ID: 1087311730

View in Genome Browser
Species Human (GRCh38)
Location 11:96551520-96551542
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087311717_1087311730 23 Left 1087311717 11:96551474-96551496 CCTGTTCTTTTCGTCCAGATCTG No data
Right 1087311730 11:96551520-96551542 CCACTGGGGTAGGGGCGGGATGG No data
1087311715_1087311730 25 Left 1087311715 11:96551472-96551494 CCCCTGTTCTTTTCGTCCAGATC No data
Right 1087311730 11:96551520-96551542 CCACTGGGGTAGGGGCGGGATGG No data
1087311716_1087311730 24 Left 1087311716 11:96551473-96551495 CCCTGTTCTTTTCGTCCAGATCT No data
Right 1087311730 11:96551520-96551542 CCACTGGGGTAGGGGCGGGATGG No data
1087311719_1087311730 9 Left 1087311719 11:96551488-96551510 CCAGATCTGGTTGTTAAATGTTT No data
Right 1087311730 11:96551520-96551542 CCACTGGGGTAGGGGCGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087311730 Original CRISPR CCACTGGGGTAGGGGCGGGA TGG Intergenic
No off target data available for this crispr