ID: 1087311722

View in Genome Browser
Species Human (GRCh38)
Location 11:96551506-96551528
Sequence TGTTTACCAGCACACCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087311717_1087311722 9 Left 1087311717 11:96551474-96551496 CCTGTTCTTTTCGTCCAGATCTG No data
Right 1087311722 11:96551506-96551528 TGTTTACCAGCACACCACTGGGG No data
1087311716_1087311722 10 Left 1087311716 11:96551473-96551495 CCCTGTTCTTTTCGTCCAGATCT No data
Right 1087311722 11:96551506-96551528 TGTTTACCAGCACACCACTGGGG No data
1087311719_1087311722 -5 Left 1087311719 11:96551488-96551510 CCAGATCTGGTTGTTAAATGTTT No data
Right 1087311722 11:96551506-96551528 TGTTTACCAGCACACCACTGGGG No data
1087311715_1087311722 11 Left 1087311715 11:96551472-96551494 CCCCTGTTCTTTTCGTCCAGATC No data
Right 1087311722 11:96551506-96551528 TGTTTACCAGCACACCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087311722 Original CRISPR TGTTTACCAGCACACCACTG GGG Intergenic
No off target data available for this crispr