ID: 1087297044

View in Genome Browser
Species Human (GRCh38)
Location 11:96389776-96389798
Sequence GCTCGCGCTCCCGGTGCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 22}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087297044_1087297046 -10 Left 1087297044 11:96389776-96389798 CCATTAGCACCGGGAGCGCGAGC 0: 1
1: 0
2: 1
3: 0
4: 22
Right 1087297046 11:96389789-96389811 GAGCGCGAGCGAGTCCCAGCCGG 0: 1
1: 0
2: 0
3: 4
4: 71
1087297044_1087297047 -9 Left 1087297044 11:96389776-96389798 CCATTAGCACCGGGAGCGCGAGC 0: 1
1: 0
2: 1
3: 0
4: 22
Right 1087297047 11:96389790-96389812 AGCGCGAGCGAGTCCCAGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087297044 Original CRISPR GCTCGCGCTCCCGGTGCTAA TGG (reversed) Intronic
904643022 1:31944738-31944760 GCTCGCTGTCCCGGTGCCAGCGG + Intronic
905183106 1:36178540-36178562 CCTCGCGCTCCCGCTGCTCCCGG - Exonic
1087297044 11:96389776-96389798 GCTCGCGCTCCCGGTGCTAATGG - Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1096073543 12:48788852-48788874 GCTCGGGCTCCCGGTGCGCCAGG - Intronic
1131181209 15:90241316-90241338 GATCAGGCTCCCGGTGCAAACGG - Exonic
1132889422 16:2196589-2196611 GCTCGGGCTCCCGGCGCGGAGGG + Intergenic
1142742050 17:1937015-1937037 GCGCGCGCTCCCTGTGGGAATGG - Exonic
1157805354 18:50653879-50653901 CCTCACGCTCCCATTGCTAACGG - Intronic
1158649548 18:59273419-59273441 GCTGGGGCTCTCGGCGCTAAAGG + Intronic
1164995835 19:32720075-32720097 GCTCCAGCTCCTGGTGCTGAAGG + Exonic
932776062 2:74529120-74529142 GCTCTCACTCACGGTGCTACAGG + Exonic
1183869257 22:40728879-40728901 GCTCGGGCTCCCAGCGCTCAGGG - Intergenic
967915028 3:194572331-194572353 ACTCGGGCTGCCGGAGCTAAAGG + Intergenic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG + Intergenic
1015503129 6:133953442-133953464 GCCCGCGCTCCCTGTGCCCAGGG - Intronic
1017324357 6:153129991-153130013 GCTCGCTCTCCCGGAGCCCAGGG + Intronic
1047406050 8:124586624-124586646 GGTCGCGCTCCCTGAGTTAAAGG + Intronic
1060480002 9:124012259-124012281 CCTGGCGCTCCTGGCGCTAACGG - Exonic
1193075163 X:77347606-77347628 GCTGGCGTTCCAGGTGCTACTGG - Intergenic
1194312393 X:92328195-92328217 GTTCCCTCTCCCTGTGCTAAAGG - Intronic
1194515356 X:94845212-94845234 GCTGGCGTTCCAGGTGCCAATGG + Intergenic
1200620662 Y:5442326-5442348 GTTCCCTCTCCCTGTGCTAAAGG - Intronic