ID: 1087296648

View in Genome Browser
Species Human (GRCh38)
Location 11:96384880-96384902
Sequence ATGAAATATCTGAGTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 1, 2: 4, 3: 28, 4: 337}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087296647_1087296648 -5 Left 1087296647 11:96384862-96384884 CCACAAACACAAAATCACATGAA 0: 1
1: 0
2: 6
3: 68
4: 602
Right 1087296648 11:96384880-96384902 ATGAAATATCTGAGTGAAGATGG 0: 1
1: 1
2: 4
3: 28
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087296648 Original CRISPR ATGAAATATCTGAGTGAAGA TGG Intronic
903390034 1:22957386-22957408 ATGAAATTGCTGAGTCAAGGGGG + Intronic
905390370 1:37632517-37632539 ATGACATATATGATTGAAGCTGG + Intronic
905671254 1:39791729-39791751 ATGAAACACCTGAGTGCAAAGGG - Intergenic
906169075 1:43708221-43708243 AGAAAATATCTTAGTGAGGAGGG + Intronic
906740053 1:48173683-48173705 ATGAAATAATGGAATGAAGATGG - Intergenic
908328971 1:63051686-63051708 AGGCAATATCTGGGGGAAGAAGG + Intergenic
909716924 1:78719514-78719536 TTGAAATAAATGAATGAAGAAGG - Intergenic
910077107 1:83294491-83294513 GTGAAATATCAGAGTGCTGAAGG + Intergenic
910423473 1:87096100-87096122 ATTATATATCTGTGTGAAGCTGG - Intronic
910534611 1:88283008-88283030 ATCAAATAGCTCAGTGAAAATGG + Intergenic
910772691 1:90845824-90845846 ATGAAATCTCTAAGAAAAGAAGG + Intergenic
911039905 1:93583257-93583279 ATAAAATATATGAGCGAGGAGGG + Intronic
912347587 1:108978941-108978963 TTGAGATATCTGAGTAAAAAAGG + Intronic
913223132 1:116675408-116675430 ATGGAAGATCTGAGAGAAGAGGG + Intergenic
913229367 1:116728990-116729012 AAGAAATATCTGAATTATGAGGG + Intergenic
913558065 1:119989141-119989163 ATGCAATAGCTGAGTGAATATGG + Intronic
913614263 1:120541310-120541332 TTGTAAAATCTGAGTTAAGAGGG - Intergenic
914576006 1:148969590-148969612 TTGTAAAATCTGAGTTAAGAGGG + Intronic
914906918 1:151753932-151753954 AGGAAATATCATAGTGAGGAAGG + Intergenic
915170767 1:153975712-153975734 ATGGAATATCTGAAAGAAGAGGG - Intronic
915773750 1:158459511-158459533 ATGAAATATGTGGATGCAGAAGG - Intergenic
916091768 1:161313058-161313080 AAAAAAGATCTGAGTGAAAAAGG + Intergenic
918192441 1:182188672-182188694 TGGAAATGTCTGAGTGAAAAGGG - Intergenic
918574372 1:186038815-186038837 ATGTAATAACTGAAAGAAGAAGG - Exonic
919092998 1:192996569-192996591 ATGACATATCTAATTCAAGAAGG - Intergenic
919429321 1:197473139-197473161 ATGACATTTCTGAGAGAAGTGGG + Intronic
921036694 1:211385698-211385720 ATCAAATATCTGACTGGATATGG + Intergenic
921845892 1:219881587-219881609 ATGAAATATCTGACAGTAAAGGG + Intronic
922040536 1:221891897-221891919 ATGCAATATCAGGGTGAACAAGG + Intergenic
923041582 1:230323612-230323634 ATGAAATACCTGAGGACAGAGGG + Exonic
923053180 1:230403341-230403363 TTCAGGTATCTGAGTGAAGATGG + Intronic
923859418 1:237878053-237878075 CTGAATATTCTGAGTGAAGATGG + Exonic
924112917 1:240717477-240717499 ATGCAATGTGTGAGTGCAGAGGG + Intergenic
924551656 1:245083667-245083689 ATCAAGTATATGACTGAAGAAGG + Exonic
924633460 1:245763495-245763517 AAAAAATAGCTGTGTGAAGATGG + Intronic
924686602 1:246298532-246298554 ATAAAATATCAGAGACAAGATGG + Intronic
924948985 1:248865508-248865530 ATAAAATATCTGAGGGAAGAGGG - Intergenic
1063120595 10:3103076-3103098 ATGAGAAATCAGTGTGAAGATGG + Intronic
1063248832 10:4252138-4252160 GTGAAGCATCTGAGGGAAGAGGG + Intergenic
1065459131 10:25937293-25937315 GTAAAATATATGAGTGAAGCAGG - Intronic
1066083247 10:31952980-31953002 ATGAAATAAAGGAGTGAGGACGG + Intergenic
1066287240 10:33980219-33980241 ATGTGATATGTAAGTGAAGATGG + Intergenic
1066542443 10:36462138-36462160 ATGCAAGATCAGAGTGAAGTAGG - Intergenic
1067228679 10:44391919-44391941 GAGAAATATCTCAGGGAAGAGGG + Intergenic
1068342433 10:55723967-55723989 ATGAAATGCCTGAGAGGAGAGGG - Intergenic
1068730088 10:60348173-60348195 ATGAAATAGCAGAGGCAAGATGG - Intronic
1069078518 10:64063897-64063919 ATGCAATGACTGAGTGGAGAAGG + Intergenic
1069086920 10:64151428-64151450 ATGAAATATATGAGTGCTAAGGG - Intergenic
1069130833 10:64700213-64700235 ATGTAATATGTGAGACAAGATGG + Intergenic
1069155223 10:65021214-65021236 ATGAAAAAACTGACTCAAGATGG + Intergenic
1070855553 10:79605767-79605789 ATGAAATAGCTGAGGGAAACGGG - Intergenic
1071318276 10:84424843-84424865 ATGTAAGCACTGAGTGAAGATGG + Intronic
1072010300 10:91297785-91297807 ATGAAAGAACTGAGTGGGGAAGG - Intergenic
1072186656 10:93046511-93046533 AAGAGCTACCTGAGTGAAGAAGG + Intronic
1072487016 10:95865283-95865305 CTGAAAGCTCTGTGTGAAGAAGG + Intronic
1072517422 10:96199378-96199400 ATTAAAAATTTGAGTCAAGATGG - Intronic
1073610407 10:104937577-104937599 ATTAAATATCTGAGTCAAGAAGG + Intronic
1075217007 10:120544896-120544918 AGCAAATGTCTGAGTGGAGATGG - Intronic
1075245779 10:120821162-120821184 CTGAGATATCAGAGTGCAGAGGG - Intergenic
1076222239 10:128743616-128743638 GAGAAAGATCTCAGTGAAGATGG + Intergenic
1076272621 10:129167548-129167570 ATGAATGCTCTGGGTGAAGATGG + Intergenic
1076280601 10:129243165-129243187 ATGAAATATCCACGTTAAGATGG + Intergenic
1077728021 11:4696207-4696229 TTGAAGTAACTGAGTGATGATGG - Intronic
1078299610 11:10114296-10114318 ATGAGATCTCAGATTGAAGATGG - Intronic
1079515993 11:21269534-21269556 ATGAAATATGTAAGTGTTGAGGG + Intronic
1079989467 11:27231696-27231718 AGGAAATAGCTGTTTGAAGACGG - Intergenic
1080710836 11:34746487-34746509 TTGATATATATGAGTGAATAGGG + Intergenic
1081308421 11:41541557-41541579 ATGGATTATCTAACTGAAGATGG + Intergenic
1081729283 11:45357685-45357707 CTGCAATAACTGGGTGAAGAGGG - Intergenic
1081825769 11:46049975-46049997 ATGAAATATATGATAGAATATGG - Intronic
1082914851 11:58422140-58422162 ATGTAATACCTGAATGAGGAAGG - Intergenic
1082988487 11:59187437-59187459 CTGTAACATGTGAGTGAAGAAGG + Intronic
1084137113 11:67192938-67192960 ATCAAGTATTTGAGTGAATATGG - Intronic
1085632635 11:78131842-78131864 ATGAAGGGCCTGAGTGAAGATGG - Intronic
1086002389 11:81998720-81998742 ATGAAATAGCTGAGGGAAACAGG - Intergenic
1086213170 11:84345592-84345614 ATCAAATATTGAAGTGAAGATGG + Intronic
1087021507 11:93607948-93607970 ATGAGACAACTGAGTGATGATGG + Intergenic
1087296648 11:96384880-96384902 ATGAAATATCTGAGTGAAGATGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088536655 11:110868787-110868809 ATTAAATAACTATGTGAAGAGGG + Intergenic
1088760792 11:112927108-112927130 ATGGGATATCAGAGTGAAAAAGG - Intergenic
1088773818 11:113062592-113062614 GTAAAATATGAGAGTGAAGAAGG + Intronic
1092204144 12:6605640-6605662 ATGTAATAGCCTAGTGAAGAGGG - Intronic
1092448180 12:8577234-8577256 ATGACATCTTTGAGTGCAGATGG + Intergenic
1093253539 12:16837852-16837874 ATGAAATGACTGATTGAAGAAGG - Intergenic
1094072623 12:26434674-26434696 ATGACATATCTTAGAGTAGAAGG - Intronic
1095749063 12:45691326-45691348 GGGAAATATCTGAGAGTAGAAGG + Intergenic
1096695897 12:53348050-53348072 ATTAAATATGTGAGTAAAGATGG - Intergenic
1098831548 12:75370979-75371001 ATGCAATAGCTGAGGGAAGCTGG - Intronic
1099072264 12:78060111-78060133 GTCAAAATTCTGAGTGAAGAGGG - Intronic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1099176265 12:79426518-79426540 ATGAATTTTCTTAGAGAAGAGGG - Intronic
1099481710 12:83175143-83175165 ATAAAATTCCGGAGTGAAGAGGG + Intergenic
1099573146 12:84350831-84350853 ATGAAATACATGAGTACAGAGGG - Intergenic
1100207863 12:92370588-92370610 ATGAAATGTGTGTGTGAGGAGGG + Intergenic
1100453371 12:94729049-94729071 ATGACAGATCTTAGTGATGATGG - Intergenic
1100844956 12:98648341-98648363 GAGAAAGATCTGAGGGAAGATGG + Exonic
1101551728 12:105769224-105769246 TTGCAATAACTTAGTGAAGAAGG + Intergenic
1102733833 12:115139595-115139617 TTGAAATATCTAAGAGAAGATGG - Intergenic
1104072076 12:125354493-125354515 GTGACATATCTGAGTGAAATGGG - Intronic
1106492329 13:30237891-30237913 ATGTAATATATGTGTCAAGAAGG - Intronic
1106630730 13:31469313-31469335 AGAAAATATCTGAGTTAAAATGG - Intergenic
1107135894 13:36943702-36943724 ATAAAATAACTGAATAAAGAAGG + Intergenic
1107179686 13:37444441-37444463 ATGAAATTTCAGAGTTGAGAGGG - Intergenic
1107439697 13:40414958-40414980 AGGAAAGAACTGAGTGAAGTGGG + Intergenic
1108289306 13:48942364-48942386 AGGGAGTATCTGAGTGAGGAGGG + Intergenic
1109131283 13:58589389-58589411 ATGATTAATCTTAGTGAAGAAGG + Intergenic
1110070297 13:71167356-71167378 ATGAAATATCTGGGGGAAAATGG - Intergenic
1110211779 13:72981986-72982008 ATGAGATAACTGAGTTTAGAGGG - Intronic
1110599364 13:77354446-77354468 ATGAATTAACTGAATGAAGCAGG + Intergenic
1111131154 13:83977298-83977320 ATGAAATTTGAAAGTGAAGAAGG - Intergenic
1111353074 13:87059016-87059038 AAAAATTATCTCAGTGAAGATGG + Intergenic
1114204324 14:20554444-20554466 TTGAAATGTCTGAGTGAATAAGG - Intergenic
1114206924 14:20580846-20580868 ATGAAATATCAGAGTATAGTGGG + Intergenic
1116035414 14:39621291-39621313 ATGAAAAATGTGATTGGAGAGGG + Intergenic
1116447936 14:45033623-45033645 ATGAAAAATCAGAGTTTAGATGG - Intronic
1116641378 14:47467923-47467945 ATGAAATGTCTGTATGAAGATGG + Intronic
1116724034 14:48538269-48538291 ATGAAAAATCTGGGTGGATATGG + Intergenic
1116902640 14:50376576-50376598 ATGTTATTGCTGAGTGAAGAAGG + Intronic
1117455563 14:55893668-55893690 AAGCAATATCTGAGTAAGGAGGG + Intergenic
1118692298 14:68351876-68351898 ATGAATTAGATGGGTGAAGAGGG + Intronic
1119110016 14:71963267-71963289 ATGGAAGTTTTGAGTGAAGAAGG - Intronic
1120325678 14:83022369-83022391 ATGAAATATATGAGAGATGATGG - Intergenic
1120817325 14:88875913-88875935 ATGAAAAAAATGAGTGAGGAAGG - Intronic
1121598509 14:95185110-95185132 AAAAAAAATCAGAGTGAAGAGGG + Exonic
1122614356 14:103007047-103007069 GTGAGATGACTGAGTGAAGATGG + Intronic
1124457462 15:29857564-29857586 ATAAAATATGTATGTGAAGAGGG + Intronic
1126169682 15:45684767-45684789 ATTAAATATTTGTTTGAAGAAGG - Intronic
1126522880 15:49616311-49616333 ATAAAATATCTGTGTGTATATGG - Intronic
1127153207 15:56100087-56100109 ATGATATAATTGAGTGAAGCTGG + Intronic
1128592666 15:68915334-68915356 AAGAAATAACTTAGGGAAGAAGG - Intronic
1129186086 15:73907653-73907675 ATGGAACATGTGAGTGAGGATGG - Intergenic
1133491558 16:6274758-6274780 ATGAAATATCTAATTTAAAAGGG + Intronic
1133674115 16:8053777-8053799 AAGAAATATCGAAGTGAGGAAGG + Intergenic
1133694793 16:8252086-8252108 ATAAAATGTCTGATTGAACAAGG - Intergenic
1135579919 16:23616698-23616720 ATGAAATGTCTCAGTGAATATGG + Intronic
1138452235 16:57100236-57100258 AAGAAATCACTAAGTGAAGAAGG + Intronic
1139216586 16:65131445-65131467 ATGAAAGAGGTGAGTGAATAAGG - Intergenic
1139266013 16:65639138-65639160 TTGAAATTTCTGGGGGAAGATGG - Intergenic
1139516417 16:67454920-67454942 AGGAAAGATCTGAAGGAAGAGGG - Intronic
1139564299 16:67763673-67763695 ATCAGATACCTGAGTGAAGTGGG - Intronic
1141068056 16:80929901-80929923 AATAAATATCTGACTGAAGAAGG + Intergenic
1141274180 16:82570152-82570174 AAGAAATAACTGAGGGAAAAGGG + Intergenic
1143304442 17:5934755-5934777 ATGAAAGGTCTGAATGAAGGTGG + Intronic
1144301727 17:13927639-13927661 ATGAAATAGCTGAGGGAAATGGG + Intergenic
1145256690 17:21328276-21328298 ATGAGATATTTGAGGGAAAATGG - Intergenic
1145263472 17:21368172-21368194 ATTAAAAAGCTGAGAGAAGAGGG - Intergenic
1145319921 17:21759672-21759694 ATGAGATATTTGAGGGAAAATGG + Intergenic
1146557537 17:33839494-33839516 ATTACATATCAGAGTGTAGAAGG - Intronic
1148539608 17:48469841-48469863 ATCAAGTATCTGAGTGACCAAGG + Intergenic
1148977772 17:51544611-51544633 ATGGAACATCCAAGTGAAGATGG - Intergenic
1149277605 17:55061588-55061610 ATGAGGGATCTGAGTAAAGAGGG - Intronic
1151403417 17:73871111-73871133 ATGAAAGAGCTGAGGGAGGAAGG + Intergenic
1151536700 17:74743024-74743046 ATGAGATATCTGTGGGAAGGTGG - Intronic
1152719944 17:81918521-81918543 ATTAAAGATCTAAGTGAGGAGGG - Exonic
1153328583 18:3848509-3848531 TTGAAGTATCTAAGTGAAGTTGG - Intronic
1155235998 18:23819878-23819900 ATGAAGTATGAGATTGAAGACGG + Exonic
1156421935 18:36963331-36963353 ATGACATAGATGTGTGAAGAGGG + Intronic
1156598194 18:38572281-38572303 ATGAAGTCTCTGAGGTAAGAGGG + Intergenic
1159350748 18:67269415-67269437 ATGAAACAGCTGACTGATGAGGG + Intergenic
1159389636 18:67773082-67773104 ATGAAACATCTGATTGCAGAAGG - Intergenic
1159909512 18:74131965-74131987 ATGTAATGTCTGAGTCAAGGAGG - Intronic
1162407177 19:10481939-10481961 ATAAAATAACTGAGTGAAGGGGG + Intergenic
1162595209 19:11623336-11623358 ATGGGATATCAGAGTGAAAAAGG - Intergenic
1164510766 19:28895261-28895283 ACATAATCTCTGAGTGAAGAGGG + Intergenic
1166289406 19:41852433-41852455 ATCAAATAAATGAGTAAAGAAGG + Intergenic
1166449682 19:42887680-42887702 AAGGAATACCTGAGTGAAGCTGG - Intronic
1167214377 19:48154702-48154724 ATGAGATATAACAGTGAAGATGG - Intronic
925775985 2:7336291-7336313 ATGAGGAATATGAGTGAAGAGGG + Intergenic
925935969 2:8760248-8760270 ATTAAATATGTGCATGAAGATGG - Intronic
926254688 2:11181108-11181130 CTGAAATATTTGAGTAAAAAAGG - Exonic
926813759 2:16780070-16780092 CTGAGAGTTCTGAGTGAAGAGGG - Intergenic
928696030 2:33851179-33851201 ATGGAAAAACTGATTGAAGAAGG + Intergenic
928743868 2:34388933-34388955 ATGAAACATATGTGGGAAGATGG + Intergenic
929849481 2:45571012-45571034 ATGAGATATTTGAGGGAAAAGGG + Intronic
929900398 2:45996514-45996536 ATAAAATATCTCAGTAAACAAGG - Intronic
930506798 2:52292728-52292750 ATGAAATGTCTGAACCAAGAGGG + Intergenic
931186153 2:59953299-59953321 ATGAACTGTCTGGGGGAAGAAGG + Intergenic
931830231 2:66043498-66043520 ATCAACTGTCTGTGTGAAGATGG + Intergenic
933389011 2:81647872-81647894 ATGGAATGCCTGAGTTAAGATGG + Intergenic
934892540 2:98083296-98083318 TGGAAAGATCTGAGTGTAGAAGG + Intergenic
934910959 2:98253955-98253977 TTGAAGTATTTTAGTGAAGATGG + Intronic
936402564 2:112176517-112176539 ATGAAATATCTGTGGGGGGAAGG + Intronic
936642315 2:114328501-114328523 ATCTAATAACTGATTGAAGAGGG - Intergenic
938647399 2:133345761-133345783 ATGTAATATGGGAGTGGAGATGG + Intronic
938652140 2:133394374-133394396 AGGAAATCTCTCAGAGAAGATGG + Intronic
939087759 2:137742112-137742134 ATGAAAAATCATAGTGAAAATGG + Intergenic
939340773 2:140893927-140893949 ATGAAACATCAGGGTGGAGAGGG + Intronic
939936658 2:148301172-148301194 ATGAGTTAACTGAGTCAAGAAGG + Intronic
940012823 2:149072873-149072895 CTGAGACATTTGAGTGAAGATGG + Intronic
940753316 2:157653108-157653130 ATGAAATATCTTGGTTAACAGGG + Intergenic
941066265 2:160906460-160906482 ATGTAATATGTGTGTGAATATGG + Intergenic
943002413 2:182345175-182345197 ATTAATTATCTAAGTGGAGATGG - Intronic
943890236 2:193277175-193277197 ATCAAACGCCTGAGTGAAGAGGG - Intergenic
944267524 2:197745209-197745231 TTGAAATAAGTGAGTGAAGACGG + Intronic
945590876 2:211729787-211729809 ATGAAATATTTGAGCAAGGATGG - Intronic
945914848 2:215692622-215692644 AAGAAATATTTGAATGAAGAAGG - Intergenic
945995650 2:216433737-216433759 ATGAACAAACTCAGTGAAGAAGG + Intronic
946785045 2:223234887-223234909 ATGAAAGATCACAGGGAAGATGG - Intergenic
947873255 2:233451329-233451351 AGGAATTATCTGAGTGGAAAAGG + Intronic
948743032 2:240060661-240060683 ATGGAAAAACTGATTGAAGAAGG - Intergenic
1170092804 20:12609794-12609816 ATAAAATATCTGAGTCAATATGG - Intergenic
1170646987 20:18206613-18206635 ATGAATTATTAGAGTGAGGAGGG + Intergenic
1175184234 20:57169229-57169251 AGGAACTGTCTGAGTCAAGATGG + Exonic
1177408332 21:20699046-20699068 ATGAAATCTCTGAATGGAAATGG + Intergenic
1177631708 21:23737049-23737071 GTGAAATACCCGAGTTAAGATGG + Intergenic
1177696381 21:24578540-24578562 ACGAAATAGCTGTGTGAACATGG + Intergenic
1177798526 21:25804709-25804731 AAGAAAGAAATGAGTGAAGAAGG + Intergenic
1179119128 21:38526679-38526701 ATGTTATTTCTGAGTGAGGAGGG + Intronic
1179284527 21:39966141-39966163 ATAACTTTTCTGAGTGAAGATGG + Intergenic
1182273543 22:29170851-29170873 ACGAAACATCCGAGCGAAGAGGG + Intergenic
1183449794 22:37886846-37886868 GTGAGAGATCTGAGAGAAGAGGG + Intronic
951975128 3:28498084-28498106 AATAAATATCTGAGTCAAGTGGG + Intronic
953774787 3:45807190-45807212 TTGGAATAGCTCAGTGAAGAAGG - Intergenic
953803850 3:46051208-46051230 ATGAGATATCAGAGTGGAAAAGG - Intergenic
953872366 3:46638369-46638391 AAGAACTATCTTAGTGAAAAAGG - Intergenic
953934787 3:47032018-47032040 ATGACATATTTGAATGCAGAAGG - Intronic
955538003 3:59944679-59944701 AGGACATATTTGAGTGTAGAAGG - Intronic
955827776 3:62966477-62966499 AGGATATAACTGAGAGAAGAAGG - Intergenic
957025931 3:75181969-75181991 ATAAAATATCTTAGTGAACTAGG - Intergenic
957111828 3:75971349-75971371 AAGTAATATTTGAGTGATGAAGG + Intronic
957482135 3:80811924-80811946 ATGAATAATCTGAGAGAAGAAGG - Intergenic
959033546 3:101332966-101332988 ATGATATATCTTAAAGAAGATGG - Intronic
960043746 3:113176137-113176159 ATGAAATATTCAAGTGAAGATGG + Intergenic
963578475 3:147094548-147094570 AGCAAAGATCTGAGGGAAGAAGG + Intergenic
964635014 3:158848849-158848871 ATGAAATATGTGGGTGAGGGAGG + Intergenic
965005406 3:163016449-163016471 ATGATTTAGCTTAGTGAAGAGGG + Intergenic
965260607 3:166478960-166478982 ATGAAATAAATAAGTCAAGAGGG + Intergenic
965568307 3:170145060-170145082 ATGTAATAACTAAGTCAAGATGG - Intronic
965750770 3:171972831-171972853 CAGAAACATCTGGGTGAAGAGGG + Intergenic
967472077 3:189873515-189873537 GGGAAATATCTGGGTGCAGAAGG + Intronic
969193715 4:5544088-5544110 CTGAAATCTATGAGAGAAGAGGG + Intronic
971135510 4:23864088-23864110 GTGAAACCTATGAGTGAAGAGGG - Intronic
971929033 4:33054189-33054211 CTGAACTATTTGAGTGTAGAAGG - Intergenic
972708448 4:41569436-41569458 ATGGGGTATCTGAGTGATGAAGG - Intronic
973019699 4:45187473-45187495 AAAAAATAGCTGAGTGAGGAAGG + Intergenic
973562267 4:52149095-52149117 ATGAAATATCTGTAAAAAGATGG + Intergenic
973901381 4:55476211-55476233 ATGAAATATTTGAGATAACATGG + Intronic
974414352 4:61586200-61586222 ATGAAATTGATGAGTCAAGAGGG - Intronic
974982329 4:68974081-68974103 TTGAAATAACTCACTGAAGAGGG + Intergenic
974995132 4:69146623-69146645 ATGAAATAACGCACTGAAGAGGG - Intronic
975087801 4:70364640-70364662 CTGAAATATCTTGGTGAAGCAGG + Intronic
975089712 4:70387670-70387692 CTGAAATATCTTGGTGAAGCAGG + Intronic
976486520 4:85611872-85611894 ATTAAATATCTGAATGAAGAAGG - Intronic
977662860 4:99610945-99610967 TTCAAATATCTGAGTAATGAAGG + Intronic
977723633 4:100268879-100268901 GTGAATTATCTGAGGCAAGATGG - Intergenic
978905920 4:114005357-114005379 ATGGAATATCTGAATGAATGAGG + Intergenic
979408274 4:120341696-120341718 ATGAAATATTTTGGGGAAGAGGG + Intergenic
979900529 4:126210949-126210971 AGTAAATATGTGAGTGAAGAGGG + Intergenic
980070980 4:128242813-128242835 ATGAGAGATCAGATTGAAGATGG + Intergenic
980189116 4:129500915-129500937 ATGAAATAGCTAAGTCAAAAGGG + Intergenic
980785349 4:137547086-137547108 ATGAAATATCAGAGTCTAAATGG + Intergenic
981415629 4:144489534-144489556 AGGAATTATCTGAGTGATTAGGG + Intergenic
981764747 4:148235909-148235931 AAGAAATATATCAGTAAAGATGG - Intronic
982586723 4:157250827-157250849 ATGAAGTATGTGAGTGGAGGAGG - Intronic
983278574 4:165651269-165651291 ATGAAAAATATTAGTGAATAAGG + Intergenic
984239962 4:177206398-177206420 ATGAAAGACCTGGATGAAGAAGG - Intergenic
984478484 4:180267718-180267740 ATGAAATCTCTGAGCCCAGATGG + Intergenic
987749717 5:22023874-22023896 ATGACATAACTGTGTTAAGAGGG - Intronic
987949023 5:24652314-24652336 ATGAGATATCAGAGTGGAAAAGG + Intergenic
989521585 5:42408492-42408514 ATTAAATATATGAGTGAATAAGG + Intergenic
990045352 5:51423444-51423466 CTGATATATCTGAGAGAAGCAGG - Intergenic
990154475 5:52859814-52859836 CTGAAATATCTAAATTAAGAGGG - Intronic
990322333 5:54642140-54642162 ATGAAAGGTCTGAGAGAAGGAGG + Intergenic
991654001 5:68884699-68884721 ATGAAACATCCTAATGAAGAAGG + Intergenic
991681762 5:69147325-69147347 ATGACATATTTAAGTGCAGAAGG - Intergenic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
992984927 5:82218506-82218528 ATGACATATCCCAGTGATGATGG - Intronic
993249490 5:85500206-85500228 ATGATATTTCTGGGAGAAGAAGG - Intergenic
993725769 5:91364931-91364953 ATGAAATAAATGAATGAATATGG - Intergenic
993858589 5:93105630-93105652 ATGAAGTATCAGAATGAAGGGGG - Intergenic
994079854 5:95696487-95696509 ATTACATATCTGTGTGAAGCAGG - Intronic
994465646 5:100126254-100126276 ATCAAATTTCTGAGTGGACATGG + Intergenic
996184576 5:120460362-120460384 ATAAAATGTATGAGTGAACAAGG + Intergenic
996800028 5:127392908-127392930 ATGAAATATCTGCATGAATCTGG + Intronic
997284184 5:132666634-132666656 ATGAGATATCTGAGTGCAGTTGG - Intergenic
998637904 5:143976889-143976911 ATAAAATATCTGACTGGAAAGGG + Intergenic
998757985 5:145401614-145401636 AGGATATATATGAGTAAAGAAGG - Intergenic
999109551 5:149106648-149106670 AAGAAATATGTTAGTGAACATGG + Intergenic
999168667 5:149574047-149574069 ATGAAATATCTGAGTGAAAATGG + Intronic
999185607 5:149706065-149706087 ATGTAAAATCTTGGTGAAGAAGG + Intergenic
999265737 5:150265643-150265665 AAGAAATAACTGAATGAAGCTGG + Intronic
999372840 5:151066556-151066578 ATGAAAGATCAGAGTGAGAAAGG + Intronic
1000687912 5:164275415-164275437 ATGAAATACTTAAGTGAATATGG - Intergenic
1002208433 5:177580461-177580483 AGGAGAAATCTGTGTGAAGATGG + Intergenic
1002909657 6:1480114-1480136 ATTAAATGAATGAGTGAAGATGG - Intergenic
1004083135 6:12415917-12415939 ATGAGACATCTGAGTGAAGTGGG + Intergenic
1005116057 6:22338598-22338620 AAGAAATATTTGTTTGAAGAAGG + Intergenic
1006323143 6:33332737-33332759 ATGGAAAATCTGAGTGAAAGAGG - Intergenic
1009308097 6:62117762-62117784 ATAAAATATTTGAGTCAAAATGG - Intronic
1009360754 6:62809559-62809581 GTAAAATGTCAGAGTGAAGATGG + Intergenic
1010684984 6:78843814-78843836 ATGAAATTTCTCAATAAAGAAGG + Intergenic
1011562458 6:88634805-88634827 ATTTAATATGTGAGTGAAAATGG + Intronic
1012841873 6:104339247-104339269 ATGAAATATCTCCATGTAGAAGG - Intergenic
1016463700 6:144305581-144305603 ATGAAAGAAATGAGGGAAGAAGG + Intronic
1016478977 6:144460921-144460943 ATGAAATGTCTCTCTGAAGATGG - Intronic
1016630493 6:146224245-146224267 ATGAAATACCAGAGTGAGGTGGG + Intronic
1016883986 6:148941166-148941188 ATAATAAATCTGAGTGAAAAAGG - Intronic
1016941610 6:149486929-149486951 ATTAAGTGGCTGAGTGAAGATGG + Intergenic
1017020881 6:150139390-150139412 ATGAAATATTGGAATGAAAATGG + Intergenic
1018216451 6:161532779-161532801 CTGGGATATCTGAGTCAAGAAGG + Intronic
1018425331 6:163674873-163674895 AGTAAAGATCAGAGTGAAGAGGG + Intergenic
1021281898 7:18730224-18730246 GTGGAATAGCAGAGTGAAGATGG - Intronic
1022021808 7:26406855-26406877 ATCAAATGAATGAGTGAAGAAGG + Intergenic
1022192418 7:28029308-28029330 ATGAAATATCTTAGGAATGAAGG + Intronic
1022403844 7:30067746-30067768 CTGAAAATACTGAGTGAAGAAGG - Intronic
1024091371 7:45944212-45944234 ATGAGATAACTGAGTGCAAATGG - Intergenic
1024918972 7:54536698-54536720 ATGAGATATGTGTGAGAAGAGGG - Intergenic
1025017131 7:55448856-55448878 ATAAAATATGTCATTGAAGAGGG - Intronic
1025219696 7:57096397-57096419 ATGAGATGTCTGAGTTAAAAAGG + Intergenic
1025630486 7:63267943-63267965 ATGAGATGTCTGAGTTAAAAAGG + Intergenic
1026465235 7:70647995-70648017 TGGAAATAGCTGAGTGATGACGG + Intronic
1028029332 7:85889520-85889542 ATGAGATATGTGAGAAAAGAAGG - Intergenic
1030573323 7:111254127-111254149 ATGAGATTTCTGAGTGATAAAGG + Intronic
1030573451 7:111256492-111256514 GTGAAATATCTCATTGAAGAAGG + Intronic
1030678084 7:112405871-112405893 ATCAGATTTCTGAGAGAAGATGG - Intergenic
1031030213 7:116726396-116726418 TTGAGATCTCTGAGTCAAGAAGG - Intronic
1031260276 7:119508924-119508946 ATGAAACATCGGATTGAAGGTGG + Intergenic
1031496625 7:122457171-122457193 AAGAAATATCTAAGAGAAAAAGG + Intronic
1033425070 7:141236534-141236556 CTGCAATATTTGAGGGAAGATGG - Intronic
1033575975 7:142685307-142685329 ATGCAATATCTAAGAGAATATGG - Intergenic
1035248186 7:157578908-157578930 ATGAAATTATAGAGTGAAGAGGG + Intronic
1036071360 8:5443537-5443559 AAAAAAAAACTGAGTGAAGAGGG + Intergenic
1036207675 8:6817203-6817225 ATGCAATCTCTGGGTGAAGTGGG - Intronic
1037144085 8:15552528-15552550 AGGAAATAACCCAGTGAAGAGGG + Intronic
1037509105 8:19563692-19563714 ATTAAAGATCTGAGTGGAGGTGG - Intronic
1038066307 8:23967216-23967238 ATAAAATTTCTGAGTGAATGGGG - Intergenic
1038109569 8:24480444-24480466 ATGGAATCTCTGAGTTAAAAGGG - Intronic
1038175996 8:25182858-25182880 ATTTAATATGTGTGTGAAGAAGG + Intergenic
1038241741 8:25815781-25815803 ATGAGATATTTCACTGAAGATGG + Intergenic
1038317122 8:26495193-26495215 ATGTAATATTTGAGGGTAGAGGG + Intronic
1039732782 8:40297737-40297759 ATGAAATTCCAGAGTGGAGAAGG - Intergenic
1041077241 8:54179895-54179917 AGGAAATATCAGAGGTAAGAGGG - Intergenic
1041411113 8:57556532-57556554 AGGAAATATCTGCCTAAAGAAGG + Intergenic
1041920273 8:63174754-63174776 ATGAAATATCTAAATAAAGAGGG - Intronic
1042713029 8:71740677-71740699 ATCATATATCTGTTTGAAGAGGG + Intergenic
1042990133 8:74629989-74630011 AGGAATTCTCTGACTGAAGAAGG + Intronic
1044145705 8:88711125-88711147 ATGGAATATATGTGTAAAGAAGG + Intergenic
1044498216 8:92916808-92916830 CAGAAATATGTGAGTGAAAAAGG - Intronic
1045804687 8:106144678-106144700 CTGAAATATCTCAGTGAGGAAGG + Intergenic
1047164102 8:122417541-122417563 ATGATGTATCTAATTGAAGAGGG + Intergenic
1050214152 9:3303798-3303820 AGGAAATATGTGGGTGAAAATGG + Intronic
1050286520 9:4108401-4108423 ATGGAAACTCTGAGGGAAGAAGG + Intronic
1050714475 9:8506753-8506775 ATGAAATAACAGATTGTAGAAGG - Intronic
1052428350 9:28334182-28334204 ATGAAATATAAGAAAGAAGATGG + Intronic
1054748451 9:68880078-68880100 AAGAAAAATCTGAGGGAAGTAGG + Intronic
1054869027 9:70032169-70032191 ATTAAAGTTCTGAGTAAAGATGG - Intergenic
1056163847 9:83923183-83923205 ATGAAATATAGGAATGAAGGTGG + Intergenic
1057689010 9:97266249-97266271 ATGAAGTTTCTGAGTTAAGTTGG + Intergenic
1058647205 9:107141743-107141765 ATGAAATATCAGCTTGAACAAGG + Intergenic
1059626851 9:116076317-116076339 ATGAAATAACTGAGTTAAGTGGG - Intergenic
1186909549 X:14147442-14147464 ATGAAATATCTATGTAAAGAAGG - Intergenic
1187254691 X:17631542-17631564 ATTAAATAACTGAATGAAGGTGG + Intronic
1188906473 X:35798207-35798229 ATTCAATATCGGAGTGAACAGGG + Intergenic
1189059827 X:37741104-37741126 CTGAAAAATCTGAGTATAGAAGG + Intronic
1189523691 X:41797711-41797733 ATGAAATATCTGTGTGACTTCGG - Intronic
1189950282 X:46222854-46222876 ATGAAACATATGAGGGGAGAAGG + Intergenic
1190809321 X:53868360-53868382 GTGAAATATCTGAATAGAGAAGG - Intergenic
1191078091 X:56477813-56477835 ATGAAATTTCAGAATGAGGAGGG + Intergenic
1191213445 X:57911576-57911598 GTGAAATATCTGAGATGAGAAGG + Intergenic
1192121977 X:68464878-68464900 AAGAAATATGAGAGTGAGGAGGG + Intergenic
1194256265 X:91638617-91638639 ATGAGATAACTGAGTAAACAGGG + Intergenic
1195517574 X:105794853-105794875 AACAAATATCTGAGAAAAGAGGG - Intergenic
1197099245 X:122632552-122632574 CTGAAAAATCTGGGTAAAGAAGG - Intergenic
1197603590 X:128559498-128559520 ATGGAAGATCAGAGTGATGACGG + Intergenic
1197986179 X:132268736-132268758 ATGAAGTGTCTGAGTGAGGCCGG - Intergenic
1198543790 X:137670280-137670302 ATGAAATATATTAGTGGAAAGGG - Intergenic
1199651670 X:149951046-149951068 AGGAAATATCTGAGAGAGAAAGG - Intergenic
1200574995 Y:4877901-4877923 ATGAGATAACTGAGTAAACAGGG + Intergenic
1201497127 Y:14600554-14600576 ATGAAATATGTATGAGAAGAAGG + Intronic
1201553419 Y:15242888-15242910 ATGAATTTGCTGAGTGAAAATGG + Intergenic