ID: 1087307253

View in Genome Browser
Species Human (GRCh38)
Location 11:96501663-96501685
Sequence TCCAAGGCGGTGATGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087307253_1087307262 4 Left 1087307253 11:96501663-96501685 CCCACTGCCATCACCGCCTTGGA 0: 1
1: 0
2: 4
3: 13
4: 118
Right 1087307262 11:96501690-96501712 AGGGTAACACTGTCAGTATCTGG 0: 1
1: 1
2: 0
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087307253 Original CRISPR TCCAAGGCGGTGATGGCAGT GGG (reversed) Intronic
900992009 1:6102422-6102444 ACCAAGACGGTGAGGGCAGAGGG + Exonic
901218902 1:7571046-7571068 TCCATGAAGGTGAAGGCAGTTGG - Intronic
902641006 1:17766143-17766165 TCCACGGCTGTGATGGAGGTGGG + Intronic
904024464 1:27493519-27493541 CCCATGGGGGTGGTGGCAGTGGG + Intergenic
905291451 1:36924407-36924429 TCCAAGGTGCTGATGGCTGAGGG + Intronic
907331952 1:53677352-53677374 GCCAAGGCGGTACAGGCAGTGGG + Intronic
908141228 1:61187389-61187411 ACTAAGGCAGTTATGGCAGTTGG - Intronic
912451576 1:109770656-109770678 TCCAGGGCTGTCAGGGCAGTGGG - Intronic
915858904 1:159421767-159421789 GCCTGGGTGGTGATGGCAGTGGG + Intergenic
920377213 1:205515536-205515558 TCTAGGACGCTGATGGCAGTTGG + Intronic
921900715 1:220447742-220447764 TCCAAGGAGGTGATGGAGGAGGG + Intergenic
1063957131 10:11277414-11277436 TCCAGGGAGGTGAGGGCAGAGGG - Intronic
1064587041 10:16849694-16849716 GCCATGGCGGTGATGGCAAGAGG - Intronic
1064622400 10:17229198-17229220 TCCGCGGCTGGGATGGCAGTGGG + Intronic
1065040492 10:21689736-21689758 TCCAAGGAGTTGAAAGCAGTTGG + Intronic
1071031670 10:81192174-81192196 TCCAAGGAGATGATTGAAGTTGG - Intergenic
1076490468 10:130858044-130858066 TGCCAGGAGGTGATGGCAGAGGG - Intergenic
1076880787 10:133238185-133238207 TCCCAGGTGGAGATGGGAGTGGG + Intronic
1077546965 11:3176238-3176260 TCAAAGGCAGTGAAGGCAGCAGG + Intergenic
1080967084 11:37225165-37225187 TCCAAGCCTGTGGTGGCAGGTGG + Intergenic
1087307253 11:96501663-96501685 TCCAAGGCGGTGATGGCAGTGGG - Intronic
1097018738 12:56005329-56005351 AACAAGGCCTTGATGGCAGTAGG - Exonic
1097130041 12:56805034-56805056 TCCAAGCCTGTGAGGGCAGGGGG + Intergenic
1097559180 12:61180689-61180711 ACAAGGGCGGTGATAGCAGTTGG - Intergenic
1097701740 12:62827483-62827505 CTCAAGACAGTGATGGCAGTGGG - Intronic
1101706834 12:107228397-107228419 TCCAAGGAGGTCTAGGCAGTGGG - Intergenic
1112148866 13:96733907-96733929 TGCAAGGCTGTGGTGGCAGTGGG - Intronic
1114635617 14:24185166-24185188 ACCTAGGTAGTGATGGCAGTGGG - Exonic
1117485082 14:56188038-56188060 TCCAAGGAGGAAATGGCAGCTGG - Intronic
1119034826 14:71220623-71220645 ACCAAGGCAGTGGGGGCAGTGGG - Intergenic
1120730110 14:87992612-87992634 TTCATCGCGGAGATGGCAGTCGG - Intronic
1121844292 14:97159530-97159552 TCCCAGGAGGTGATGGAAGGAGG + Intergenic
1122027501 14:98888346-98888368 TCCAGGGGGGTGATGGTGGTGGG + Intergenic
1122506709 14:102236246-102236268 TCCAATGCAGTGATGGCAGATGG - Intronic
1124705413 15:31960011-31960033 TCCAAGGCTGTGCGGACAGTAGG - Intergenic
1129484988 15:75862195-75862217 TCCAAGGACGTGATGACAGGAGG + Intronic
1129663920 15:77568749-77568771 GCCAAAGCTGTGATGGAAGTTGG + Intergenic
1133687659 16:8181419-8181441 ACCACAGAGGTGATGGCAGTGGG + Intergenic
1138294912 16:55878007-55878029 TCCAAGGAGGTGATGTCAAGTGG - Intronic
1141440486 16:84026578-84026600 ACCCAGGAGGTGGTGGCAGTGGG + Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1143003491 17:3811108-3811130 TCCCAAGCTGTGACGGCAGTGGG - Intergenic
1143280654 17:5751930-5751952 TTCTAGGAGGTGGTGGCAGTGGG + Intergenic
1144759125 17:17697374-17697396 TACACAGCGGTGATGGCAGGTGG - Intronic
1146585402 17:34077717-34077739 CAAAAGGAGGTGATGGCAGTGGG - Intronic
1148652010 17:49257073-49257095 TCCAGGGAGGTCATGGCAGGTGG - Intergenic
1153096586 18:1413107-1413129 TCCCAGGCCTTGATGGGAGTTGG - Intergenic
1153798082 18:8643118-8643140 ACCAAGGTGGAGATGCCAGTAGG - Intergenic
1153817877 18:8806771-8806793 TCCCAGGTGTTGTTGGCAGTGGG - Intronic
1154297324 18:13162260-13162282 TCCCAGGAGGTGGAGGCAGTGGG + Intergenic
1158456873 18:57615959-57615981 CCCAAGGCTTTGATGACAGTAGG - Exonic
1160503844 18:79416594-79416616 TCCCAGGAGGTGATGGCAGCGGG - Intronic
1162468335 19:10856575-10856597 TCGAAGGCGGAGGTTGCAGTGGG - Intronic
1163809408 19:19421252-19421274 GCCAGGGAGGTGAGGGCAGTAGG + Intronic
1164393385 19:27844424-27844446 TCCAATGCAGTGACGGCAGATGG + Intergenic
1168301206 19:55406234-55406256 TCCACGGTGGTGATGGTGGTAGG - Intronic
1168593269 19:57653981-57654003 TCTAAGGTGGTGATGGTAGTGGG - Intergenic
927084114 2:19657304-19657326 TCTAAGTCTGTGATGGAAGTGGG + Intergenic
927248563 2:20978198-20978220 CCACAGGCGGTGGTGGCAGTAGG - Intergenic
928923323 2:36549184-36549206 TCTAAGGTGGTTATGGCAGCTGG - Exonic
928971989 2:37039078-37039100 TGCAAGGCTGAGATGGGAGTGGG + Intronic
931638557 2:64361971-64361993 TCCAAGGCGCTGAGCGTAGTAGG - Intergenic
932459850 2:71875151-71875173 TGCAAATCGGTGAAGGCAGTAGG - Intergenic
935789918 2:106581479-106581501 TCCACTGCGGTGCTGGCTGTGGG - Intergenic
936639108 2:114292665-114292687 TCCAGGACGGTGATGTCAGAAGG - Intergenic
939956764 2:148533905-148533927 TTCAAGGAGGTGATGAAAGTAGG - Intergenic
945198090 2:207256099-207256121 TCCAAGGCGGTGAAGGCAGGAGG + Intergenic
946143349 2:217710479-217710501 TGCATGGTGATGATGGCAGTTGG - Intronic
1173932917 20:46836815-46836837 TTCAGGGAGGTGATGGGAGTAGG + Intergenic
1174221296 20:48957687-48957709 TCCAAGGCTGTCATGTCAGCAGG + Intronic
1175207399 20:57321898-57321920 TCTAAGGCAGTGATTCCAGTGGG - Intergenic
1175982572 20:62746478-62746500 TCCAAGGCAGTGATGTTTGTGGG + Intronic
1177345702 21:19866320-19866342 TCTAAGGCTGGGATGGCATTTGG - Intergenic
1181760923 22:25058285-25058307 GGCAAGGTGGTGATGACAGTTGG - Intronic
1182046111 22:27275434-27275456 TCCAAGGGGGAGGTGGCATTTGG - Intergenic
1182357958 22:29730703-29730725 TCCAGGGCGGGGATGGCAGATGG + Exonic
1184560987 22:45262865-45262887 TCCAAGCCTGTGAGGGCAGGGGG + Intergenic
1184839414 22:47043772-47043794 TCCAAGGCTCTGAGGGCAGGGGG + Intronic
1185076114 22:48683598-48683620 TCCTAGGCTGTCCTGGCAGTGGG - Intronic
949940745 3:9152329-9152351 TCCAAGGTGGAGATGGGAGAGGG + Intronic
950473084 3:13198500-13198522 TCCTAGGCGGTGATGACCGCTGG + Intergenic
951485120 3:23202689-23202711 CCCAAGACGGTGCAGGCAGTGGG - Intergenic
953738267 3:45514635-45514657 GCCAAGGCTGTGATTTCAGTAGG + Intronic
957190824 3:77007147-77007169 TCCCAGGCTTTGATGCCAGTTGG - Intronic
957199650 3:77116192-77116214 TCCTGGACAGTGATGGCAGTTGG + Intronic
959038056 3:101387820-101387842 TCATTGGCAGTGATGGCAGTGGG - Intronic
963199093 3:142568694-142568716 TCCAAGTCTGTGAGGGCAGGGGG - Intronic
963423870 3:145097512-145097534 TCCATAGCAGTGATGGCTGTTGG + Intergenic
964003946 3:151808192-151808214 TCCAAAGCAGTGATGGCAGATGG - Intergenic
966068809 3:175849320-175849342 TCCAAGGTGGTCCTGGCTGTAGG - Intergenic
966421799 3:179741287-179741309 TGCAAGGCGGAGGTTGCAGTGGG - Intronic
969529534 4:7723111-7723133 TGCCACGCGGGGATGGCAGTTGG + Intronic
978138892 4:105295509-105295531 TAGAAGGCAGAGATGGCAGTGGG + Intergenic
981665340 4:147218734-147218756 TCTAAGGCTGGGATGGCAGGTGG + Intergenic
985578327 5:683971-683993 TTGAAGGCTGTGATGGCAGCCGG - Intronic
992198817 5:74364569-74364591 TCCAAGGCCCTGATGGCAGGAGG + Intergenic
997263343 5:132480277-132480299 TCCTAGTGGGTGATGGCAGGTGG - Intergenic
997310850 5:132880890-132880912 TCCAAAGCGATCATGTCAGTTGG - Exonic
999361813 5:150992095-150992117 TCCAAGGTGGTGATGGTGGTGGG + Intergenic
1003838823 6:10099250-10099272 CCCAAGGAGGTGACGGCAGGTGG - Intronic
1006285637 6:33092082-33092104 GCCAAGGCCGTGAGGGCAGAGGG + Intergenic
1006583254 6:35088663-35088685 GCGATGGCGGTGGTGGCAGTGGG - Exonic
1009598836 6:65771838-65771860 TCCAAGGCTGTGCTGCAAGTGGG - Intergenic
1015159431 6:130136085-130136107 ACCAGGGTGGTGGTGGCAGTAGG - Intronic
1020787980 7:12592902-12592924 TCCGATGCAGTGATGGCAGTGGG + Intronic
1021296836 7:18918361-18918383 TCCAAGAATGTGATGGCACTAGG + Intronic
1022040951 7:26580590-26580612 TCCATGGCCTTGATGACAGTGGG - Intergenic
1025875760 7:65478563-65478585 TCCAATGCAGTGACGGCAGATGG - Intergenic
1029479660 7:100804926-100804948 CCCAGGGCTGTGATGGCAGGAGG + Intronic
1030895214 7:115051245-115051267 GCCAAGGAGGTGATGACAATGGG + Intergenic
1032443293 7:131958957-131958979 CCCAAGGAGGTGATGGCCGAGGG - Intergenic
1037403325 8:18515560-18515582 TTCATGGCAGTGATGGCTGTTGG + Intergenic
1037513180 8:19604176-19604198 ACCAAGGGGGTCTTGGCAGTGGG - Intronic
1041024335 8:53668680-53668702 TCCAAGACGGAGGTGGCAGCAGG + Intergenic
1043212456 8:77540313-77540335 TCCAAAGCAGTGATGGAGGTAGG + Intergenic
1044161082 8:88915836-88915858 TCCAGGGCTGTTATGGCTGTTGG - Intergenic
1047518639 8:125577239-125577261 TCCAAGGTGGTGATAGGACTCGG + Intergenic
1047613099 8:126540034-126540056 TCCAAAGCGATGCTGTCAGTTGG - Intergenic
1048781351 8:138005759-138005781 TCCCAGGTGGTCCTGGCAGTGGG - Intergenic
1049856516 8:144865346-144865368 TCCGAGGTGGTGATGGCAGTTGG + Intergenic
1052794639 9:32912157-32912179 TCCAAGGAGATGGTTGCAGTAGG - Intergenic
1056099581 9:83287856-83287878 TCCACTGGGGAGATGGCAGTGGG - Intronic
1056277241 9:85005352-85005374 TCCAAGATGGTGATGGAAGACGG - Intronic
1060175454 9:121494273-121494295 GCAGAGGCAGTGATGGCAGTGGG - Intergenic
1060375255 9:123111107-123111129 CCCAAGGTAGTGATGGCAGCTGG - Intronic
1186798265 X:13067137-13067159 TCCAAGGCAGAGAGGCCAGTGGG + Intergenic
1191641423 X:63432390-63432412 TCCGAGGTGGTGATGGCGGTGGG + Intergenic
1191778687 X:64845009-64845031 TCCAATGCAGTGATGGCAGAGGG - Intergenic
1192774033 X:74223376-74223398 TCGGAGGCGGAGATTGCAGTGGG - Intergenic
1193571388 X:83149393-83149415 TCCATGATGGTGATGGCTGTTGG + Intergenic
1194142283 X:90221185-90221207 TCCGTGGTGGTGATGGCAGTGGG + Intergenic
1195949668 X:110255263-110255285 TCCCAGGCGTTGATTACAGTGGG - Intronic
1199074331 X:143511870-143511892 TCCGAGGTGGTGATGGCAGTAGG - Intronic
1199093333 X:143715137-143715159 TCCGAGGTGGTGATGGCAGTAGG - Intronic
1200488036 Y:3790286-3790308 TCCGTGGTGGTGATGGCAGTGGG + Intergenic
1201310777 Y:12596715-12596737 TCCAATGCAGTGATAGCAGATGG + Intergenic