGTTCAGCTACACTTTATGGG - Intronic
947064347 2:226204701-226204723 ATAGTTCAGTAACAAGTAAGGGG - Intergenic
1177234064 21:18362945-18362967 ATAGTTAAGAATATAGTTATTGG - Intronic
1178885500 21:36481840-36481862 TTCGTTCATCAAATAGTTATTGG + Intronic
1179378666 21:40878259-40878281 ATAGCTCATGAACTTGTTATAGG + Intergenic
1182088092 22:27575201-27575223 GTAGTGCAGGAACTAGTTACAGG + Intergenic
949978034 3:9478393-9478415 TTCATTCAGCAACTATTTATTGG + Intronic
954888795 3:53903776-53903798 TTATTTCTGCAACTGGTTATAGG + Intergenic
956950861 3:74280656-74280678 ATTGTTCAACAAATACTTATTGG + Intronic
957219546 3:77364236-77364258 ATAGTTCAACAAGTGGTGATAGG - Intronic
957246002 3:77717114-77717136 ATAGTTCAGGTAATATTTATAGG - Intergenic
957602526 3:82356470-82356492 TTAGTTTAGCAAATATTTATTGG + Intergenic
958854419 3:99367367-99367389 TTTGTTCAGCAACTACTCATTGG - Intergenic
959678996 3:109071398-109071420 CTCATTCAGTAACTAGTTATAGG + Intronic
959796657 3:110439068-110439090 AGTGTTCAGCAAATATTTATTGG + Intergenic
960174957 3:114506311-114506333 AAAGTTCAGCAATTAGGTCTGGG + Intronic
963373560 3:144434395-144434417 ATTGTTCAGCTCCTACTTATAGG - Intergenic
967761829 3:193234534-193234556 TTCATTCAACAACTAGTTATTGG + Intergenic
970898957 4:21136449-21136471 TTAGTTCAGCAAATAGGCATTGG + Intronic
971724210 4:30288205-30288227 CTTGTTCATGAACTAGTTATGGG - Intergenic
971950470 4:33339027-33339049 AGAGTTAAGCATTTAGTTATAGG - Intergenic
973257182 4:48125334-48125356 CTCATTCAGCAACTATTTATTGG + Intronic
975482424 4:74895871-74895893 AAAATTCAGCAACTATTTATTGG + Intergenic
975788548 4:77921934-77921956 TTCGTTGAGCAAATAGTTATTGG + Intronic
976040213 4:80875220-80875242 AGAGATCAGCAATTAGTCATTGG + Intronic
978204083 4:106058761-106058783 ATATTTTAGCAACTAGTCATAGG + Intronic
983810443 4:172054014-172054036 ATAGTTAAGCAAAATGTTATTGG + Intronic
986075636 5:4335090-4335112 GTAGTCCAGAAACTAGTCATTGG - Intergenic
986714372 5:10512094-10512116 GTTGTTCAGCAAATATTTATTGG - Intronic
988773360 5:34453286-34453308 TTATTTCTGCAACTAGTTATAGG - Intergenic
991205775 5:64048858-64048880 TTATTTCTGCAACTAGTTATAGG - Intergenic
992823510 5:80522991-80523013 GAAGTTCAGCAACTGGTTTTAGG + Intronic
995407554 5:111817018-111817040 AAAGCACATCAACTAGTTATAGG - Intronic
1000342039 5:160285404-160285426 GTCTTTCAGCAATTAGTTATTGG - Intronic
1003485008 6:6567914-6567936 TTAGTTCCCCAATTAGTTATGGG - Intergenic
1008520734 6:52360760-52360782 ATAGTCCAGCACTTACTTATAGG - Intergenic
1008869536 6:56256104-56256126 TTTGTTCAGCAACTATTTAATGG - Intronic
1015569510 6:134606498-134606520 ATATTTCAGGAACTAGTATTGGG - Intergenic
1017324241 6:153128921-153128943 ATAGTTCCGCAACTACTCCTTGG - Intronic
1020359372 7:7311163-7311185 ATAGTTCTGCAACAACTTGTTGG + Intergenic
1020674655 7:11167490-11167512 ATAGTTCAGAAAATATTGATTGG + Intronic
1022955684 7:35378031-35378053 TTTGTTCAGCAACTCTTTATTGG - Intergenic
1024391576 7:48818979-48819001 GTAATTCAGCAGCTACTTATTGG - Intergenic
1024914004 7:54478124-54478146 CTAGTTCATCAACTAGCAATGGG + Intergenic
1028053580 7:86215918-86215940 ATGGTTCACAAACTAATTATGGG + Intergenic
1031398831 7:121306567-121306589 ACAGTTCAGCAAGTAGATTTTGG + Intergenic
1036291177 8:7492101-7492123 TTATTTCTGCAACCAGTTATAGG - Intergenic
1036330313 8:7819435-7819457 TTATTTCTGCAACCAGTTATAGG + Intergenic
1036658656 8:10693471-10693493 TTAGGTCAGCAAATACTTATTGG - Intronic
1040468405 8:47716329-47716351 AAAAGTCAGGAACTAGTTATAGG - Intronic
1042696700 8:71561392-71561414 ATAGTTTAGCAAATGGTAATTGG + Intronic
1049047135 8:140161765-140161787 ATGGCTCAGCAACTAGATTTGGG + Intronic
1050179726 9:2908243-2908265 ATATTTTAGCAATTAGTTTTGGG - Intergenic
1052024511 9:23559671-23559693 ATAATTCAAGAAATAGTTATTGG - Intergenic
1053018886 9:34680773-34680795 GTAGTTCTGCAACTGGTTCTGGG - Intergenic
1055889553 9:81108316-81108338 TTAGTTGACCAACTAGGTATTGG + Intergenic
1186165994 X:6826670-6826692 CTAATTCAGCAACAAGTTATAGG + Intergenic
1186537579 X:10365695-10365717 TTAGTTCAGCAAACATTTATTGG + Intergenic
1187584649 X:20646795-20646817 ATTGTTCAGCTCCCAGTTATAGG - Intergenic
1188224409 X:27579335-27579357 ATTGTTCAGCTACCACTTATAGG - Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189800483 X:44687711-44687733 ATAGTTCAGCAATTTGTTTATGG + Intergenic
1195427505 X:104751225-104751247 TTTGTTCAGCAAATATTTATTGG + Intronic
1195713220 X:107792172-107792194 ATAGTTGTTCAACTAGTTATAGG + Intronic
1198196321 X:134366415-134366437 AAAGCTCAGCAAATATTTATTGG + Intergenic
1200947233 Y:8855844-8855866 ATACTTCTGTAACTATTTATTGG + Intergenic