ID: 1087295039

View in Genome Browser
Species Human (GRCh38)
Location 11:96362175-96362197
Sequence AATATAATGAAACATGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 292}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087295039 Original CRISPR AATATAATGAAACATGTACC AGG Intronic
901837762 1:11935184-11935206 AATAGAAGGAAACACTTACCAGG - Intronic
902652592 1:17846217-17846239 AATATAGTGAAACATGGGGCCGG - Intergenic
902898608 1:19497315-19497337 TATTTAATGAAAGATGTACAAGG + Intergenic
904361747 1:29979246-29979268 AATTAAATGAAACTTGTGCCAGG - Intergenic
906309526 1:44743497-44743519 AATAAAATAATACATGTAGCTGG + Intronic
907573087 1:55501890-55501912 AATATATTGAAACATTAGCCAGG - Intergenic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
907995294 1:59625267-59625289 AATAGTATGAAATATGTATCAGG - Intronic
908168544 1:61482580-61482602 ATTATAATGAAGCATGAATCAGG - Intergenic
909936651 1:81558836-81558858 GATATAATGAACCTTGCACCAGG + Intronic
911069182 1:93818638-93818660 CATATAATGAAACAAATGCCTGG - Intronic
911115568 1:94242830-94242852 AATATAATGACACAGATACATGG + Intronic
911810842 1:102278056-102278078 AAAATGTTGGAACATGTACCTGG + Intergenic
912935220 1:113997858-113997880 AATATAATGAAAAATGAAAAAGG + Intergenic
913145312 1:115983709-115983731 CATAGAATTAAACATGTACCTGG + Intronic
916331448 1:163622095-163622117 AGTTAAATGAAACATGAACCTGG - Intergenic
916441585 1:164831266-164831288 TAGTTAATGATACATGTACCAGG - Intronic
917718938 1:177767388-177767410 TACATAAGGAAACATGTACAGGG + Intergenic
918245929 1:182659402-182659424 AGTATTATAAAACATGTAGCCGG + Intronic
918312862 1:183298468-183298490 AATATAATAAAACATATACAGGG + Intronic
919027456 1:192195132-192195154 AATATAATGAAGATTCTACCTGG + Intergenic
919199072 1:194328850-194328872 AATATATTAAAACAGGTACAGGG + Intergenic
919220240 1:194618739-194618761 AATAAAATGAAAAATGTGACAGG + Intergenic
920892092 1:209997753-209997775 AATATAAATAACCATGTAACAGG + Intronic
921787418 1:219246903-219246925 AAAATAAAGAAACATGTAATGGG + Intergenic
922418125 1:225440437-225440459 AGTATAATGCTACATCTACCAGG + Intergenic
923851350 1:237799279-237799301 AATATCATGAAACAAGAACTAGG + Intronic
1063807838 10:9667694-9667716 AAAATAAATAAACATGTACACGG + Intergenic
1064712710 10:18142465-18142487 GACAGAATGAAAAATGTACCCGG + Intronic
1064929333 10:20606651-20606673 AATATAATATAATATGTAGCAGG + Intergenic
1065979266 10:30875463-30875485 AAAATAATGGAACAAGTATCAGG - Intronic
1066299053 10:34080846-34080868 AATATAATGAAGCCTGTCCCTGG + Intergenic
1066572097 10:36784629-36784651 AATATAATGAAACACCTATTTGG + Intergenic
1067147999 10:43707443-43707465 AATATAATGAAAATTGTGACTGG - Intergenic
1068124584 10:52823647-52823669 AGCATCATGAAACATGCACCAGG + Intergenic
1069279286 10:66633849-66633871 AATATAGTGAAAAATATACTTGG - Intronic
1071514865 10:86290676-86290698 AATAAAATAAAATATGTTCCAGG + Intronic
1071756182 10:88542864-88542886 AATATAATAAAAAATGCTCCAGG + Intronic
1075607601 10:123824937-123824959 AATGTACAGAAACATGCACCTGG + Intronic
1076270209 10:129145901-129145923 AATGTAATGAAACATTCAGCTGG + Intergenic
1077822465 11:5761701-5761723 AATACCATGAAACTGGTACCAGG - Intronic
1077927918 11:6700267-6700289 AATTTTATGAAATATGCACCTGG - Intergenic
1079030664 11:16983854-16983876 AATATTATTAAAGATGGACCTGG - Intronic
1079085162 11:17439994-17440016 TATATAAGAAAACATGTCCCAGG + Intronic
1079788771 11:24709945-24709967 AATTTAAATAAACATGAACCAGG + Intronic
1079817931 11:25085953-25085975 AATACTATGAAACATGTAAATGG - Intergenic
1081049924 11:38325638-38325660 ATTATAATGAAATCTGTACATGG + Intergenic
1081626318 11:44657783-44657805 AATAAAATAAAATATGTATCGGG + Intergenic
1082937251 11:58667937-58667959 AATATTATGAATAATGTAACAGG + Intronic
1083014248 11:59436463-59436485 AATATAATGAAACATCTCCAAGG + Intergenic
1084722831 11:70919001-70919023 AAAAAAATTAAAAATGTACCGGG + Intronic
1085289013 11:75384092-75384114 AAAATAATGAAACAGGGGCCGGG - Intergenic
1087295039 11:96362175-96362197 AATATAATGAAACATGTACCAGG + Intronic
1087362853 11:97182525-97182547 AAGACAATGTTACATGTACCTGG - Intergenic
1087869866 11:103279194-103279216 AATATAATAAAACATCTTTCTGG - Intronic
1087942406 11:104114802-104114824 CATCTAATGAAATATGTACGGGG - Intronic
1091102111 11:132884441-132884463 AATATAAGGAGACAAATACCAGG + Intronic
1094049157 12:26199824-26199846 AAAATAATGAATCAACTACCTGG + Intronic
1094054009 12:26250119-26250141 AACCTAATGAAACAAGTACTGGG - Intronic
1094114315 12:26893814-26893836 CATTTAATGAACCATGTGCCAGG - Intergenic
1095202191 12:39397346-39397368 AATATAGTGAAACACATATCAGG + Intronic
1095273733 12:40254284-40254306 AATATAAAGAAACATGCATGAGG - Intronic
1095280255 12:40343025-40343047 AATATAAAAAAACATTTACAAGG + Intronic
1099653399 12:85457794-85457816 AATAAAATCAAACAGGTAACAGG - Intergenic
1102077119 12:110068447-110068469 AATTTATTGAATCATGTAACTGG - Intronic
1104082610 12:125443674-125443696 ATTATAATTAAACATTTACAAGG + Intronic
1104236728 12:126945522-126945544 AATATAAAGAAAGATAAACCTGG - Intergenic
1104549767 12:129745743-129745765 AATATCATGTTAAATGTACCTGG - Intronic
1106706640 13:32287353-32287375 AATATAATGAACAATCTACATGG - Intronic
1106940301 13:34770643-34770665 AACATAAAAAAATATGTACCTGG + Intergenic
1107129203 13:36877430-36877452 AATATCTTGTAAAATGTACCTGG - Intronic
1107129917 13:36884211-36884233 ACTAAAATGAAACAAGTAGCTGG - Intronic
1107139428 13:36981390-36981412 AAAATAATGAAACAGGAACGTGG - Intronic
1109390599 13:61686201-61686223 AATAAAATGAAAAATTTAACAGG + Intergenic
1109458340 13:62623797-62623819 AATATAACTAAACATGGAGCTGG + Intergenic
1109485966 13:63020215-63020237 AGAATAATGGAACATGTACCTGG + Intergenic
1109584282 13:64377648-64377670 AATAAAATCAAATAAGTACCTGG + Intergenic
1110150110 13:72241646-72241668 AATATAATAAAACATTATCCAGG + Intergenic
1110325500 13:74210071-74210093 AATATTATAAAACAGATACCTGG + Intergenic
1110438315 13:75499527-75499549 AATATAAAGAATCATGTCCATGG - Intergenic
1111212886 13:85103196-85103218 AATATATAGAAAGATATACCAGG + Intergenic
1111915558 13:94356738-94356760 ATTAAAATGAAAAATGTAGCTGG + Intronic
1114056342 14:18970582-18970604 AATATAATCAAACTTGTTTCTGG + Intronic
1114106209 14:19431145-19431167 AATATAATCAAACTTGTTTCTGG - Intronic
1114980990 14:28164051-28164073 AAAATACTGAAACATGGCCCCGG - Intergenic
1115531760 14:34334266-34334288 AAAAAAAAGAAACAGGTACCTGG + Intronic
1116722151 14:48511139-48511161 AATAAAATGTAACATTTACGAGG + Intergenic
1116766978 14:49084592-49084614 AATATATTCATATATGTACCTGG - Intergenic
1116836981 14:49778454-49778476 TAGATACTGAAACATTTACCTGG + Exonic
1118953331 14:70455175-70455197 AATATAAGGAAACTTGAATCAGG + Intronic
1120519958 14:85515504-85515526 AATAAGATGAAACATCTACAGGG + Intergenic
1120698862 14:87675729-87675751 AATAAAATGAAAAATGAACAGGG + Intergenic
1124939853 15:34208071-34208093 AATAAAATAAAAAATGTGCCAGG - Intronic
1125066301 15:35489353-35489375 AATTTAATGAAACTGGGACCAGG - Intronic
1125778373 15:42239857-42239879 AATATAATGTAATATTGACCAGG - Intronic
1131640919 15:94292547-94292569 AACCTAATAAAACATGTACTGGG + Intronic
1135500641 16:22992910-22992932 AATAAAATGAAAAATGAACCAGG + Intergenic
1136958565 16:34816453-34816475 AATATATTGAATCATGTCCAAGG - Intergenic
1138629324 16:58280994-58281016 AAGAAAATGAAATATGAACCAGG - Exonic
1139038479 16:62976298-62976320 AATATAATGTAGGATGTAGCAGG + Intergenic
1140601414 16:76480377-76480399 AATGTAATGAAAGATGTACAAGG + Intronic
1143397503 17:6613225-6613247 AATCTAATGAAAGAAGTACAAGG + Intronic
1146580868 17:34037509-34037531 GATCTGATGAAACCTGTACCAGG - Intronic
1146814005 17:35927844-35927866 AAGATTATGAAACATTTACTTGG - Intronic
1148529148 17:48372598-48372620 AATAAAATAATACATGTGCCGGG - Intronic
1149376306 17:56047564-56047586 CATAAAATGAAATATGAACCAGG + Intergenic
1150122115 17:62612655-62612677 GATCTGATGAAACCTGTACCAGG + Exonic
1151041723 17:70869465-70869487 AATAAAATGTAACTTGAACCTGG - Intergenic
1151043844 17:70896061-70896083 ATGGTAATGAAACATGTAGCTGG + Intergenic
1151232881 17:72697378-72697400 AATAAAATGAAATATGTGCCAGG - Intronic
1153431695 18:5024328-5024350 AATAGAAAGAAACAGGCACCAGG - Intergenic
1155391026 18:25336855-25336877 AGTAAAAAGAAACATTTACCAGG + Intronic
1155575099 18:27236484-27236506 ATTATAATGCAACATAAACCGGG + Intergenic
1155602454 18:27565264-27565286 AATATAATGAAACTATAACCAGG + Intergenic
1156567580 18:38212493-38212515 AATCTAATGAAACATGTATTGGG + Intergenic
1158384108 18:56969531-56969553 AATATAAAGATAAATGTAACTGG - Intronic
1159361536 18:67410934-67410956 TATTTAATGATACATGTACTTGG + Intergenic
1159799875 18:72885069-72885091 ACTTAAATGAAACAAGTACCTGG + Intergenic
1159817723 18:73096808-73096830 AATACAATGAAACATATTACCGG - Intergenic
1161206416 19:3043494-3043516 AATATCAGAAAACATCTACCTGG + Intronic
1161247273 19:3259977-3259999 TATATAATTTAACATGTTCCAGG + Intronic
1162083399 19:8233466-8233488 AATATAAAAAAACAACTACCTGG - Intronic
1162650544 19:12085590-12085612 AATATAATGAAACCAGGGCCAGG + Intergenic
1163224304 19:15945232-15945254 AATATAAAGAAACATGTCTCAGG - Intergenic
1163919394 19:20274707-20274729 AATAAAAACAAACATGCACCAGG + Intergenic
1165447286 19:35863261-35863283 AATAAAATAAAAAATGAACCGGG + Intronic
925023718 2:591368-591390 AATATCATGAAAAATAAACCTGG + Intergenic
927337371 2:21940878-21940900 ATTATAATTAAATATTTACCAGG + Intergenic
927418634 2:22906180-22906202 AATAAAATGAAATAGGCACCTGG + Intergenic
928468698 2:31551138-31551160 AATCTAACCAAACATGTACAAGG + Intronic
928937507 2:36694746-36694768 AATGTAATGATATATGTACAGGG + Intergenic
930609877 2:53530244-53530266 AATATATTAAACCATGTATCAGG - Intergenic
930861365 2:56077566-56077588 AAGATAATGAAACCTGTATGAGG - Intergenic
932306691 2:70708667-70708689 AACTTAATGTAACATGTCCCAGG - Intronic
933029016 2:77302481-77302503 AATATAATGAAAAATATCACAGG + Intronic
935047339 2:99493967-99493989 AATATAATGAAACAAGAAGAAGG + Intergenic
937978814 2:127599263-127599285 AATCTAATAAAACATGTACAGGG - Intronic
938285959 2:130117485-130117507 AATATAATCAAACTTGTTTCTGG - Intronic
938336607 2:130506048-130506070 AATATAATCAAACTTGTTTCTGG - Intronic
938429647 2:131221417-131221439 AATATAATCAAACTTGTTTCTGG + Intronic
939562267 2:143746303-143746325 AATATAATGTAACATTTAGAGGG - Intronic
939753040 2:146072691-146072713 TATCTAATGAAACATGTTTCTGG + Intergenic
940135233 2:150428040-150428062 TATATAATTAGACATGTGCCAGG + Intergenic
940680342 2:156777458-156777480 GATATAATTAAAGATGTCCCTGG - Intergenic
941721377 2:168816550-168816572 AAGGTGATGAAACATCTACCAGG - Intronic
942137423 2:172940929-172940951 AATCTAACAAAACATGTACAGGG - Intronic
942349128 2:175034591-175034613 AATATCATGAAAAATGTCACAGG - Intergenic
942919796 2:181358552-181358574 AATATAATGATAGATGTATATGG - Intergenic
943467110 2:188241338-188241360 AATATAATTAAGCATTTATCAGG - Intergenic
944028970 2:195209371-195209393 AATTTAATGAAATATGTACAAGG - Intergenic
944306352 2:198184203-198184225 AACATAATGAAAAGAGTACCAGG - Intronic
946975606 2:225146359-225146381 AATTTAATTAAACAAGTGCCAGG + Intergenic
1168879016 20:1190720-1190742 AATATAGTGATTCATGTAACTGG + Intergenic
1170034700 20:11978126-11978148 AATGCAAACAAACATGTACCAGG - Intergenic
1170083756 20:12506201-12506223 AATAGAATAAATCATGTGCCAGG - Intergenic
1170823168 20:19771374-19771396 TATATTATGAAACATATACCTGG - Intergenic
1172017304 20:31884994-31885016 AATTTAATTAAAAATGTACAAGG + Intronic
1172260637 20:33561428-33561450 GTTATAATGAAAAATGTACAGGG + Intronic
1174000348 20:47370057-47370079 AATAAAATAAAATTTGTACCTGG - Intergenic
1178002708 21:28181815-28181837 AATATAGAGAAATTTGTACCAGG + Intergenic
1178227863 21:30744699-30744721 AATATAATGAAAAATGAAACTGG + Intergenic
1180474827 22:15693193-15693215 AATATAATCAAACTTGTTTCTGG + Intronic
1180789977 22:18570465-18570487 AATATACTGAAAAAGGTATCGGG + Intergenic
1181231762 22:21424850-21424872 AATATACTGAAAAAGGTATCGGG - Intronic
1181246889 22:21510018-21510040 AATATACTGAAAAAGGTATCGGG + Intergenic
1183591604 22:38782334-38782356 ACTATAATGAAAAATGAAGCAGG - Intronic
949974979 3:9448154-9448176 AAAATAAGGAAACAGGTAGCAGG - Intronic
950821519 3:15764863-15764885 AATATGGTTAAACATGGACCTGG - Intronic
953140903 3:40228344-40228366 TATATATTAAAACATGTTCCTGG + Intronic
953147369 3:40291030-40291052 AATAAGCTGAAACATGTTCCTGG - Intergenic
953505159 3:43478898-43478920 AATATTATAAAACAGGTACTTGG - Intronic
953724201 3:45383189-45383211 AATTTAATGCAAAATGTCCCTGG + Intergenic
955270488 3:57493037-57493059 ACTTTAATGAAACATATACTTGG + Intronic
955840227 3:63104857-63104879 GATATAATGAAGAAAGTACCTGG + Intergenic
956680738 3:71777507-71777529 AAAAAAATAAAACAAGTACCAGG + Intronic
956975523 3:74574491-74574513 AATTTAATGAAACATAAAGCAGG - Intergenic
957213202 3:77287895-77287917 AATAAAATGAAATCTGTACGTGG - Intronic
957760545 3:84549467-84549489 TATATAATGAAAGATATAACAGG - Intergenic
958172375 3:89954286-89954308 TATATAATGAAACCTGAACTGGG + Intergenic
958693709 3:97501391-97501413 AATATAATTGATCATGTTCCAGG + Intronic
958991283 3:100848782-100848804 AATATAAAGAGACATTTACCAGG + Exonic
960341674 3:116482095-116482117 AATCTAATAAAATATGTACAAGG + Intronic
961165672 3:124762073-124762095 AATATGATGAAACAGAGACCTGG - Exonic
963726878 3:148932840-148932862 AATAGAATTAATCATGTACGGGG + Intergenic
963735315 3:149012074-149012096 AATATAAGGAAAAATGTCTCTGG - Intronic
964741904 3:159975255-159975277 AATATAATTAAGCATTTCCCTGG + Intergenic
967000780 3:185332092-185332114 TATAAAATGATACATGTACAAGG - Intronic
967503826 3:190230745-190230767 TATATCATGAAAAATGTATCAGG - Intergenic
969412694 4:7039940-7039962 AGTCTAATGAAACATGTTCTTGG - Intergenic
969857441 4:10011466-10011488 AGTATAATGAAGCAGGTTCCAGG + Intronic
969998160 4:11336340-11336362 ATTATAATAAAACCTGTAGCGGG + Intergenic
970019871 4:11556205-11556227 AAAATAATTAAACTTGTATCAGG - Intergenic
970579561 4:17462798-17462820 AATATAATTAAACATTTAGGAGG - Intronic
970953368 4:21782216-21782238 AATATAATGATATATATACGTGG + Intronic
971679586 4:29679333-29679355 AATAGAATAAAAGATGTAGCAGG + Intergenic
971921632 4:32947713-32947735 AATAAAATGAAACAAAAACCTGG - Intergenic
973178477 4:47239008-47239030 AATAAAATAAAGCCTGTACCAGG - Intronic
974154867 4:58058118-58058140 AATATAATGAAATATGAACATGG - Intergenic
974377112 4:61093073-61093095 AATATAATCAAACATTGACTGGG + Intergenic
975650360 4:76586647-76586669 AGAATAAAGAAACATGTACATGG + Intronic
976447752 4:85150987-85151009 AATATAAGAAAACAAGCACCTGG - Intergenic
976610875 4:87029115-87029137 AATAAAAAGAAACAGGTAACAGG - Intronic
977122462 4:93120275-93120297 ACTATAATGACACATGCACACGG + Intronic
979108754 4:116723074-116723096 AATTTAATGAAACATGAGCTTGG + Intergenic
979496506 4:121389726-121389748 AATATAATGAAACTTGCTCAAGG + Intergenic
980338745 4:131513145-131513167 AATCCAATGAAAGTTGTACCAGG + Intergenic
980379527 4:131993599-131993621 AATATAATGATATATGTACTTGG + Intergenic
980820695 4:138012304-138012326 AATATAATCAATCATGTAAGTGG + Intergenic
981123827 4:141083039-141083061 AATATAATTAAACATCTTCAGGG - Intronic
981283001 4:142982576-142982598 AATGTAAAGAAACATATAGCAGG + Intergenic
982717415 4:158823651-158823673 AATAGAATGAAACAGATTCCTGG - Intronic
984156236 4:176198795-176198817 AATATGATGAAACTTGCACCAGG - Intergenic
986276592 5:6280478-6280500 AATATGAAGAAGCATATACCAGG - Intergenic
986781786 5:11073052-11073074 AATATAATCAAACATCAGCCAGG + Intronic
987140758 5:14943648-14943670 AATATCCTGAAACAGGTGCCTGG + Intergenic
988278246 5:29111557-29111579 TATATAATGATACAAGGACCAGG - Intergenic
988428779 5:31094414-31094436 AATATAATGGAAAATGGGCCTGG + Intergenic
988564182 5:32307909-32307931 GATGTAATGATACCTGTACCTGG - Intronic
989524499 5:42437902-42437924 AATATAAGAAAATATATACCAGG - Intronic
990177900 5:53127934-53127956 AATTTAATGGAGCATGCACCAGG + Intergenic
991393764 5:66181037-66181059 AACATAAAGAAACATGTAATAGG - Exonic
991630633 5:68653417-68653439 CATAAAATGAAACATGTCACAGG - Intergenic
991961391 5:72048139-72048161 AATCTGATGGAAGATGTACCTGG + Intergenic
991983699 5:72260676-72260698 AACATAATAAAATATGTATCAGG + Intronic
993261658 5:85664988-85665010 ACTATAATGATACATGTAGGAGG - Intergenic
994667960 5:102730037-102730059 AATATAATGAAACTAGTAGCAGG - Intergenic
996250331 5:121320906-121320928 AATATAGTGGAACTTGTACATGG + Intergenic
996397146 5:123024807-123024829 AATAAAATGAAACATGGAAGAGG + Intronic
996576412 5:124981336-124981358 TAAATAATGAGACATATACCAGG - Intergenic
997001179 5:129763964-129763986 AATATAATGAAGCATGAAGTAGG + Intronic
997408017 5:133667730-133667752 AATATGAAGAAAGATGTAGCAGG - Intergenic
997462866 5:134066510-134066532 AATATACTAACACATGTAGCAGG - Intergenic
997682577 5:135766542-135766564 AATATTATGAACCATATAACAGG - Intergenic
997687007 5:135795794-135795816 GATATTATGAACCATGTAACAGG - Intergenic
997822695 5:137080091-137080113 AATATAACTAATCATGAACCTGG + Intronic
998473160 5:142399091-142399113 AAAATAATGATACATGGGCCAGG + Intergenic
999477069 5:151910214-151910236 AATAAAAGGCAACCTGTACCAGG - Intronic
1000158812 5:158579178-158579200 AAGATAATGAAACAGAAACCTGG - Intergenic
1000998736 5:167984994-167985016 GTTATAATGAAACATTTAGCTGG - Intronic
1001422478 5:171598344-171598366 AATCTAATGATTCATGTAACTGG - Intergenic
1002089043 5:176793666-176793688 GATATAATTAAACATGTGCGTGG + Intergenic
1002207905 5:177576757-177576779 AGTATAAAGAAACAGGTGCCTGG + Intergenic
1003002137 6:2346237-2346259 AATGAAATGAACCATGTACAAGG - Intergenic
1003759747 6:9163882-9163904 AAAATAATTGAATATGTACCTGG + Intergenic
1005381465 6:25238803-25238825 AATATTTTGAAAAATGTATCTGG - Intergenic
1005517341 6:26567508-26567530 CATATAATGAAACATGCACAGGG - Intergenic
1005673081 6:28126699-28126721 AATCAAATGAAACATCTTCCAGG - Intronic
1006212916 6:32412619-32412641 AACATAATTAAACATGGACGAGG + Intergenic
1006972478 6:38060771-38060793 TATATAAAAAAAAATGTACCTGG - Intronic
1007991069 6:46256399-46256421 AATAAAATAAAATATGTTCCAGG + Intronic
1009714082 6:67364871-67364893 AATAAAATGAAATTTGTACCAGG - Intergenic
1009738693 6:67714749-67714771 AACATTTTGAAAAATGTACCTGG + Intergenic
1009920615 6:70055344-70055366 TATAAAATTACACATGTACCAGG + Intronic
1010601225 6:77828717-77828739 AATATTTTGAAACATGAAACAGG - Intronic
1010717741 6:79249101-79249123 AATGTAGTGAAACATATAACAGG - Intergenic
1012841548 6:104334630-104334652 AAAATAATGAAATAAATACCAGG - Intergenic
1017283299 6:152646397-152646419 AATATAATGAAACATAGAGAAGG + Intergenic
1017309417 6:152958535-152958557 TATATAAACAAACATGTACATGG - Intergenic
1017759235 6:157555492-157555514 CATGTAATGAAAAATGTTCCTGG + Intronic
1018310067 6:162499298-162499320 AATAATATGAAAGATTTACCAGG - Intronic
1020695791 7:11412648-11412670 ATTATAATGTAACAGGTACATGG - Exonic
1020750896 7:12140666-12140688 TATATGATGAAACATTGACCAGG - Intergenic
1020890003 7:13867338-13867360 AATATAAAAAAAAATCTACCTGG + Intergenic
1021157099 7:17223814-17223836 AATAAAATTAAACATGTCCATGG + Intergenic
1021829320 7:24587838-24587860 AATATTATGAAACATTTAGTAGG + Intronic
1022268782 7:28785612-28785634 AATATAATCAAACATTAACAAGG - Intronic
1022860795 7:34364513-34364535 AATGAAATGAAGCATGTAGCTGG + Intergenic
1023629280 7:42147556-42147578 AATATAAAGAAAAATGTATAAGG - Intronic
1024328942 7:48137286-48137308 AATATAGTTAAACATGAAGCTGG - Intergenic
1024371037 7:48584092-48584114 AAAATAATAATATATGTACCTGG - Intronic
1026413629 7:70155047-70155069 CCTATAATGAAACATCCACCTGG - Intronic
1027958620 7:84915432-84915454 AATATAGTAAAATAGGTACCTGG + Intergenic
1027977857 7:85181822-85181844 AAAATTATGAAACATGAACATGG + Intronic
1028570758 7:92284246-92284268 AAGATAATGAGGCATGTACTGGG + Intronic
1029475443 7:100780733-100780755 AAAATACTGAGACATGAACCAGG - Intronic
1030275565 7:107717816-107717838 AATATAATAAAGAATGTGCCAGG + Intergenic
1030889389 7:114980540-114980562 AATACAATGAATCATGTAAAGGG - Intronic
1031271945 7:119662313-119662335 AACATAATGAAAGATGTAACAGG + Intergenic
1031610051 7:123815430-123815452 AATATAATGAGAAATGTAGTTGG - Intergenic
1032016974 7:128386452-128386474 AATATATTTAAACAAATACCTGG - Intergenic
1032252238 7:130268104-130268126 AATACAATGAGCCATGTACAGGG - Intronic
1032679681 7:134168801-134168823 AAGATAAAGAACCATGAACCAGG - Intronic
1032946655 7:136861573-136861595 AATATAAGGCAATATGTATCTGG + Intergenic
1034479968 7:151312222-151312244 AACATAATGAAACATGGAAAAGG + Intergenic
1034817170 7:154182538-154182560 AGGATAATGTAACATGTGCCCGG + Intronic
1035069791 7:156134988-156135010 AATCTATTGAAACATGCACAGGG - Intergenic
1037063934 8:14552586-14552608 ATTATAATGCAACATGGTCCTGG - Intronic
1038915600 8:32018112-32018134 GATATTATAAAACATGTATCTGG - Intronic
1039291965 8:36105980-36106002 AATCTAACAAAACATGCACCAGG + Intergenic
1041846320 8:62333344-62333366 ACTATAATGAAGCTAGTACCAGG - Intronic
1042476086 8:69249345-69249367 AATATAATTATATATGTAACAGG + Intergenic
1042550756 8:69992216-69992238 AATATAAAGAAACATATGCCTGG + Intergenic
1043183951 8:77121154-77121176 AATATAATGAAATCTACACCAGG - Intergenic
1043635756 8:82379144-82379166 AATATTATGAACAATGTAACAGG - Intergenic
1044090397 8:87993023-87993045 AATAAAATAAAATATGTACGTGG + Intergenic
1044174342 8:89099709-89099731 AATAAAATGAAAGTTGAACCTGG - Intergenic
1045218363 8:100172267-100172289 AATATAAGTAAATATGTATCTGG - Intronic
1045289685 8:100821870-100821892 AATATAATAAAACATGAAGCAGG - Intergenic
1046372885 8:113334313-113334335 AATACAAGGAAATATGTAACAGG - Intronic
1046505819 8:115136752-115136774 ATTATAAAGACACATGCACCTGG - Intergenic
1048024373 8:130571233-130571255 AATACAAAGAAAAATATACCTGG + Intergenic
1048480347 8:134784324-134784346 TATACAATGAAAAATGTACAAGG - Intergenic
1053836905 9:42147686-42147708 AATTCAATAAAATATGTACCAGG + Intergenic
1056528910 9:87469786-87469808 AATAATATGAAATATGTGCCTGG + Intergenic
1057778721 9:98032923-98032945 ATAAAAATGAAACATGTGCCAGG + Intergenic
1186236797 X:7520662-7520684 AATATAATGATACATATTCATGG + Intergenic
1187018493 X:15354512-15354534 AATATAAAGAAACAAGTAAAGGG - Intronic
1188694714 X:33176436-33176458 AATATAATTATACGTATACCTGG - Intronic
1189057668 X:37715642-37715664 AATAAAGTGAAAAAAGTACCAGG - Intronic
1191873067 X:65766296-65766318 ATTTTAATGAAACATTTACTAGG - Intergenic
1194625636 X:96223721-96223743 AATATAATGAAATAAATATCTGG - Intergenic
1194716752 X:97295485-97295507 AAAATAATCAAATATGTGCCAGG + Intronic
1195400313 X:104454507-104454529 AACATATTGAAACAAGTACACGG + Intergenic
1198784885 X:140276251-140276273 AATCTAACAAAACATGTACAGGG - Intergenic
1198941030 X:141955384-141955406 AAGATGATGAAACATCTTCCTGG - Intergenic
1200089982 X:153630572-153630594 AATATCATGAAAACTGTAACTGG + Intergenic
1202015809 Y:20405387-20405409 AATATTTTACAACATGTACCAGG - Intergenic
1202031476 Y:20578685-20578707 AATAGAATAAAACATATACCTGG - Intronic