ID: 1087311715

View in Genome Browser
Species Human (GRCh38)
Location 11:96551472-96551494
Sequence GATCTGGACGAAAAGAACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087311715_1087311721 10 Left 1087311715 11:96551472-96551494 CCCCTGTTCTTTTCGTCCAGATC No data
Right 1087311721 11:96551505-96551527 ATGTTTACCAGCACACCACTGGG No data
1087311715_1087311722 11 Left 1087311715 11:96551472-96551494 CCCCTGTTCTTTTCGTCCAGATC No data
Right 1087311722 11:96551506-96551528 TGTTTACCAGCACACCACTGGGG No data
1087311715_1087311728 21 Left 1087311715 11:96551472-96551494 CCCCTGTTCTTTTCGTCCAGATC No data
Right 1087311728 11:96551516-96551538 CACACCACTGGGGTAGGGGCGGG No data
1087311715_1087311723 15 Left 1087311715 11:96551472-96551494 CCCCTGTTCTTTTCGTCCAGATC No data
Right 1087311723 11:96551510-96551532 TACCAGCACACCACTGGGGTAGG No data
1087311715_1087311724 16 Left 1087311715 11:96551472-96551494 CCCCTGTTCTTTTCGTCCAGATC No data
Right 1087311724 11:96551511-96551533 ACCAGCACACCACTGGGGTAGGG No data
1087311715_1087311730 25 Left 1087311715 11:96551472-96551494 CCCCTGTTCTTTTCGTCCAGATC No data
Right 1087311730 11:96551520-96551542 CCACTGGGGTAGGGGCGGGATGG No data
1087311715_1087311720 9 Left 1087311715 11:96551472-96551494 CCCCTGTTCTTTTCGTCCAGATC No data
Right 1087311720 11:96551504-96551526 AATGTTTACCAGCACACCACTGG No data
1087311715_1087311726 17 Left 1087311715 11:96551472-96551494 CCCCTGTTCTTTTCGTCCAGATC No data
Right 1087311726 11:96551512-96551534 CCAGCACACCACTGGGGTAGGGG No data
1087311715_1087311727 20 Left 1087311715 11:96551472-96551494 CCCCTGTTCTTTTCGTCCAGATC No data
Right 1087311727 11:96551515-96551537 GCACACCACTGGGGTAGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087311715 Original CRISPR GATCTGGACGAAAAGAACAG GGG (reversed) Intergenic
No off target data available for this crispr